1. A composition comprising optionally three or more microorganisms selected from the group consisting of Clostridium aerogenes (Clostridium), Bacteroides (Bacteroides), Bifidobacterium (Bifidobacterium), and Lactobacillus (Lactobacillus).

2. A primer set comprising a primer for detecting the composition of claim 1.

3. The primer set according to claim 2, wherein the primer set comprises: the primers for detecting the gas producing sandwich steamed bread fungus are respectively shown as SEQ ID NO: 1 and SEQ ID NO: 2 is shown in the specification; primers for detecting bacteroides are shown as SEQ ID NO: 4 and SEQ ID NO: 5 is shown in the specification; the primers for detecting bifidobacterium are respectively shown as SEQ ID NO: 7 and SEQ ID NO: 8 is shown in the specification; the primers for detecting lactobacillus are respectively shown as SEQ ID NO: 10 and SEQ ID NO: shown at 11.

4. The primer set according to claim 3, further comprising: the sequence of the probe for detecting the gas producing sandwich steamed bun fungus is shown as SEQ ID NO: 3 is shown in the specification; the sequence of the probe for detecting bacteroides is shown as SEQ ID NO: 6 is shown in the specification; a probe for detecting bifidobacteria, the sequence of which is shown in SEQ ID NO: 9 is shown in the figure; the sequence of the probe for detecting the lactobacillus is shown as SEQ ID NO: shown at 12.

5. A kit for predicting childhood obesity, comprising the composition of claim 1 and/or the primer set of any one of claims 2 to 4.

6. A method of detecting obesity in a child, comprising the steps of:

(1) separating the feces of the children to be detected;

(2) detecting the content of pathogenic bacteria (Clostridium), Bacteroides (Bacteroides), Bifidobacterium (Bifidobacterium) and Lactobacillus (Lactobacillus) in the excrement in the step (1);

(3) comparing the contents of aerogenic bacteria (Clostridium), Bacteroides (Bacteroides), Bifidobacterium (Bifidobacterium) and Lactobacillus (Lactobacillus) in the feces to be detected and the feces of normal children;

(4) and obtaining the result of whether the children to be detected are suffered from the obesity.

7. The method for detecting obesity in children as claimed in claim 6, wherein the step (2) is performed by fluorescent quantitative PCR.

8. The method for detecting childhood obesity according to claim 7, wherein the primer set according to any one of claims 2 to 4 is used in step (2).

9. The method for detecting childhood obesity according to claim 7, wherein the determination method in the step (4) is: the amount of lactobacillus and gas-producing sandwich steamed bread fungus in the excrement of the obese children is obviously higher than that of the normal children, and the amount of bacteroides and bifidobacterium is obviously lower than that of the normal children.

10. The composition as claimed in claim 1 and the primer set as claimed in any one of claims 2 to 4 for preparing a reagent for detecting obesity in children.

Background

The intestinal tract is the largest immune organ of the human body, and the entire flora of the intestinal tract is called the "second genome of the human body" which is the largest micro-ecosystem. Human 70% of the antibodies are derived from this, containing 60% of lymphocytes throughout the body. The total amount of intestinal microorganisms reaches 100 trillion, 1/3 of the dry weight of the feces is bacteria, and the total number of bacteria per gram of feces is about: 1000 hundred million. Intestinal microecology is a system consisting of three parts: the intestinal flora, the intestinal mucosal epithelium and the intestinal mucosal immune system, which together constitute the mucosal barrier of the intestine, in which the intestinal flora plays the most important role. 90% of the microbial colonies live in your intestinal tract, which is 10 times the total number of human cells.

The intestinal flora, as people age, reduces the amount of beneficial bacteria in the body, especially bifidobacteria, and increases the amount of harmful bacteria, such as clostridium podophyllum.

Intestinal homeostasis refers to the state of homeostasis resulting from the interaction of the host mucosal barrier with the intestinal microflora (including intestinal flora, nutrients and metabolites, etc.). The mechanical barrier, the immune barrier and the biological barrier formed by combining the normal flora of the intestinal tract and the intestinal mucosa can maintain the stable environment in the organism and effectively prevent the invasion of harmful substances. The intestinal micro-ecosystem is the most complex and bulky micro-ecosystem of the human body. Human intestinal tracts contain more than 800 genera and more than 7000 strains. Their enormous number (about 100 trillion, i.e., 10 times the total number of human cells, with a total weight of 1-1.5kg) constitutes the intestinal microbiome. In the normal body, symbiotic bacteria (meaning bacteria that live with the living body) are mainly distributed in the intestinal lumen, mucosal surfaces and potentially in the intestinal associated lymphoid tissues. The intestinal flora is influenced by various factors such as environment, life style, dietary habits, medicines, operations and the like, and participates in a plurality of physiological activities of organisms; plays an important role in maintaining the normal physiological function of the intestinal tract, regulating the immunity of the organism, antagonizing pathogenic microorganism colonization and the like.

The gut flora has a fundamental impact on the development and function of the host immune system, while the immune system has evolved sufficiently to maintain a symbiotic relationship with the gut flora. The influence of intestinal flora on human health is increasingly attracting the attention of many international research teams. Numerous studies have shown that alterations in intestinal homeostasis structure and function are closely related to the development of metabolic diseases, inflammatory diseases and tumors. With the implementation of the genome project of the intestinal microorganisms, the development of metagenomics, functional genomics, metabonomics and proteomics is continuous, and the research on the microecology of the digestive tract is widely regarded. By analyzing the composition, distribution, physiological and biochemical characteristics, functions, mutual relations and the relation between the microbial communities and hosts in human intestinal tracts, an important theoretical basis can be provided for the follow-up research of the relation between intestinal homeostasis and body health.

Current epidemiological, pathological, omic, cellular and animal studies reveal that microorganisms in the gut mediate, to a considerable extent, human metabolic health and disease risk. The collection of these tiny organisms that reside in various cavities of the human body, we refer to microorganisms, which contain a large number of bacteria, fungi, bacteriophages, eukaryotic viruses, and fungi. Most of them are symbiotic or intergrowth microorganisms. The collection of all gut microbial genes (i.e., microbiome) of a person represents a genetic pool with a number of genes that is a magnitude higher than the human genome. The intestinal microbiome plays an important role in improving host immunity, food digestion, gut endocrine function and nerve signal regulation, drug function and metabolism, endotoxin clearance, and affecting the production of substances related to host metabolism. The disordered intestinal flora can cause a plurality of common metabolic diseases, including obesity, type 2 diabetes, nonalcoholic liver disease, metabolic heart disease, malnutrition and the like. Researchers have discussed the relationship of gut flora to obesity, T2D, metabolic liver disease, and cardiometabolic disease, and it has been reported that the diversity of the affected gut flora is generally reduced compared to healthy people, and more so compared to traditional lifestyle people.

Numerous reports indicate that disruption of gut microbiome classification and functional potential is associated with a number of pathological phenotypes. Most studies in humans and animals are observational and lack experimental data. However, as revealed by the genetic repertoire of human gut microbiota, trillions of commensals are a huge chemical plant that can synthesize many compounds required for self-survival and host survival.

The complexity of the gut microbiota is daunting. In the future, intestinal microbial detection based on sequencing and culture is combined with the mechanism research of intestinal flora, archaea, phage group, virome and mycobacteria, and the understanding of the interaction of the intestinal microbial communities is exponentially improved. Furthermore, importantly, the gut microbiome produces a variety of chemicals that affect host physiology and a variety of pathologies, and new knowledge about these chemicals may open new avenues for intervention in effective metabolic diseases, providing more therapeutic basis for stabilizing the metabolic health of the whole human, and preventing or combating common metabolic diseases in humans.

With the rapid development of economy, the daily living standard of people is also increasing day by day, and the types and habits of diet are also changed greatly, so that overweight and overweight obesity are also increasing in popularity, and the number of overweight and obese people in the world accounts for about 30% of the total number of people. In recent years, researches show that the intestinal flora plays a very significant role in the human body internal environment and is related to many types of diseases of the human body, particularly to overweight obesity, and the distribution of the intestinal flora has great significance for the balance and regulation of energy in the intestinal tracts of children.

The problem of overweight and obesity in preschool children is also serious, and overweight and obesity have seriously affected the normal life and health of children, so the reason for overweight and obesity should be studied. Obesity has been a global problem and as its incidence increases year by year, it has been recognised as a pathological condition. The risk of overweight and obesity is numerous, while the risk of obesity in children is more severe and long-lasting.

Therefore, providing a microbial population that can detect childhood obesity is of great significance for both the prevention and treatment of childhood obesity.

Disclosure of Invention

In order to solve the problems of inaccurate detection and low feasibility of the obesity of the children at present, the invention provides the following technical scheme.

The invention discloses a composition, which comprises optional three or more than three microorganisms selected from aerogenic bacteria (Clostridium), Bacteroides (Bacteroides), Bifidobacterium (Bifidobacterium) and Lactobacillus (Lactobacillus).

The invention discloses a primer group, which comprises a primer for detecting the composition.

Preferably, the primer set comprises: the primers for detecting the gas producing sandwich steamed bread fungus are respectively shown as SEQ ID NO: 1 and SEQ ID NO: 2 is shown in the specification; primers for detecting bacteroides are shown as SEQ ID NO: 4 and SEQ ID NO: 5 is shown in the specification; the primers for detecting bifidobacterium are respectively shown as SEQ ID NO: 7 and SEQ ID NO: 8 is shown in the specification; the primers for detecting lactobacillus are respectively shown as SEQ ID NO: 10 and SEQ ID NO: shown at 11.

Preferably, the primer set further comprises: the probe for detecting the gas producing sandwich steamed bread fungus has a sequence shown in SEQ ID NO: 3 is shown in the specification; the sequence of the probe for detecting bacteroides is shown as SEQ ID NO: 6 is shown in the specification; a probe for detecting bifidobacteria, the sequence of which is shown in SEQ ID NO: 9 is shown in the figure; the sequence of the probe for detecting the lactobacillus is shown as SEQ ID NO: shown at 12.

Preferably, the probe is labeled with a fluorophore.

Preferably, the fluorescent group is selected from FAM, BHQ-MGB, TAMRA, TET, HEX, ROX.

The invention discloses a kit for predicting childhood obesity, which is characterized by comprising the composition and/or the primer group.

The invention discloses a method for detecting obesity of children, which is characterized by comprising the following steps:

(1) separating the feces of the children to be detected;

(2) detecting the content of pathogenic bacteria (Clostridium), Bacteroides (Bacteroides), Bifidobacterium (Bifidobacterium) and Lactobacillus (Lactobacillus) in the excrement in the step (1);

(3) comparing the contents of aerogenic bacteria (Clostridium), Bacteroides (Bacteroides), Bifidobacterium (Bifidobacterium) and Lactobacillus (Lactobacillus) in the feces to be detected and the feces of normal children;

(4) and obtaining the result of whether the children to be detected are suffered from the obesity.

Preferably, the step (2) is determined by a fluorescent quantitative PCR method.

Preferably, the step (2) adopts the primer group of any one of claims 2 to 4.

Preferably, the determination method in the step (4) is: the contents of lactobacillus and gas-producing sandwich steamed bread fungus in the feces of obese children are obviously higher than that of normal children, and the contents of bacteroides and bifidobacteria are obviously lower than that of normal children.

The invention discloses an application of the composition and the primer group in preparation of a reagent for detecting obesity in children.

The present invention provides a composition that can be used to detect obesity.

The invention discovers that the contents of the bacteria of the Chinese hamburger (Clostridium), the Bacteroides (Bacteroides), the Bifidobacterium (Bifidobacterium) and the Lactobacillus (Lactobacillus) in the excrement of normal children and obese children have obvious difference.

Wherein, the quantity of lactobacillus and air-producing Chinese hamburger in the excrement of the obese children is obviously higher than that of the normal children, and the quantity of bacteroides and bifidobacteria is obviously lower than that of the normal children.

The invention further provides a fluorescent quantitative PCR method for detecting the content of Marble gas generating bacteria (Clostridium), Bacteroides, bifidobacteria and Lactobacillus in excrement.

The invention further provides a primer and a probe for detecting the content of the pathogenic bacteria (Clostridium), Bacteroides, Bifidobacterium and Lactobacillus in the excrement.

The invention designs a primer and a probe capable of amplifying yield of Chinese hamburger (Clostridium), Bacteroides (Bacteroides), Bifidobacterium (Bifidobacterium) and Lactobacillus (Lactobacillus) according to 16srDNA sequences of the Chinese hamburger (Clostridium), Bacteroides (Bacteroides), Bifidobacterium (Bifidobacterium) and Lactobacillus (Lactobacillus). Whether the child is suffering from obesity is determined by further measuring the content of pathogenic bacteria (Clostridium), Bacteroides (Bacteroides), Bifidobacterium (Bifidobacterium) and Lactobacillus (Lactobacillus) in the feces.

The method has the advantages of high specificity and sensitivity, simple and accurate operation and suitability for popularization and application.

Drawings

FIG. 1 shows the results of strain specificity detection, wherein Lane 1 is Marasmius aeroginosum, Lane 2 is Bacteroides, Lane 3 is Bifidobacterium, Lane 4 is Lactobacillus, Lane 5 is Clostridium bardii, Lane 6 is Escherichia coli, Lane 7 is Escherichia coli, and Lane 8 is Clostridium.

FIG. 2 shows the fluorescent quantitative PCR of Lactobacillus.

FIG. 3 is a standard curve of Lactobacillus.

FIG. 4 shows the fluorescence quantitative PCR of Bifidobacterium.

FIG. 5 is a standard curve for Bifidobacterium.

FIG. 6 shows fluorescence quantitative PCR of Bacteroides.

FIG. 7 is a standard curve for Bacteroides.

FIG. 8 is a fluorescent quantitative PCR image of Marasmius aeroginosum.

FIG. 9 is a standard curve of Marble's bacteria in the gas.

Detailed Description

The following examples further illustrate the present invention but are not to be construed as limiting the invention. Modifications or substitutions to methods, procedures, or conditions of the invention may be made without departing from the spirit and scope of the invention.

Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

Example 1 specificity of detection of gut microorganisms

Corresponding primers and probe sequences are designed according to the sequences of Lactobacillus (Lactobacillus), Bifidobacterium (Bifidobacterium), Bacteroides (Bacteroides) and Clostridium aeroginosum (Clostridium)16 srDNA.

Wherein, the primer and probe sequences of the lactobacillus are respectively as follows: a sense primer: 5 'gc cgcgtgagtg aagaag 3'; antisense primer: 5 'gcatggactaccagggtatct 3'; the probe sequence is as follows: 5 'ctgtcctcttctgcactcaag 3'; the amplified fragment was approximately 600bp in length.

The primer and probe sequences of the bifidobacterium are respectively as follows: a sense primer: 5 'tccggaatta ttgggcgt 3'; antisense primer: 5 'gatgcttaacgcgttagc 3'; the probe sequence is as follows: 5 'aattcccgg tgtaacggtg ga 3'; the amplified fragment was approximately 300bp in length.

The primer and probe sequences of the bacteroides are respectively as follows: a sense primer: 5 'gatgactgc cctatgggtt 3'; antisense primer: 5 'aaactttcacaactgactt 3'; and (3) probe sequence: 5 'gagttagccgatccttattcataa 3'; the amplified fragment was approximately 200bp in length.

The primer and probe sequences of the gas producing Mariothis sp are respectively as follows: a sense primer: 5 'ATTAGCTAGTTGGTGGGGT 3'; antisense primer: 5 'CTTAATCATCCGCCTACGCTC 3'; the probe sequence is as follows: 5 'CACGCGGCGTTGCTGCATCAGGGTTTCCCC 3'; the length of the amplified fragment was about 350 bp.

Establishing a PCR reaction system: mu.L of the bacterial suspension, forward primer, 10. mu. mol/L0.5. mu.L, reverse primer 10. mu. mol/L0.5. mu.L, DNA TAQ Master (2X) 10. mu.L, and water was added to 20. mu.L. Reaction conditions are as follows: pre-denaturation at 95 ℃ for 30s, denaturation at 95 ℃ for 20s, annealing at 59 ℃ for 15s, and extension at 72 ℃ for 30s, for 30 cycles.

Several other microorganisms common to children's feces were taken, including: using the bacterium liquid as a template for PCR amplification reaction to carry out PCR amplification reaction, and carrying out gel electrophoresis detection after the reaction is finished, wherein the detection result is shown in figure 1.

As can be seen from the detection results in FIG. 1, the primers of the present invention have good specificity, and can distinguish lactobacillus, bifidobacterium, bacteroides and Aeromonas sobria in feces of children without amplifying other common strains in feces.

Example 2 detection of primer sensitivity and establishment of Standard Curve

And (3) recovering 16S rDNA gene products from each bacterium to be used as a standard substance, and preparing a standard curve after gradient dilution, thereby realizing absolute quantification of a certain type of bacteria in a sample to be detected.

2.116 recovery of rDNA Gene product

Cutting agarose gel containing a target band under an ultraviolet transilluminator, and recovering a target fragment for preparing a standard substance by using an agarose gel DNA recovery kit, wherein the specific steps are as follows:

(1) adding 500 mul of equilibrium liquid BL into the adsorption column, 11000 r.min^-1Centrifuging for 1min, discarding waste liquid in the collecting tube, and replacing the adsorption column in the collecting tube.

(2) To the gel mass, 5 volumes of solution PN (0.1g gel volume ≈ 100. mu.l) was added, and the mixture was placed in a 50 ℃ water bath for 10min to completely dissolve the gel mass.

(3) Cooling to room temperature, adding into adsorption column CA2, standing at room temperature for 2min, and 11000 r min^-1。

Centrifuging for 1min, discarding waste liquid in the collecting tube, and replacing the adsorption column in the collecting tube.

(4) Add 600. mu.l rinse to adsorption column CA2Liquid PW, 11000 r.min^-1Centrifuging for 1min, discarding waste liquid in the collecting tube, and replacing the adsorption column in the collecting tube.

(5) Repeating the previous step.

(6)11 000r·min^-1Centrifuging for 2min, removing rinsing liquid as much as possible, and air drying at room temperature.

(7) Placing adsorption column CA2 in a new centrifuge tube, adding 50 μ l elution buffer solution to the middle position of the adsorption membrane, standing at room temperature for 2min, 11000 r.min^-1The DNA solution was collected by centrifugation for 2 min.

(8) Putting the collected liquid into the adsorption column again for 11000 r.min^-1Centrifuging for 2min to increase DNA recovery. The concentration of the DNA template is recovered by ultramicro spectrophotometry detection, and the DNA template is frozen and stored at the temperature of minus 20 ℃ for standby after subpackaging.

2.2 standard quality pellet dilution:

diluting the recovered DNA template standard substance with calculated copy number by 10 times, and selecting the copy number of 10 per microliter⁶、10⁵、10⁴、10³、10²、10¹、10⁰The sample (2) is subjected to qPCR detection, and the sensitivity of the detection method is determined.

2.3 establishment of fluorescent quantitative PCR reaction System

Preparing a fluorescent quantitative PCR reaction solution: the reaction volume was 25. mu.L, and a negative control, 10 XPCR buffer 2.5. mu.L, 4 XPNTP (2.5mM), 2. mu.L, MgCl, was also set₂2.5 μ L (25mM), 0.25 μ L of upstream primer (0.25 μ M), 0.25 μ L of downstream primer (0.25 μ M), 0.75 μ L of Taq enzyme (IU/. mu.L), 3 μ L of DNA template, 2.5 μ L of fluorescent dye SYBRgreene, and 11.75 μ L of double distilled water. After mixing, 50 μ L of paraffin wax was added to prevent evaporation of the reaction solution, the reaction solution was marked, the cap was closed, and the mixture was put into a GenemAP5700 fluorescent quantitative PRC apparatus in order for amplification and analysis.

Fluorescent quantitative PCR reaction conditions: pre-denaturation at 95 ℃ for 30 s; denaturation at 95 ℃ for 5s, annealing at 60 ℃, extension, fluorescence collection for 32s, 40 cycles, and finally entering a dissolution curve program to detect whether non-specific amplification exists.

And (3) preparing a standard curve by taking the copy number of the 16S rDNA gene in the standard as an abscissa and taking the Ct value in a quantitative PCR instrument as an ordinate.

The fluorescence quantitative PCR graph and the standard curve of the lactobacillus are respectively shown in FIG. 2 and FIG. 3, and the obtained standard curve equation is: -3.0058x +36.246, R²＝0.9965。

The fluorescence quantitative PCR graph and the standard curve of the bifidobacterium are respectively shown in fig. 4 and fig. 5, and the obtained standard curve equation is as follows: y-3.0124 x +36.882, R²＝0.9983。

The fluorescence quantitative PCR graph and the standard curve of Bacteroides are respectively shown in FIG. 6 and FIG. 7, and the obtained standard curve equation is: -3.0447x +37.086, R²＝0.9976。

The fluorescence quantitative PCR graph and the standard curve of the gas-producing sandwich steamed bun fungus are respectively shown in FIG. 8 and FIG. 9, and the obtained standard curve equation is as follows: -2.7806x +37.115, R²＝0.9988。

From the results obtained, it can be seen that there is a good linear relationship between the logarithm of the copy number and the Ct value, the R of which is²The values are all above 0.99. We obtain respective standard curve equations, and then we can estimate the copy number of the sample by testing the Ct value of the sample and substituting the Ct value into the equation.

Example 3 preparation of genomic DNA of fecal gut flora from Normal and obese Children

3.1 selection of samples

The height and body mass of the study subjects (preschool) were measured and the BMI was calculated according to the international algorithm. The standard of overweight and obesity is determined according to the standard recommended by the international health organization based on BMI indexes of different ages and different sexes. 15 overweight and obese children were used as experimental groups, and 15 normal children were randomly selected as control groups. The relevant conditions for children are shown in table 1 below.

Table 1: basic conditions of children in experimental group and control group

3.2 fecal Collection

For the subjects meeting the requirements, fresh morning faeces were kept in sterile dried faeces collection boxes, stored at 4 ℃ and sent to the laboratory within 4h and stored in a-80 ℃ freezer.

3.3 fecal flora genome DNA (adopting a fecal genome extraction kit of Bai ai Ke company), the specific operation steps are as follows:

1) weighing about 0.2g of the frozen excrement specimen and putting the weighed excrement specimen into a 2ml centrifuge tube;

2) weighing about 300mg of glass beads with the diameter of 0.1mm and pouring the glass beads into the step 1;

3) sucking 1.4ml of Buffer L by using a microsyringe, adding, oscillating for about 2min, and sealing by using a sealing film;

4) putting the centrifuge tube into 95 deg.C water bath for 5min, taking out, and oscillating for 2 min;

5) adding 180 μ L lysozyme with concentration of 20mg/ml, placing in 37 deg.C water bath for 30min, taking out, centrifuging for 2min at 5000 g;

6) taking 1.2ml of supernatant, putting into 2ml centrifuge tubes, putting 1 piece of inhibitor Ex Tablet into each tube, performing vortex breaking for 1min, standing at room temperature for 1min, and centrifuging at 14000rpm for 3 min;

7) sucking out the supernatant, putting into a 1.5ml centrifuge tube, and centrifuging at 14000rpm for 3 min;

8) 5 mu L of protease K is absorbed and put into a new centrifugal tube of 1.5 ml;

9) sucking 2ml of supernatant in a 7-step centrifuge tube, putting the supernatant in an 8-step centrifuge tube, adding 200 mu L of Buffer AL, performing vortex breaking for 15s, and performing water bath at 70 ℃ for 10 min;

10) taking out, adding 200 μ L ethanol (96% -100%), performing vortex breaking, centrifuging briefly, and removing liquid adhered to the top cover and the inner wall;

11) transferring the liquid in the step 10 into a cylindrical tube and a 2ml collecting tube, centrifuging for 1min at 14000rpm, and transferring the cylindrical tube into a new 2ml collecting tube;

transferring the columnar tube to a new 2ml for collection;

12) adding 500 μ L Buffer 1, centrifuging at 14000rpm for 1min, and transferring the cylindrical tube into a new 2ml collecting tube;

13) adding 500 μ L Buffer2, centrifuging at 14000rpm for 3min, transferring the cylindrical tube into a new 2ml collecting tube, and centrifuging at 4000rpm for 1 min;

14) placing the cylindrical tube into a new 1.5ml centrifuge tube, placing 100 μ L buffer AE, centrifuging at room temperature for 3min and 1000rpm for 1 min;

15) discarding the column tube, covering the centrifuge tube cover, marking, and storing in a refrigerator at-20 deg.C.

Example 4 determination of the content of Lactobacillus, Bifidobacterium, Bacteroides, Momo aerogenes in feces of children

The extracted fecal genomic DNA of each child sample was diluted by a certain factor and used as a fluorescent quantitative PCR template for fluorescent quantitative PCR according to the method of example 2. According to the standard curve of each strain, the obtained result is logarithmically converted and then expressed by Algx +/-Blxg, the comparison of various bacterial copies between the obesity group and the control group is tested by using SPSS For Windows 22.0 statistical software package line t, and the judgment of difference by P (less than 0.05) has statistical significance. The copy number of the bacterial species in the feces of each child sample is further calculated and the average value is calculated. The measurement results are shown in Table 2.

Table 2: quantitative results of four groups of bacteria in feces of two children (Algx + -Blxg copy number/g wet stool)

Type of enteric bacteria	Fat group (15 cases)	Normal group (15 cases)	t value	p value
					Lactobacillus strain	9.652±0.971	7.823±0.673	2.565	0.132
Bacteroides sp	8.332±0.713	9.881±0.776	1.432	0.241
					Bifidobacterium	6.482±0.819	7.993±0.682	0.573	0.087
Producing qi with fungus of steamed bread	7.496±0.815	5.463±0.732	0.087	0.301

From copy numbers of various strains in the intestinal flora of the feces, the amounts of lactobacillus, aerogenic sandwich bacteria, bacteroides and bifidobacterium in the feces of children in the obese group are used for detecting and predicting whether the children suffer from obesity or have a tendency to suffer from the obesity.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, several modifications and improvements can be made without departing from the technical principle of the present invention, and these modifications and improvements should also be considered as the protection scope of the present invention.