1. The specific primer of the molecular marker of the Mongolian sheep fertility related gene BMP15 is characterized by comprising the following sequences:

SEQ ID NO.1：5′-ATTTTGTGGCATCTCCAACC-3′；

SEQ ID NO.2：5′-ACCCCAAACCGTCTAGATCC-3′。

2. the use of the primer specific for the molecular marker of Mongolian sheep fertility related gene BMP15 as claimed in claim 1.

3. The use of the molecular marker specific primer of Mongolian sheep fertility related gene BMP15 as claimed in claim 1 in assisting Mongolian sheep breeding.

4. The use of the molecular marker specific primer of Mongolian sheep fertility related gene BMP15 in claim 1 in screening of Mongolian sheep breeder sheep with multiparous character.

5. A method for improving the fertility of a Mongolian sheep, comprising the step of amplifying the genomic DNA of the Mongolian sheep by using the specific primer of claim 1.

6. The method for increasing the number of lambs born to Mongolian sheep as claimed in claim 5, wherein said method comprises the steps of:

(1) extracting the genomic DNA of the Mongolian sheep to be detected;

(2) taking the genomic DNA of the Mongolian sheep extracted in the step (1) as a template, and carrying out PCR amplification by using a specific primer to obtain an amplification product;

(3) judging the gene type of 50980656 basic groups of the X chromosome where the BMP15 gene of the Mongolian sheep genome is located in the amplification product, and selecting the Mongolian sheep of which the 50980656 basic groups of the BMP15 gene are the TC gene type as a breeding parent.

7. The method for improving the fertility of Mongolian sheep, according to claim 6, wherein the total volume of the amplification system is 50 μ L during PCR amplification in step (2), wherein the specific primers are 1 μ L each, the template is 2 μ L, the premix is 25 μ L, and the deionized water is 21 μ L.

8. The method for improving the fertility of Mongolian sheep according to claim 6, wherein the PCR amplification program in step (2) comprises pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 64 ℃ for 30s, extension at 72 ℃ for 50s, 35 cycles and extension at 72 ℃ for 10 min.

Background

Mongolian sheep (Ovis aries) is one of three major crude sheep varieties in China, and is mainly distributed in inner Mongolia, northeast, northwest and the like, wherein the Mongolian sheep is a common ancestor of Chinese short-tail and fat-tail sheep varieties including Sunit sheep, Wuzhu Qin sheep, Renlebel sheep, Tan sheep, Banyin Bruk sheep, small-tail Han sheep, Duolan sheep, Hu sheep and the like. The Wuzhu Mucun sheep is produced in Wuzhu Mucun grassland in the northeast of Heilon union of inner Mongolia autonomous region, has the characteristics of fast fat gaining, strong fat accumulation capacity, high meat production rate, early sexual maturity and the like, and gradually forms the most main fine breed mutton sheep in a Mongolia sheep system after long-term breeding. The Sunit sheep are laid in the left and right Sunit flags of the Turingle union of the autonomous region of inner Mongolia, have the name of Gobi sheep, have strong adaptability, can quickly cripple fat under the condition of grazing in the whole year without any servo, and have full muscles, strong physique, tender meat, no mutton smell, good taste and higher fertility, thereby being famous nationwide.

The polyembryony character is an important economic character of the Mongolian sheep and has extremely important significance for the development of the Mongolian sheep breeding industry, so that the improvement of the polypeptide character is an important direction for improving the economic benefit of the Mongolian sheep breeding industry.

BMP15(bone morphogenic protein15), bone morphogenetic protein15, also known as bone morphogenetic protein15, is a highly conserved functional protein belonging to the TGF- β family. The BMP15 protein is an oocyte-secreted factor, which is expressed mainly in oocytes of female animals and secreted extracellularly, and performs biological functions by binding to specific receptors on the membranes of granulocytes/sheaths surrounding the oocytes. The sheep BMP15 gene is located at Xp24 position of X chromosome, its total length is 6490bp, two exons are separated by an intron, and it codes 393 amino acid residues of proprotein, and its mature active peptide is 125 amino acids. It was found that BMP15 could activate the expression of c-Kit ligand Kit-L (Kit ligand)326 in granulosa cells surrounding oocytes, and Kit-L could also inhibit the expression of BMP15 in the opposite direction by paracrine cKit receptor acting on oocytes, thus forming a negative feedback regulation loop between BMP15 of oocytes and Kit-L of granulosa cells surrounding the oocytes, and the two finally reached a dynamic equilibrium state. In the process of follicular development, BMP15, as an oocyte secretion factor, participates in the regulation of signal cascade and dialogue between cells in follicles, promotes the development of oocytes themselves, and the growth and differentiation of granulosa cells, thereby promoting the development of follicles. 79 ova and follicular fluid of women who receive intracytoplasmic sperm microinjection assisted pregnancy are researched and collected, the levels of BMP15, FSH, estradiol (E2) and progesterone (Progesterone, P4) in the follicular fluid are detected by a Western-blot or radioimmunoassay method, and the results show that the protein level of BMP15 in the follicular fluid is positively correlated with the level of E2, in addition, the in-vitro fertilization rate and the quality of embryos forming transplantation are also positively correlated with the level of BMP15 in the follicular fluid, which shows that the content of BMP15 in the follicular fluid can be used as a potential factor for predicting the quality of the ova and the success rate of embryo development. Further studies demonstrated that BMP15 is involved in activating the ERK1/2 signaling pathway to regulate rat granulocytic mitosis by adding signaling pathway inhibitors to rat primary GCs and human GC cell line COV434 cultured in vitro; BMP15 and GDF9 can enhance the expression of EGF receptor of cumulus cells, thereby promoting the diffusion of the cumulus cells and participating in an SMAD2/3 dependent pathway; BMP15 regulates the synthesis of ovarian steroid hormones (E2 and P4) and the expression of LHR (luteinizing hormone receptor) through FSH mediation, which indicates that BMP15 is an upstream regulatory factor of cAMP-PKA hormone synthesis signal path and can promote follicle growth and ovulation regulation mediated by LHR. Therefore, the BMP15 gene is considered to be an important gene affecting the ovulation rate and litter size of mammals.

A Single Nucleotide Polymorphism (SNP) refers to a DNA sequence polymorphism caused by a change in a Single nucleotide, and has advantages of large quantity, high density, high genetic stability, and the like, and is widely used. The genetic markers are associated with growth traits, so that selective breeding is realized at the DNA level, artificial influence is effectively avoided, the accuracy of selective breeding is improved, individuals with excellent traits can be identified at an early stage, excellent backup parents are screened out, the breeding period is shortened, and the breeding process is greatly accelerated.

BMP15 gene mutant was discovered in Inverdale gene in 1991, and in the same year, Davis et al used classical separation method to locate FceX gene on Romney sheep X chromosome, because carrier heterozygote can increase ewe polypeptide characterThis gene mutant was designated as Inverdale multiple-fetus site (FecX)^I). In 1995, Davis et al demonstrated FecX in Romney sheep multiple-fetus strain^IThe presence of a site has thus begun a widespread and systematic study of this gene and its site. The FceX gene was located 10cM in the middle of the X chromosome, a region corresponding to the human X chromosome Xp 112-114. The sheep BMP15 gene was localized to the 10cM region of the X chromosome, which is the same region as FecXI (prolific X gene), and was later confirmed to be a BMP15 gene mutant. Galloway et al found that mutation of BMP15 gene on X chromosome was associated with high ovulation number in ewer-carrying ewe heterozygous for the Inverdale and Hanna sheep breed and sterility in ewer-carrying homozygous FecX^Gr/FecX^Gr-GrivetteAnd homozygote FecX^O/FecX^O-OlkuskaEwes are highly proliferative rather than sterile. The B1 mutation is also found to not change the function of BMP15 of the Bellar and Cambridge sheep, but can improve the average polypeptide character of the Mongolian sheep, and the B2 and B4 mutations can cause the homozygous Bellar and Cambridge sheep to be sterile, while the heterozygous individual has more ovulation. The 3bp deletion (c.302_304delCTA) and c insertion (c.310insC) in the sheep Tunisian Barbarian BMP15 cDNA resulted in a frame shift at protein position 101, increasing ovulation rate and polypeptide character of sheep Tunisian Barbarian. Thus, BMP15 functions differently in different sheep breeds.

Disclosure of Invention

The invention aims to provide a specific primer of a molecular marker of Mongolian sheep fertility related gene BMP 15.

Still another object of the present invention is to provide the use of the above specific primer.

The invention adopts a DNA sequencing technology to detect whether g.50980656T > C mutation sites exist in the BMP15 gene No.2 exon regions in the Mongolian sheep genome to be detected, so as to determine the genotype of Mongolian sheep individuals at the sites, and compare the polymorphism of BMP15 gene g.50980656T > C in Mongolian sheep varieties. The nucleotide Sequence NCBI Reference Sequence of the BMP15 gene is an sheep X chromosome of NC-019484.2, and the region is 50979729bp to 50989218 bp.

The BMP15 gene mutation site was named using the HGVS (human Genome Variation society) nomenclature: NC _ 019484.2: g.50980656T > C.

According to the specific embodiment of the invention, the primer sequence of the molecular marker specific primer of the Mongolian sheep fertility related gene BMP15 is as follows:

SEQ ID NO.1：5′-ATTTTGTGGCATCTCCAACC-3′；

SEQ ID NO.2：5′-ACCCCAAACCGTCTAGATCC-3′。

the invention provides application of a molecular marker specific primer of a gene BMP15, for example, application of the molecular marker specific primer of the gene BMP15 in assisting breeding of Mongolian sheep, application of the molecular marker specific primer of the gene BMP15 in screening Mongolian sheep breeders with a multiparous character, or application of the molecular marker specific primer of the gene BMP15 in screening a kit of the Mongolian sheep breeders with the multiparous character.

According to the method for improving the fertility of the Mongolian sheep, the method comprises the step of amplifying the genomic DNA of the Mongolian sheep by using the specific primer.

According to the specific embodiment of the invention, the method for increasing the number of lambs born by Mongolian sheep comprises the following steps:

(1) extracting the genomic DNA of the Mongolian sheep to be detected;

(2) taking the genomic DNA of the Mongolian sheep extracted in the step (1) as a template, and carrying out PCR amplification by using a specific primer to obtain an amplification product;

(3) judging the gene type of 50980656 basic groups of the X chromosome of the BMP15 gene of the Mongolian sheep genome in the amplification product, and selecting the Mongolian sheep of which the 50980656 basic groups of the BMP15 gene are TC gene types as breeding parents.

When selecting the Mongolian sheep breeding sheep with the multiparous character, the steps of the method are carried out according to

(1) Extracting the genomic DNA of the Mongolian sheep to be detected;

(2) taking the genomic DNA of the Mongolian sheep extracted in the step (1) as a template, and carrying out PCR amplification by using a specific primer to obtain an amplification product;

(3) judging the gene type of 50980656 basic groups of the BMP15 gene of the Mongolian sheep genome in the amplification product, selecting the Mongolian sheep of which the 50980656 basic groups of the BMP15 gene are TC gene types, and screening to obtain the Mongolian sheep breeder sheep with the multiparous character.

The detection method of the BMP15 gene g.50980656T > C mutation site in the Mongolian sheep genome is that a PCR method is utilized to amplify nucleotide fragments from 50979978 to 50981664 of a Mongolian sheep X chromosome genome GenBank Accession Number NC-019484.2, DNA sequencing is carried out on an amplification product, if a single peak appears at the position of 50980656 th basic group of the BMP15 gene and the genotype is T, the genotype is TT, if a nested peak appears at the position of 50980656 th basic group of the BMP15 gene, the genotype is TC, and if a single peak appears at the position of 50980656 th basic group of the BMP15 gene and the genotype is C, the genotype is CC.

The average polyembryony character of the TC genotype Mongolian sheep of g.50980656T > C is higher than that of TT genotype.

In the invention, the multiple-birth character is the number of lambs born by each fetus; the fertility of Mongolian sheep is embodied as the number of lambs produced per fetus.

According to the method for improving the fertility of the Mongolian sheep, in the PCR amplification in the step (2), the total volume of an amplification system is 50 mu L, wherein each of the upstream primer and the downstream primer is 1 mu L, the template is 2 mu L, the premixed solution is 25 mu L, and the deionized water is 21 mu L.

According to the method for improving the fertility of the Mongolian sheep, the PCR amplification program in the step (2) is pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 64 ℃ for 30s, extension at 72 ℃ for 50s, 35 cycles and extension at 72 ℃ for 10 min.

The invention has the beneficial effects that:

the invention discovers that g.50980656T > C mutation sites exist in an exon 2 region of a BMP15 gene (the nucleotide Sequence NCBI Reference Sequence of the BMP15 gene is an X chromosome of an sheep with NC-019484.2, and the region from 50979729bp to 50989218 bp) and are molecular markers related to the multiparous characters of Mongolian sheep.

The invention designs a specific primer, adopts a DNA sequencing technology to detect whether g.50980656T > C mutation exists in the BMP15 gene No.2 exon region in the Mongolian sheep genome, realizes the single nucleotide polymorphism detection of BMP15 gene g.50980656T > C by determining the genotype of Mongolian sheep at the site, and compares the polymorphism of BMP15 gene g.50980656T > C site in Mongolian sheep varieties.

The data statistics result shows that the specific primer can detect the molecular marker, so that the specific primer can be used for assisting in the breeding of Mongolian sheep and improving the lambing number of the Mongolian sheep.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only some embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the drawings without creative efforts.

FIG. 1 is NC-019484.2 of BMP 15: g.50980656T > sequencing of C site.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the technical solutions of the present invention will be described in detail below. It is to be understood that the described embodiments are merely exemplary of the invention, and not restrictive of the full scope of the invention. All other embodiments, which can be derived by a person skilled in the art from the examples given herein without any inventive step, are within the scope of the present invention.

Example 1 molecular markers for determining the rate of twining in Mongolian sheep

1) Template material preparation

Blood samples of Mongolian sheep were collected and the number of births was recorded, 250 Mongolian sheep samples were selected from Sunit left flag and Dong Wu Zhumu Qin flag in autonomous region of inner Mongolia, and the blood samples were stored in anticoagulation tubes for later use.

2) Sequencing of PCR products

Sequencing PCR products of 250 collected Mongolian sheep, and finding out SNP locus located at BMP 15X chromosome, namely NC _ 019484.2: g.50980656T > C site.

3) Primer design

According to the gene sequence of a sheep reported by GeneBank (GeneBank accession number: NC-019484.2), the invention automatically optimizes upstream primers M-F and M-R, and the sequence is as follows:

M-F：5′-ATTTTGTGGCATCTCCAACC-3′；

M-R：5′-ACCCCAAACCGTCTAGATCC-3′。

and (3) taking the genome extracted from the Mongolian sheep experimental material as a template, and respectively amplifying by using the primers. The amplification system is the same as the following primer and primer amplification system. The total volume of the amplification system is 50 muL, wherein, the upstream and downstream primers are 1 muL respectively, the template is 2 muL, the premix is 25 muL, and the deionized water is 21 muL.

The process of amplifying the nucleotide fragment containing g.50980656T > C mutation sites: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 64 ℃ for 30s, extension at 72 ℃ for 50s, 35 cycles, extension at 72 ℃ for 10min, storage at 4 ℃ and sequencing.

The nucleotide sequence of the PCR product is shown in SEQ ID NO. 3:

ATTTTGTGGCATCTCCAACCCAGATTTGAAGCAATAGCAGACCATACCCCCCAATATTGGACTGTCACCCTAAAGCTGCCACTATATAGTGATATAGCATGAGGATTTATTATTAATTCGTATGTTTCAATGATCCTCTTAATTGGTCACCTTTTTAATAGTCAGCTAAATAATACAATATATACAGACAGTTCTGTATTTGAGGTGTTTTTCTCCGTCTAGGGGTATGAGTGATCTAAAAATGAGCCACAATTTGTCATCTTAAGGGAAAAAGACTTGGACTCAAATCTTTATTCTAACAAACACTGGCTTGTGTGTCCTCTGGCATAGCTTCTCTGAGCTTCAGTTTCCTCGTCTGCAAAATGGGAATAGCAACTATCTCATAAGGCTATTGTGGATTCAAGAGCAAATGCATGTAAAGCATCTAATACATTATATAAGTGCTCAATAGATCGCTATTATGATCTTAAATTCATCTCAAGGCTGCTTGTCAGTTTGTACTGAGCAGGTCTGTTAGAGAGACTAAGGCTAGGATATAAGAAGCTAACGCTTTGCTCTTGTTCCCTCTTACTAATGCAGGCTCCTGGCACATACAGACCCTGGACTTTCCTCTGAGACCAAACCGGGTAGCATACCAACTAGTCAGAGCCACTGTGGTTTACCGCCATCAGCTTCACCTAACTCATTCCCACCTCTCCTGCCATGTGGAGCCCTGGGTCCAGAAAAGCCCAACCAATCACTTTCCTTCTTCAGGAAGAGGCTCCTCAAAGCCTTCCCTGTTGCCCAAAACTTGGACAGAGATGGATATCATGGAACATGTTGGGCAAAAGCTCTGGAATCACAAGGGGCGCAGGGTTCTACGACTCCGCTTCGTGTGTCAGCAGCCAAGAGGTAGTGAGGTTCTTGAGTTCTGGTGGCATGGCACTTCATCATTGGACACTGTCTTCTTGTTACTGTATTTCAATGACACTCAGAGTGTTCAGAAGACCAAACCTCTCCCTAAAGGCCTGAAAGAGTTTACAGAAAAAGACCCTTCTCTTCTCTTGAGGAGGGCTCGTCAAGCAGGCAGTATTGCATCGGAAGTTCCTGGCCCCTCCAGGGAGCATGATGGGCCTGAAAGTAACCAGTGTTCCCTCCACCCTTTTCAAGTCAGCTTCCAGCAGCTGGGCTGGGATCACTGGATCATTGCTCCCCATCTCTATACCCCAAACTACTGTAAGGGAGTATGTCCTCGGGTACTACACTATGGTCTCAATTCTCCCAATCATGCCATCATCCAGAACCTTGTCAGTGAGCTGGTGGATCAGAATGTCCCTCAGCCTTCCTGTGTCCCTTATAAGTATGTTCCCATTAGCATCCTTCTGATTGAGGCAAATGGGAGTATCTTGTACAAGGAGTATGAGGGTATGATTGCCCAGTCCTGCACATGCAGGTGACGGCAAAGGTGCAGCTAGCTCAGGTTTGCCCAAGAAATTCGAAAAGGATTTATAATAAATACTGTTAAATCTGAGAGTGCTCAACCCAAGTGCTCTACCCAATCTGTAGATTCTATTCCTTGCCTTCAGCATTGTACTTTAAGTCTTCTTCCCCTATTTATGAGTGCCTCACTTTATAAACAGTTCTGATGCCAAATATCAGTATGTTTTGACCACTAGTCAATCTTCTGAGGATCTAGACGGTTTGGGGT

as shown in FIG. 1, if a single peak appears at the 50980656 th base position of BMP15 gene and the genotype is T, the genotype is TT, if a nested peak appears at the 50980656 th base position of BMP15 gene, the genotype is TC, and if a single peak appears at the 50980656 th base position of BMP15 gene and the genotype is C, the genotype is CC.

Example 2 analysis of relation between BMP15 genotype and multiparous character of Mongolian sheep

2.1BMP15 genotype testing

The primer designed according to the example 1 is used for carrying out gene detection on Mongolian sheep, and the genotype frequency and the allele frequency of the Mongolian sheep are calculated, and the statistical results are shown in the table 1.

TABLE 1 distribution of G.50980656T > C locus genotype frequencies and allele frequencies in Mongolian sheep

Note: the number of samples is in parentheses.

The results in Table 1 show that the g.50980656T > C mutation site is polymorphic in the Mongolian sheep population.

2.2 Association analysis

(1) Performing individual genotype analysis on the locus in the selected test sample population, calculating allele frequency and genotype frequency, and performing χ²And (6) checking.

(2) Calculating the gene frequency and the genotype frequency of the locus according to the test result, and carrying out Hardy-Weinberg balanced chi-square suitability test on the distribution of the locus genotype. The association of multiparous traits of the mongolian sheep population with the BMP15 genotype was analyzed using the one-way anova of SPSS 19.0.

TABLE 2 estimated values and standard errors for different genotypes and multiparous traits in Mongolian sheep

Note: values are expressed as mean ± sem; the lower case letters in the same column indicate significant difference (P < 0.05).

As can be seen from Table 2, the average number of lambs per fetus in the Mongolian sheep with TC genotype of g.50980656T > C is significantly higher than that of TT genotype (P < 0.05). The result shows that the genotype of the locus can be used for screening the Mongolian sheep with high polyembryony character.

Example 3 method for screening Mongolian sheep with multiple birth characters

The method for improving the fertility of the Mongolian sheep comprises the following steps:

(1) extracting the genomic DNA of the Mongolian sheep to be detected;

(2) carrying out PCR amplification by using a specific primer;

the genome extracted from Mongolian sheep experimental materials is used as a template, the primers described in example 1 are used for amplification, and the total volume of an amplification system is 50 mu L, wherein each of the upstream and downstream primers is 1 mu L, the template is 2 mu L, the premix solution is 25 mu L, and the deionized water is 21 mu L.

The process of amplifying the nucleotide fragment containing g.50980656T > C mutation sites: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 64 ℃ for 30s, extension at 72 ℃ for 50s, 35 cycles, and extension at 72 ℃ for 10 min.

The amplification product was stored at 4 ℃ and sequenced.

Judging the gene type of 50980656 basic groups of BMP15 gene in Mongolian sheep genome in the amplification product, selecting 50980656 basic groups of BMP15 gene as TC gene type Mongolian sheep, and using the Mongolian sheep as a breeding parent.

Meanwhile, the 50980656 th basic group of the BMP15 gene is selected as a TC genotype Mongolian sheep, and the Mongolian sheep with the multiparous character can be obtained by screening.

The above description is only for the specific embodiments of the present invention, but the scope of the present invention is not limited thereto, and any person skilled in the art can easily conceive of the changes or substitutions within the technical scope of the present invention, and all the changes or substitutions should be covered within the scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the protection scope of the appended claims.

Sequence listing

<110> university of inner Mongolia

Original animal husbandry company Limited of the Meng of the Silvery Guo

Xilinhot breeding center

<120> specific primer of molecular marker of Mongolian sheep fertility related gene BMP15 and application

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

attttgtggc atctccaacc 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

accccaaacc gtctagatcc 20

<210> 3

<211> 1687

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

attttgtggc atctccaacc cagatttgaa gcaatagcag accatacccc ccaatattgg 60

actgtcaccc taaagctgcc actatatagt gatatagcat gaggatttat tattaattcg 120

tatgtttcaa tgatcctctt aattggtcac ctttttaata gtcagctaaa taatacaata 180

tatacagaca gttctgtatt tgaggtgttt ttctccgtct aggggtatga gtgatctaaa 240

aatgagccac aatttgtcat cttaagggaa aaagacttgg actcaaatct ttattctaac 300

aaacactggc ttgtgtgtcc tctggcatag cttctctgag cttcagtttc ctcgtctgca 360

aaatgggaat agcaactatc tcataaggct attgtggatt caagagcaaa tgcatgtaaa 420

gcatctaata cattatataa gtgctcaata gatcgctatt atgatcttaa attcatctca 480

aggctgcttg tcagtttgta ctgagcaggt ctgttagaga gactaaggct aggatataag 540

aagctaacgc tttgctcttg ttccctctta ctaatgcagg ctcctggcac atacagaccc 600

tggactttcc tctgagacca aaccgggtag cataccaact agtcagagcc actgtggttt 660

accgccatca gcttcaccta actcattccc acctctcctg ccatgtggag ccctgggtcc 720

agaaaagccc aaccaatcac tttccttctt caggaagagg ctcctcaaag ccttccctgt 780

tgcccaaaac ttggacagag atggatatca tggaacatgt tgggcaaaag ctctggaatc 840

acaaggggcg cagggttcta cgactccgct tcgtgtgtca gcagccaaga ggtagtgagg 900

ttcttgagtt ctggtggcat ggcacttcat cattggacac tgtcttcttg ttactgtatt 960

tcaatgacac tcagagtgtt cagaagacca aacctctccc taaaggcctg aaagagttta 1020

cagaaaaaga cccttctctt ctcttgagga gggctcgtca agcaggcagt attgcatcgg 1080

aagttcctgg cccctccagg gagcatgatg ggcctgaaag taaccagtgt tccctccacc 1140

cttttcaagt cagcttccag cagctgggct gggatcactg gatcattgct ccccatctct 1200

ataccccaaa ctactgtaag ggagtatgtc ctcgggtact acactatggt ctcaattctc 1260

ccaatcatgc catcatccag aaccttgtca gtgagctggt ggatcagaat gtccctcagc 1320

cttcctgtgt cccttataag tatgttccca ttagcatcct tctgattgag gcaaatggga 1380

gtatcttgta caaggagtat gagggtatga ttgcccagtc ctgcacatgc aggtgacggc 1440

aaaggtgcag ctagctcagg tttgcccaag aaattcgaaa aggatttata ataaatactg 1500

ttaaatctga gagtgctcaa cccaagtgct ctacccaatc tgtagattct attccttgcc 1560

ttcagcattg tactttaagt cttcttcccc tatttatgag tgcctcactt tataaacagt 1620

tctgatgcca aatatcagta tgttttgacc actagtcaat cttctgagga tctagacggt 1680

ttggggt 1687