1. The molecular marker for distinguishing the white rust resistance of the chrysanthemum is characterized by being a restriction enzyme amplification polymorphic sequence (CAPS), wherein the nucleotide sequence of an upstream primer of an original sequence of the restriction enzyme amplification polymorphic sequence (CAPS) is SEQ ID NO: 1, the nucleotide sequence of the downstream primer is SEQ ID NO: 2.

2. the method for distinguishing white rust resistance of chrysanthemum according to the molecular marker of claim 1, which comprises the following steps:

(1) extracting genome DNA of chrysanthemum:

extracting genome DNA of the chrysanthemum to be detected by adopting a CTAB method;

(2) PCR amplification of full-length sequence:

and (3) PCR reaction system: comprises 5 mu L of 2 Xhigh fidelity Taq enzyme buffer solution, 1 mu L of DNA template, 1 mu L of upstream primer, 1 mu L of downstream primer and 2 mu L of deionized water;

and (3) PCR reaction conditions: pre-denaturation at 98 ℃ for 3 min; denaturation at 98 ℃ for 10 seconds, annealing at 45 ℃ for 30 seconds, extension at 72 ℃ for 3 minutes for 30 seconds, and 35 cycles; extension at 72 ℃ for 7 min; storing at 4 deg.C;

(3) full-length sequence purification and cloning vector ligation

Purifying the full-length sequence: purifying the target fragment by using an agarose gel purification recovery reagent;

secondly, after the target fragment is connected with a cloning vector, the competence of escherichia coli is transformed;

(4) positive plasmid identification and sequencing:

selecting a single colony to LB liquid culture medium containing 50mg/L kanamycin, incubating for 12 hours at 37 ℃ under the condition of 200rpm, carrying out PCR verification after the bacterial liquid is turbid, wherein the primer is SEQ ID NO: 1 and SEQ ID NO: 2;

extracting plasmids by using a plasmid rapid extraction kit;

(5) PCR amplifying the molecular marker original sequence by using plasmid as a template

And (3) PCR reaction system: comprises 5 mu L of 2 XTaq enzyme buffer solution, 1 mu L of plasmid template, 1 mu L of upstream primer, 1 mu L of downstream primer and 2 mu L of deionized water;

and (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 seconds, annealing at 50 ℃ for 30 seconds, extension at 72 ℃ for 45 seconds, 35 cycles; extension at 72 ℃ for 7 min; storing at 4 deg.C;

(6) restriction enzyme Nla III enzyme digestion of plasmid PCR products:

the restriction endonuclease Nla III recognizes the sequence as CATG ^;

an enzyme digestion reaction system: 6 mu L of PCR product, 0.5 mu L of Nla III restriction endonuclease, 1.5 mu L of 10 Xenzyme digestion buffer solution and 4 mu L of deionized water;

the enzyme digestion reaction conditions are as follows: enzyme digestion is carried out for 60 minutes at 37 ℃;

(7) and (3) carrying out agarose gel electrophoresis detection after the PCR product is subjected to enzyme digestion:

after imaging by a gel imager, if two specific bands of 523bp and 99bp are displayed, the chrysanthemum is white rust resistant; when the specificity band of 643bp is shown, the chrysanthemum is infected with white rust.

3. The method according to claim 2, wherein the specific steps of step (3) and (b) are as follows:

taking 4 mu L of the PCR purified product obtained in the step one and 1 mu L of cloning vector solution, gently mixing, and connecting for 25 minutes at 25 ℃; transforming the connecting product into escherichia coli competent cells, carrying out ice bath for 30 minutes, then carrying out water bath heat shock at 42 ℃ for 90 seconds, and carrying out ice bath for 2 minutes; adding 600 μ L LB liquid culture medium, and incubating at 37 deg.C for 1 hr at 200 rpm; and uniformly coating 200 mu L of turbid bacterial liquid on LB solid culture medium added with 50mg/L of kanamycin, and carrying out inverted culture at 37 ℃ for overnight.

4. The method according to claim 2 or 3, wherein the Taq enzyme buffer contains 0.2U, dNTPs1 μ M Taq enzyme and magnesium ions.

5. The method of any one of claims 2 to 4, wherein the method is used to identify the chrysanthemum as resistant to white rust of the chrysanthemum at any stage of chrysanthemum development.

6. An acquisition method of a molecular marker for distinguishing white rust resistance of chrysanthemum is characterized by comprising the following steps:

(1) cultivating chrysanthemum: respectively culturing chrysanthemum materials for resisting white rust of chrysanthemum and infecting the white rust of chrysanthemum;

(2) extracting genome DNA of chrysanthemum:

extracting chrysanthemum genome DNA for resisting white rust disease of chrysanthemum and infecting white rust disease of chrysanthemum respectively by adopting a CTAB method;

(3) designing full-length cloning primers of white rust genes of chrysanthemum:

the full-length cloning primer comprises an upstream full-length cloning primer and a downstream full-length cloning primer, and corresponding nucleotide sequences are respectively SEQ ID NO: 3 and SEQ ID NO: 4;

(4) and (3) PCR amplification:

and (3) PCR reaction system: comprises 5 mu L of 2 XHi-Fi Taq enzyme buffer solution, 1 mu L of upstream full-length cloning primer, 1 mu L of downstream full-length cloning primer, 1 mu L of DNA template, 2 mu L of deionized water and 10 mu L of total;

and (3) PCR reaction conditions: pre-denaturation at 98 ℃ for 3 min; denaturation at 98 ℃ for 10 seconds, annealing at 45 ℃ for 50 seconds, extension at 72 ℃ for 3 minutes for 30 seconds, and 35 cycles; extension at 72 ℃ for 7 min; storing at 4 deg.C;

(5) agarose gel electrophoresis:

detecting the PCR product by using 1% agarose gel electrophoresis, and observing the position of a strip by using a gel imager;

(6) recovering an amplification product;

(7) recovering the product, connecting with a cloning vector, and transforming escherichia coli;

(8) sequencing:

the nucleotide sequence of the chrysanthemum for resisting the white rust of the chrysanthemum is shown as SEQ ID NO: 5, the chrysanthemum nucleotide sequence of the chrysanthemum white rust disease is SEQ ID NO: 6;

(9) synthesis of molecular marker for distinguishing white rust resistance of chrysanthemum

According to the nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6, determining the enzyme cutting site as CATG ^; designing and synthesizing an upstream primer nucleotide sequence SEQ ID NO: 1 and the downstream primer nucleotide sequence SEQ ID NO: 2.

7. the method for obtaining the molecular marker for distinguishing the white rust resistance of the chrysanthemum according to claim 6, wherein the high-fidelity Taq enzyme buffer solution contains 0.2U, dNTPs1 μ M of high-fidelity Taq enzyme and magnesium ions.

Background

Chrysanthemum morifolium (Chrysanthemum morifolium) is a perennial root herbaceous plant of Compositae and Chrysanthemum, and is one of ten traditional famous flowers in China. The chrysanthemum has various varieties, variable flower types and rich colors, has extremely high ornamental and economic values, and is widely applied to landscaping. The white rust of chrysanthemum is a chrysanthemum obligate parasitic disease caused by horiba horizontalis (Puccinia horiana Henn), which damages leaves, caulicles and flowers of chrysanthemum and even withers and dies of the whole plant during occurrence of the disease, thereby greatly reducing the ornamental value of the chrysanthemum. White rust of chrysanthemum is a worldwide quarantine disease, has a wide infection range, is one of the most important destructive diseases in the production process of chrysanthemum, causes great loss of chrysanthemum industry due to large-area morbidity, and seriously restricts the development of the chrysanthemum industry.

The molecular marker assisted breeding has the advantages of rapid identification of target characters, simple method and low cost, and is mainly applied to aspects of plant genotyping, molecular marker assisted selective breeding, variety identification and the like. At present, no method for identifying the white rust character of chrysanthemum through molecular markers exists.

Disclosure of Invention

In order to solve the problems, the invention provides a molecular marker for distinguishing white rust resistance of chrysanthemum and application thereof, which can distinguish the white rust resistance of chrysanthemum in chrysanthemum materials at any development stage and accelerate the breeding process of chrysanthemum. The invention is realized by the following technical scheme:

a molecular marker for distinguishing white rust resistance of chrysanthemum is a restriction amplification polymorphism sequence (CAPS), and the nucleotide sequence of an upstream primer of an original sequence of the CAPS is SEQ ID NO: 1, the nucleotide sequence of the downstream primer is SEQ ID NO: 2.

in another aspect, the present application also provides a method for distinguishing white rust resistance of chrysanthemum according to the above molecular markers, which comprises the following steps:

(1) extracting genome DNA of chrysanthemum:

extracting genome DNA of the chrysanthemum to be detected by adopting a CTAB method;

(2) PCR amplification of full-length sequence:

and (3) PCR reaction system: comprises 5 mu L of 2 Xhigh fidelity Taq enzyme buffer solution, 1 mu L of DNA template, 1 mu L of upstream primer, 1 mu L of downstream primer and 2 mu L of deionized water;

and (3) PCR reaction conditions: pre-denaturation at 98 ℃ for 3 min; denaturation at 98 ℃ for 10 seconds, annealing at 45 ℃ for 30 seconds, extension at 72 ℃ for 3 minutes for 30 seconds, and 35 cycles; extension at 72 ℃ for 7 min; storing at 4 deg.C;

(4) full-length sequence purification and cloning vector ligation

Purifying the full-length sequence: purifying the target fragment by using an agarose gel purification recovery reagent;

secondly, after the target fragment is connected with a cloning vector, the competence of escherichia coli is transformed;

(4) positive plasmid identification and sequencing:

selecting a single colony to LB liquid culture medium containing 50mg/L kanamycin, incubating for 12 hours at 37 ℃ under the condition of 200rpm, carrying out PCR verification after the bacterial liquid is turbid, wherein the primer is SEQ ID NO: 1 and SEQ ID NO: 2;

extracting plasmids by using a plasmid rapid extraction kit;

(5) PCR amplifying the molecular marker original sequence by using plasmid as a template

And (3) PCR reaction system: comprises 5 mu L of 2 XTaq enzyme buffer solution, 1 mu L of plasmid template, 1 mu L of upstream primer, 1 mu L of downstream primer and 2 mu L of deionized water;

and (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 seconds, annealing at 50 ℃ for 30 seconds, extension at 72 ℃ for 45 seconds, 35 cycles; extension at 72 ℃ for 7 min; storing at 4 deg.C;

(6) restriction enzyme Nla III enzyme digestion of plasmid PCR products:

the restriction endonuclease Nla III recognizes the sequence as CATG ^;

an enzyme digestion reaction system: 6 mu L of PCR product, 0.5 mu L of Nla III restriction endonuclease, 1.5 mu L of 10 Xenzyme digestion buffer solution and 4 mu L of deionized water;

the enzyme digestion reaction conditions are as follows: enzyme digestion is carried out for 60 minutes at 37 ℃;

(7) and (3) carrying out agarose gel electrophoresis detection after the PCR product is subjected to enzyme digestion:

after imaging by a gel imager, if two specific bands of 523bp and 99bp are displayed, the chrysanthemum is white rust resistant; when the specificity band of 643bp is shown, the chrysanthemum is infected with white rust.

Further, the concrete steps of the second step in the step (3) are as follows:

taking 4 mu L of the PCR purified product obtained in the step one and 1 mu L of cloning vector solution, gently mixing, and connecting for 25 minutes at 25 ℃; transforming the connecting product into escherichia coli competent cells, carrying out ice bath for 30 minutes, then carrying out water bath heat shock at 42 ℃ for 90 seconds, and carrying out ice bath for 2 minutes; adding 600 μ L LB liquid culture medium, and incubating at 37 deg.C for 1 hr at 200 rpm; and uniformly coating 200 mu L of turbid bacterial liquid on LB solid culture medium added with 50mg/L of kanamycin, and carrying out inverted culture at 37 ℃ for overnight.

Furthermore, the Taq enzyme buffer solution contains 0.2U, dNTPs1 mu M Taq enzyme and magnesium ions.

Further, the method can identify whether the chrysanthemum resists white rust of the chrysanthemum at any period of chrysanthemum development.

In another aspect, the application also protects an acquisition method of a molecular marker for distinguishing white rust resistance of chrysanthemum, which comprises the following steps:

(1) cultivating chrysanthemum: respectively culturing chrysanthemum materials for resisting white rust of chrysanthemum and infecting the white rust of chrysanthemum;

(2) extracting genome DNA of chrysanthemum:

extracting chrysanthemum genome DNA for resisting white rust disease of chrysanthemum and infecting white rust disease of chrysanthemum respectively by adopting a CTAB method;

(3) designing full-length cloning primers of white rust genes of chrysanthemum:

the full-length cloning primer comprises an upstream full-length cloning primer and a downstream full-length cloning primer, and corresponding nucleotide sequences are respectively SEQ ID NO: 3 and SEQ ID NO: 4;

(4) and (3) PCR amplification:

and (3) PCR reaction system: comprises 5 mu L of 2 XHi-Fi Taq enzyme buffer solution, 1 mu L of upstream full-length cloning primer, 1 mu L of downstream full-length cloning primer, 1 mu L of DNA template, 2 mu L of deionized water and 10 mu L of total;

and (3) PCR reaction conditions: pre-denaturation at 98 ℃ for 3 min; denaturation at 98 ℃ for 10 seconds, annealing at 45 ℃ for 50 seconds, extension at 72 ℃ for 3 minutes for 30 seconds, and 35 cycles; extension at 72 ℃ for 7 min; storing at 4 deg.C;

(5) agarose gel electrophoresis:

detecting the PCR product by using 1% agarose gel electrophoresis, and observing the position of a strip by using a gel imager;

(6) recovering an amplification product;

(7) recovering the product, connecting with a cloning vector, and transforming escherichia coli;

(8) sequencing:

the nucleotide sequence of the chrysanthemum for resisting the white rust of the chrysanthemum is shown as SEQ ID NO: 5, the chrysanthemum nucleotide sequence of the chrysanthemum white rust disease is SEQ ID NO: 6;

(9) synthesis of molecular marker for distinguishing white rust resistance of chrysanthemum

According to the nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6, determining the enzyme cutting site as CATG ^; designing and synthesizing an upstream primer nucleotide sequence SEQ ID NO: 1 and the downstream primer nucleotide sequence SEQ ID NO: 2.

furthermore, the high-fidelity Taq enzyme buffer solution contains 0.2U, dNTPs1 mu M of high-fidelity Taq enzyme and magnesium ions.

Compared with the prior art, the invention has the following advantages:

the CAPS molecular marker is used for identifying whether a certain chrysanthemum variety resists the white rust of chrysanthemum under the condition of not being influenced by the development stage, and has guiding significance in breeding new varieties of white rust disease resistant chrysanthemum.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and those skilled in the art can also obtain other drawings according to the drawings without creative efforts.

FIG. 1 is a 'C029' leaf map of chrysanthemum;

FIG. 2 is a photograph of chrysanthemum 'Jinba' leaves;

FIG. 3 is the agarose gel electrophoresis assay of example 2;

FIG. 4 is a picture of the leaves of the variety "early Yupan" of chrysanthemum;

FIG. 5 is a photograph of an agarose gel electrophoresis test of example 3;

FIG. 6 is a leaf map of the chrysanthemum variety "S20-4".

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are some, but not all, embodiments of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Referring to fig. 1 and fig. 2, in the earlier stage, a chrysanthemum variety 'C029' resistant to white rust of chrysanthemum and a chrysanthemum variety 'Jinba' susceptible to white rust of chrysanthemum are used as test materials, a chrysanthemum white rust related gene is identified through homologous cloning, and excavation of a chrysanthemum white rust related functional gene provides a theoretical basis for breeding of white rust traits of chrysanthemum.

The method for cultivating the cuttage seedlings of chrysanthemum 'C029' and 'Jinba' is as follows:

cutting stem segments of flos Chrysanthemi 'C029' and 'Jinba', each segment is 10-12cm, cutting in nutrient soil, spraying water 2-3 times daily, transplanting after 30 days, and performing conventional maintenance management.

Example 1:

1.1 obtaining molecular markers

(1) Cultivating chrysanthemum: cultivating a white rust resistant variety chrysanthemum by adopting a conventional cuttage method and cultivating a white rust susceptible variety Jinba cuttage seedling;

(2) extraction of genomic DNA from Chrysanthemum

The DNA of 'C029' and 'Jinba' is respectively extracted by adopting a CTAB method, and the specific method is as follows:

0.15g of leaves are fully ground under the protection of liquid nitrogen, then are quickly transferred to a 2mL centrifuge tube, and 700 mu L of 2% beta mercaptoethanol-CTAB extract preheated at 65 ℃ is added. The mixture was incubated in a water bath at 65 ℃ for 1 hour with gentle shaking every 10 minutes.

② cooling for 30 minutes at room temperature, adding 700 mu L of chloroform/isoamyl alcohol (24: 1) mixed solution, fully shaking and mixing evenly, 12000rpm, centrifuging for 7 minutes.

③ 400 mu L of the supernatant is put into a new centrifugal tube with 1.5mL, added with 800 mu L of isopropanol (precooling at minus 20 ℃) and placed at minus 20 ℃ for standing for 1 hour.

Fourthly, the mixture is centrifuged at 12000rpm for 7 minutes, and then the supernatant is discarded.

Fifthly, 700 mu L of 75% ethanol (precooled at minus 20 ℃) is added to wash the DNA, and the DNA is centrifuged for 2 minutes at 12000r, and the supernatant is discarded.

Sixthly, repeating the step five times. Air drying at room temperature, adding TE to constant volume to 50 μ L, and storing at-20 deg.C.

(3) Designing full-length cloning primers of white rust genes of chrysanthemum:

downloading CHR00066647 gene sequence in a chrysanthemum genome database (http:// www.amwayabrc.com/zh-cn/index. html), and designing a full-length sequence amplification primer of the gene, wherein the primer sequence is as follows:

upstream primer F (SEQ ID NO: 3): ATGAAACCACCTTCAGAAAC

Downstream primer R (SEQ ID NO: 4): TCAAATCGCGTACATTTTC

(4) PCR amplification

And (3) PCR reaction system: comprises 5 mu L of 2 Xhigh fidelity Taq enzyme buffer solution (containing 0.2U, dNTPs1 mu M of high fidelity Taq enzyme and magnesium ions), 1 mu L of DNA template, 1 mu L of upstream primer, 1 mu L of downstream primer and 2 mu L of deionized water;

and (3) PCR reaction conditions: pre-denaturation at 98 ℃ for 3 min; denaturation at 98 ℃ for 10 seconds, annealing at 47 ℃ for 30 seconds, extension at 72 ℃ for 3 minutes for 30 seconds, 35 cycles; extension at 72 ℃ for 7 min; storing at 4 deg.C;

(5) agarose gel electrophoresis detection

The PCR product was detected by electrophoresis on a 1% agarose gel and the bands were visualized by a gel imager.

(6) Amplification product recovery

Recovering by using an agarose gel recovery kit;

(7) connecting the purified product with a cloning vector, transforming escherichia coli, and extracting plasmids;

(8) sequencing: sequencing the plasmid connected with the cloning vector, and determining the full-length sequence of the parents as follows:

>C029(SEQ ID NO：5)

ATGAAACCACCTTCAGAAACCGGGCTGCCACCCCCCACTCCTCGTAAAAAGATGGTGAAACAGGTGACAGGAAAACGCGATGACACCCCTTTGCATGCGGCCGCTAGAGCGGGGAACATTCACACGATCATAAATCTTTTGGGTGATTGTTACTCAGAAGAAGAATTTATTTCTTTGCTGTCGAAGCAGAATTATGCAGGCGAGACACCTTTGTATGTGGCAGCAGAATATGGTTATGTTGATTTGGTTAGACTCTTGATAGATCAATGTGATATTGCTACTGCTAGCATTAAAGCTAACAACGGTTTTGATGCTCTTCATATTGCTGCTAAACAAGGAGATTTAGGTAAGATATCACTTTTGTCTTTTAAGTATATTTATAGGGTGTTTGTAATTGCTTATTTATGATGATATCTGCTTATTTCTTAGCAGATTAGTTGAGTTTTTAAATAACTGCTTATTTGTATCTACTTGTTATTAAGTAGATACACTTTAAAATAAACAGTTTCAAGCACCCCTTAAATTTTATCAATACTATTATTATTTAGCTGTTTTTTAAACTATTTTCGCTCCTTTGGCGTGTAGAGATATTAAAAGTGTTAATGGAAGCACATCCGGAGTTATCAATGACGGTGGATATATCAAACACCACAGCTTTGCACACCGCGGCAATGCAAGGCAACATTGAGGTGATGAACTATCTACTAGAGATAGAGAGTAGTTTGGCATCGATAGCGAGAAGTAATGGGAAAACAGCATTACATTCGGCTTCAAGAAATGGGCATCTTAGAGTGGTGAAAGCTCTTTTGGAGAAGGCACCAGGGATTTCAGCGAGGAATGATAAGAAGGGGCAGACCGCCCTTCACATGGCTGCGAAAGGCCAGAATCATGAGTTGGTTGAGGAGTTGATCAAGGTGGATCCGTCGTTGATAAATATGGCTGATGCTAAGGGTAACACGGCTTTGCATATAGCAACACGTAAAGGACGTGTTCAGGTAAAAATTCGGTTTTGAGCATCTTGGTTAAATATAGTGATGTAGTTGCAGTCAGGAAAATATATGTAATATGCATTGTGCACATGCTTTAACATATATTTTACCCGGGGTAACCCATTACCCAAAAACATACATAATGTCCATTTAGGGATGCCATATGCACTAGTGTTGTAGTGCATATGGAGTCTAGGATGTCAAATGTGACTCGCTAGTAGGATTGTTAGTTTCCTAGTCTCACGCATTAGGTATTGTACTTTTATGCAGATTGTAAAGATGTTACTAGCTCGTAGCGAAACCAACACAAGAGCCGTGAATAGGTCGAATGAGACCGCCTTCGACACAGCTCAAAAAATGGGCCATCCCCACATTGGAATCATCTTACAAGAACACGGAGTCCCAAGTGCTCGGGTCCTAAAACCTCCAACGACTCCAGCTCGAGAGCTCAAGCAAACCGTGAGTGACATAAAACACGAGGTCCACCACCAATTAGAACACACACGTCAAACTCGAAGAAGAGTCCAAGGCATTGCAAAACATCTCAACAAAATGCACGCCGAAGGCCTCAACAATGCAATAAATTCAACGACGGTCGTTGCTGTTTTGATCGCCACCGTGGCCTTTGCAGCAATCTTTACAGTCCCGGGCCAATATGCCGATGACCCAAATAACATTCCCGAAGGGTTTTCGCTAGGTGAGGCGAACGTGGCACCACAACCATTATTTATAGTATTTTTTGTTTTTGACTCAGTGGCTCTATTTATTTCATTAGCCGTGGTCGTGGTTCAAACATCTGTGGTGGTTATCGAAAGTAAAGCGAAGAAGCAAATGATGGCCATAATCAACAAGCTAATGTGGTTAGCTTGTGTGCTTATCTCGGTGGCATTTTTGGCCCTTGCGTTTATTGTGGTTGGGGAGCATGAGAAATGGCTAGCGATTTGTGTCACCATTATTGGAACAACGATAATGGTCACGACTTTGGGTTTAATGTGTTACTGGGTTATCATGCATCGGATTGAAAGTAAGAATATGAGAAATTTGAGAAAGAACTCGTTGACGGGTAGTGGAAGTAGGTCTCGGTCAAGGTCTAGATCATGGTCGATGTCTGTACTTTCAGACACAGATGCAATGAATACGGAGTTTAAGAAAATGTACGCGATTGAA

>Jinba(SEQ ID NO：6)

ATGAAACCACCTTCAGAAACCGGGCTGCCACCCCCCACTCCTCGTAAAAAGATGGTGAAACAGGTGACAGGAAAACGCGATGATACCCCTTTGCATACGGCTGCTAGAGCGGGGAACATTCACACGATCATAAATCTTTTGGGTGATTGTTACTCAGAAGAAGAATTTATTTCTTTGCTGTCGAAGCAGAATTATGCAGGCGAGACACCTTTGTATGTGGCAGCGGAATATGGTTATGTTGATTTGGTTAGACTCTTGATAGATCAATGTGATATTGCTACTGCTAGCATTAAAGCAAACAACGGTTTTGATGCTCTTCATATTGCTGCTAAACAAGGAGATTTAGGTAAGATATCACTTTTGTCTTTTAAGTATATTTATAGGTTGTTTGAAATTGCTTATTTATATTGAAATCTGCTTATTTTTTTAACAGATTAGTAGTTTGAGTTTTTAAATAACTACTTATTTGTATCTTGTTATTTTTAAGCAGATACACTTTAAGATAAGCAGTTTCAAGCACTCCTTAAATAATTTATCAATAGTAACACTATTACTATTATTTAACTGTCTTTTAAACTGATTTCGCTCCTTTAATTTGGCGTATAGAGATATTAAAAGTGTTAATGGAAGCACATCCGGAGTTATCAATGACGGTGGATATATCAAACACCACGGCTTTGCACACCGCGGCCATGCAAGGCAACATTGAGGTGATGAACTATCTACTAGAGATAGAGAGTAGTTTGGCATCTATAGCGAGAAGTAATGGGAAAACAGCATTGCATTCGGCCTCAAGAAATGGGCATCTTAGAGTGGTGAAAGCTCTTTTGGAGAAGGCACCCGGGATTTCAGCGAGGAATGATAAGAAGGGGCAGACCGCCCTTCACATGGCTGCGAAAGGCCAGAATCATGAGGTGGTTGAGGAGTTGATAAAAGTGGATCCGTCGTTGATAAATATGGCTGATGCTAAGGGTAACACGGCTTTGCATATAGCAACACGTAAAGGACGTGTTCAGGTAAAAATTCGGTTTTGAGCATCTTGTAAAAGTAAAGTAACTCCCAGTACCGTCTTCCACGGGTTATGGGTCCCAATACCGTCTTCCACGGTGTATGGGGGAGGTTAAGACGTAGACAACCATACCCCTACCTAAGGTAGAGAGGCTGCTTCCGGTTCTACCAAAGGTAGAAAAGGACCTCCGGCCTTGCGAGGGGTGAGGATCGAACCTTGACCTCTGTCTCCAGAGGCAAAGGTGTTAACCACTTGATCCAACCTTGCTCCAGAGGCAAGGGTTTTGAGCATCTTGTAAAGTACTTAAATGTATTGATGTATTGTTGCAGTCTCACGCATTAAATATTGTACTTTTATGCAGATTGTAAAGATGTTACTAGCTCGCAGCGAAACCAACACGAAAGCTGTGAATAGGTCGAACGAGACTGCCTTCGACACAGCTCAAAAAATGGGTCATCCCCACATTGGAATCATCTTACAAGAACACGGAGTCCCAAGTGCTCGGGTTCTAAAACCTCCAACGACTCCAGCTCGAGAGCTCAAGCAAACCGTGAGTGACATAAAACACGAGGTCCACCACCAATTGGAACACACTCGTCAAACTCGAAGAAGAGTCCAAGGCATTGCAAAACATCTCAACAAAATGCATGCCGAAGGCCTCAACAATGCAATAAATTCAACGACGGTTGTTGCTGTTTTGATCGCCACCGTGGCCTTTGCAGCAATCTTTACAGTCCCGGGCCAATATGCCGATGACCCAAATAACATTCCCGAAGGGTTTTCGCTAGGTGAGGCGAACGTGGCACCACAACCTTTATTTATAGTATTTTTTGTTTTCGACTCAGTGGCTCTATTTATTTCATTAGCCGTGGTCGTGGTTCAAACATCTGTGGTGGTTATCGAAAGTAAAGCGAAGAAGCAAATGATGGCCATAATCAACAAGCTAATGTGGTTAGCTTGTGTGCTTATCTCGGTGGCATTTTTGGCCCTTGCGTTTATTGTGGTTGGGGAGCATGAGAAATGGCTAGCGATTTGTGTCACCATTATTGGAACAACGATAATGGTCACGACTTTGGGTTTAATGTGTTACTGGATTATCATGCATCGGATTGAAAGTAAGAATATGAGAAATTTGAGAAAGAACTCGTTGACGGGTAGTGGAAGTAGGTCTCGGTCAAGGTCTAGATCATGGTCGATGTCTGTACTTTCGGACACAGATGCTATGAATACGGAGTTTAAGAAAATGTACGCGATTGAA

(9) synthesis of molecular marker for distinguishing white rust resistance of chrysanthemum

Comparing the difference sites by Multalin online software (http:// Multalin. toulouse. inra. fr/Multalin /) according to the nucleotide sequence shown obtained in step (8); introducing zero mismatch into a sequence containing a differential site at dCAPS Finder2.0(http:// helix.wustl.edu/dCAPS/dcaps.html), and determining that the enzyme cutting site is CATG ^; design and synthesis of two oligonucleotide primers SEQ ID NO: 1 and SEQ ID NO: 2, a molecular marker for distinguishing chrysanthemum white rust resistance, SEQ ID NO: 1: ATGAAACCACCTTCAGAAAC, SEQ ID NO: 2: AACTCCGGATGTGCTTCCAT are provided.

1.2 applications of molecular markers

Resistance to white rust of chrysanthemum can be distinguished at any stage of chrysanthemum development. The use method of the molecular marker comprises the following steps:

(1) extraction of genomic DNA from Chrysanthemum

Extracting chrysanthemum genome DNA by a CTAB method, which comprises the following steps:

0.15g of leaves are fully ground under the protection of liquid nitrogen, then are quickly transferred to a 2mL centrifuge tube, and 700 mu L of 2% beta mercaptoethanol-CTAB extract preheated at 65 ℃ is added. The mixture was incubated in a water bath at 65 ℃ for 1 hour with gentle shaking every 10 minutes.

② cooling for 30 minutes at room temperature, adding 700 mu L of chloroform/isoamylol (24: 1) mixed solution, fully shaking and mixing uniformly, 12000r, centrifuging for 7 minutes.

③ 400 mu L of the supernatant is put into a new centrifugal tube with 1.5mL, added with 800 mu L of isopropanol (precooling at minus 20 ℃) and placed at minus 20 ℃ for standing for 1 hour.

Fourthly, centrifuging the mixture for 7 minutes at 12000r, and then removing the supernatant.

Fifthly, 700 mu L of 75% ethanol (precooled at minus 20 ℃) is added to wash the DNA, and the DNA is centrifuged for 2 minutes at 12000r, and the supernatant is discarded.

Sixthly, repeating the step five times. Air drying at room temperature, adding TE to constant volume to 50 μ L, and storing at-20 deg.C.

(2) PCR amplification of full-length sequence:

and (3) PCR reaction system: comprises 5 mu L of 2 Xhigh fidelity Taq enzyme buffer solution, 1 mu L of DNA template, 1 mu L of upstream primer, 1 mu L of downstream primer and 2 mu L of deionized water;

and (3) PCR reaction conditions: pre-denaturation at 98 ℃ for 3 min; denaturation at 98 ℃ for 10 seconds, annealing at 45 ℃ for 30 seconds, extension at 72 ℃ for 3 minutes for 30 seconds, and 35 cycles; extension at 72 ℃ for 7 min; storing at 4 deg.C;

(3) purifying and recovering full-length sequence glue, connecting the glue with a vector and transferring the glue into escherichia coli

a. Full Length sequence purification

Purifying the target fragment by using an agarose gel purification recovery kit.

Secondly, after the target fragment is connected with a cloning vector, the competence of escherichia coli is transformed.

(4) Positive plasmid identification and sequencing:

single colonies were picked into LB liquid medium containing kanamycin (50mg/L) and incubated at 200rpm at 37 ℃ for 12 hours. After the bacterial liquid is turbid, performing PCR verification, wherein the primers are SEQ ID NO: 1 and SEQ ID NO: 2. the specific PCR reaction system and reaction conditions are as follows:

bacterial liquid PCR reaction system: comprises 5 mu L of 2 XTaq enzyme buffer solution, 3 mu L of bacterial solution, 1 mu L of upstream primer and 1 mu L of downstream primer;

bacterial liquid PCR reaction conditions: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 seconds, annealing at 50 ℃ for 30 seconds, extension at 72 ℃ for 30 seconds, 35 cycles; extension at 72 ℃ for 7 min; storing at 4 deg.C; the PCR product was detected by 1% agarose gel electrophoresis

The plasmid is used for rapid extraction.

(5) Amplifying the original sequence of the molecular marker by using plasmid PCR

And (3) PCR reaction system: comprises 5 mu L of 2 XTaq enzyme buffer solution, 1 mu L of plasmid template, 1 mu L of upstream primer, 1 mu L of downstream primer and 2 mu L of deionized water;

and (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 seconds, annealing at 50 ℃ for 30 seconds, extension at 72 ℃ for 45 seconds, 35 cycles; extension at 72 ℃ for 7 min; storing at 4 deg.C;

(6) restriction enzyme Nla III enzyme digestion of plasmid PCR products:

the restriction endonuclease Nla III recognizes the sequence as CATG ^;

an enzyme digestion reaction system: 6 mu L of PCR product, 0.5 mu L of Nla III restriction endonuclease, 1.5 mu L of 10 Xenzyme digestion buffer solution and 4 mu L of deionized water;

the enzyme digestion reaction conditions are as follows: enzyme digestion is carried out for 60 minutes at 37 ℃;

(7) carrying out agarose gel electrophoresis detection on the PCR product after enzyme digestion:

after imaging by a gel imager, if two specific bands of 523bp and 99bp are displayed, the chrysanthemum is white rust resistant; when the specificity band of 643bp is shown, the chrysanthemum is infected with white rust.

Example 2:

the molecular marker is verified to be a specific molecular marker of the chrysanthemum white rust disease-resistant variety 'early jade disc'.

The specific method comprises the following steps:

1. cultivating chrysanthemum: the white rust disease-resistant variety 'early jade disc' of the cuttage chrysanthemum.

Cutting stem segments of flos Chrysanthemi 'Zaoyu' with each segment of 10-12cm, cutting in nutrient soil, spraying water 2-3 times daily, and transplanting to pot after 30 days for conventional maintenance management.

Detection of CAPS molecular markers:

(1) extraction of genomic DNA from Chrysanthemum

Extracting chrysanthemum genome DNA by a CTAB method, which comprises the following steps:

0.15g of leaves are fully ground under the protection of liquid nitrogen, then are quickly transferred to a 2mL centrifuge tube, and 700 mu L of 2% beta mercaptoethanol-CTAB extract preheated at 65 ℃ is added. The mixture was incubated in a water bath at 65 ℃ for 1 hour with gentle shaking every 10 minutes.

② cooling for 30 minutes at room temperature, adding 700 mu L of chloroform/isoamylol (24: 1) mixed solution, fully shaking and mixing uniformly, 12000r, centrifuging for 7 minutes.

③ 400 mu L of the supernatant is put into a new centrifugal tube with 1.5mL, added with 800 mu L of isopropanol (precooling at minus 20 ℃) and placed at minus 20 ℃ for standing for 1 hour.

Fourthly, centrifuging the mixture for 7 minutes at 12000r, and then removing the supernatant.

Fifthly, 700 mu L of 75% ethanol (precooled at minus 20 ℃) is added to wash the DNA, and the DNA is centrifuged for 2 minutes at 12000r, and the supernatant is discarded.

Sixthly, repeating the step five times. Air drying at room temperature, adding TE to constant volume to 50 μ L, and storing at-20 deg.C.

(2) PCR amplification of full-length sequence:

and (3) PCR reaction system: comprises 5 mu L of 2 Xhigh fidelity Taq enzyme buffer solution, 1 mu L of DNA template, 1 mu L of upstream primer, 1 mu L of downstream primer and 2 mu L of deionized water;

and (3) PCR reaction conditions: pre-denaturation at 98 ℃ for 3 min; denaturation at 98 ℃ for 10 seconds, annealing at 45 ℃ for 30 seconds, extension at 72 ℃ for 3 minutes for 30 seconds, and 35 cycles; extension at 72 ℃ for 7 min; storing at 4 deg.C;

(3) purifying and recovering full-length sequence glue, connecting the glue with a vector and transferring the glue into escherichia coli

Purifying the target fragment by using an agarose gel purification recovery kit.

② after the target fragment is connected with cloning vector, it can be used for transforming colibacillus competence

(4) Positive plasmid identification and sequencing:

single colonies were picked into LB liquid medium containing 50mg/L kanamycin and incubated at 200rpm at 37 ℃ for 12 hours. After the bacterial liquid is turbid, performing PCR verification, wherein the primers are SEQ ID NO: 1 and SEQ ID NO: 2. the specific PCR reaction system and reaction conditions are as follows:

bacterial liquid PCR reaction system: comprises 5 mu L of 2 XTaq enzyme buffer solution, 3 mu L of bacterial solution, 1 mu L of upstream primer and 1 mu L of downstream primer;

bacterial liquid PCR reaction conditions: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 seconds, annealing at 50 ℃ for 30 seconds, extension at 72 ℃ for 30 seconds, 35 cycles; extension at 72 ℃ for 7 min; storing at 4 deg.C; the PCR product was detected by 1% agarose gel electrophoresis

The plasmid is used for rapid extraction.

(5) Amplifying the original sequence of the molecular marker by using plasmid PCR

And (3) PCR reaction system: comprises 5 mu L of 2 XTaq enzyme buffer solution, 1 mu L of plasmid template, 1 mu L of upstream primer, 1 mu L of downstream primer and 2 mu L of deionized water;

and (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 seconds, annealing at 50 ℃ for 30 seconds, extension at 72 ℃ for 45 seconds, 35 cycles; extension at 72 ℃ for 7 min; storing at 4 deg.C;

(6) restriction enzyme Nla III enzyme digestion of plasmid PCR products:

the restriction endonuclease Nla III recognizes the sequence as CATG ^;

an enzyme digestion reaction system: 6 mu L of PCR product, 0.5 mu L of Nla III restriction endonuclease, 1.5 mu L of 10 Xenzyme digestion buffer solution and 4 mu L of deionized water;

the enzyme digestion reaction conditions are as follows: enzyme digestion is carried out for 60 minutes at 37 ℃;

(7) carrying out agarose gel electrophoresis detection on the PCR product after enzyme digestion:

and (3) carrying out 2% agarose gel electrophoresis on the PCR product subjected to enzyme digestion, and taking an electrophoresis picture by using a gel imager. The sequence of the chrysanthemum white rust-resistant variety 'early jade disc' can be recognized and cut into specific bands of 523bp and 99bp by the restriction enzyme Nla III (see FIG. 3).

Use of CAPS molecular markers: the CAPS molecular marker successfully verifies that the chrysanthemum variety 'morning jade disc' resists chrysanthemum white rust (figure 4).

Example 3:

the molecular marker is verified to be a specific molecular marker of the chrysanthemum white rust disease variety 'S20-4'.

The specific method comprises the following steps:

1. cultivating chrysanthemum: the white rust disease variety 'S20-4' of the cutting chrysanthemum.

Cutting stem segments of chrysanthemum flower 'S20-4', each segment is 10-12cm, cutting in nutrient soil, spraying water 2-3 times a day, transplanting after 30 days, and performing conventional maintenance management.

Detection of CAPS molecular markers:

(1) extraction of genomic DNA from Chrysanthemum

Extracting chrysanthemum genome DNA by a CTAB method, which comprises the following steps:

0.15g of leaves are fully ground under the protection of liquid nitrogen, then are quickly transferred to a 2mL centrifuge tube, and 700 mu L of 2% beta mercaptoethanol-CTAB extract preheated at 65 ℃ is added. The mixture was incubated in a water bath at 65 ℃ for 1 hour with gentle shaking every 10 minutes.

② cooling for 30 minutes at room temperature, adding 700 mu L of chloroform/isoamylol (24: 1) mixed solution, fully shaking and mixing uniformly, 12000r, centrifuging for 7 minutes.

③ 400 mu L of the supernatant is put into a new centrifugal tube with 1.5mL, added with 800 mu L of isopropanol (precooling at minus 20 ℃) and placed at minus 20 ℃ for standing for 1 hour.

Fourthly, centrifuging the mixture for 7 minutes at 12000r, and then removing the supernatant.

Fifthly, 700 mu L of 75% ethanol (precooled at minus 20 ℃) is added to wash the DNA, and the DNA is centrifuged for 2 minutes at 12000r, and the supernatant is discarded.

Sixthly, repeating the step five times. Air drying at room temperature, adding TE to constant volume to 50 μ L, and storing at-20 deg.C.

(2) PCR amplification of full-length sequence:

and (3) PCR reaction system: comprises 5 mu L of 2 Xhigh fidelity Taq enzyme buffer solution, 1 mu L of DNA template, 1 mu L of upstream primer, 1 mu L of downstream primer and 2 mu L of deionized water;

and (3) PCR reaction conditions: pre-denaturation at 98 ℃ for 3 min; denaturation at 98 ℃ for 10 seconds, annealing at 45 ℃ for 30 seconds, extension at 72 ℃ for 3 minutes for 30 seconds, and 35 cycles; extension at 72 ℃ for 7 min; storing at 4 deg.C;

(3) purifying and recovering full-length sequence glue, connecting the glue with a vector and transferring the glue into escherichia coli

Purifying the full-length fragment by using an agarose gel purification recovery kit. ,

② after the target fragment is connected with cloning vector, it can be used for transforming colibacillus competence

(4) Positive plasmid identification and sequencing:

single colonies were picked into LB liquid medium containing kanamycin (50mg/L) and incubated at 200rpm at 37 ℃ for 12 hours. After the bacterial liquid is turbid, performing PCR verification, wherein the primers are SEQ ID NO: 1 and SEQ ID NO: 2. the specific PCR reaction system and reaction conditions are as follows:

bacterial liquid PCR reaction system: comprises 5 mu L of 2 XTaq enzyme buffer solution, 3 mu L of bacterial solution, 1 mu L of upstream primer and 1 mu L of downstream primer;

bacterial liquid PCR reaction conditions: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 seconds, annealing at 50 ℃ for 30 seconds, extension at 72 ℃ for 30 seconds, 35 cycles; extension at 72 ℃ for 7 min; storing at 4 deg.C; the PCR product was detected by 1% agarose gel electrophoresis

The method for extracting the plasmid refers to the specification of a plasmid rapid extraction kit and comprises the following specific steps:

the positive bacteria liquid is centrifuged for 1 minute at 12000rpm in a 2mL centrifuge tube, the bacteria are enriched, and the supernatant is discarded.

② adding 250 μ L of buffer solution, and suspending the thalli thoroughly by vortex oscillation.

③ adding 250 mu L of cracking solution, mixing the solution gently and evenly, and standing the mixture for 4 minutes at room temperature.

And fourthly, adding 350 mu L of SDS lysis solution, mixing the solution gently, and centrifuging the solution at 13000rpm for 10 minutes.

Fifthly, carefully absorbing the supernatant, adding the supernatant into an adsorption column, centrifuging at 12000rpm for 1 minute, and discarding the waste liquid.

Sixthly, adding 500 mu L of deproteinized liquid, centrifuging at 12000rpm for 1 minute, and discarding the waste liquid.

Adding 600 mul of rinsing liquid, centrifuging at 12000rpm for 1 minute, and discarding the waste liquid. And repeating the steps once. The tube was centrifuged at 13000rpm for 3 minutes.

And placing the adsorption column into a new centrifugal tube, and standing for 10 minutes at room temperature. Add 40. mu.L of elution buffer to the center of the adsorption membrane, let stand at room temperature for 5 minutes, and centrifuge at 12000rpm for 2 minutes. Storing at-20 deg.C for use. Sequencing was entrusted to Shanghai Biotechnology, Inc.

(5) Amplifying the original sequence of the molecular marker by using plasmid PCR

And (3) PCR reaction system: comprises 5 mu L of 2 XTaq enzyme buffer solution, 1 mu L of plasmid template, 1 mu L of upstream primer, 1 mu L of downstream primer and 2 mu L of deionized water;

and (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 seconds, annealing at 50 ℃ for 30 seconds, extension at 72 ℃ for 45 seconds, 35 cycles; extension at 72 ℃ for 7 min; storing at 4 deg.C;

(6) restriction enzyme Nla III enzyme digestion of plasmid PCR products:

the restriction endonuclease Nla III recognizes the sequence as CATG ^;

an enzyme digestion reaction system: 6 mu L of PCR product, 0.5 mu L of Nla III restriction endonuclease, 1.5 mu L of 10 Xenzyme digestion buffer solution and 4 mu L of deionized water;

the enzyme digestion reaction conditions are as follows: enzyme digestion is carried out for 60 minutes at 37 ℃;

(7) carrying out agarose gel electrophoresis detection on the PCR product after enzyme digestion:

and (3) carrying out 2% agarose gel electrophoresis on the PCR product subjected to enzyme digestion, and taking an electrophoresis picture by using a gel imager. The sequence of the chrysanthemum white rust variety 'S20-4' cannot be recognized and cut by the restriction enzyme Nla III, and a 643bp specific band appears (FIG. 5).

Use of CAPS molecular markers: by using the CAPS molecular marker, the chrysanthemum variety 'S20-4' is successfully verified to be a chrysanthemum white rust disease variety (FIG. 6).

Finally, it should be noted that: the above examples are only intended to illustrate the technical solution of the present invention, but not to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some technical features may be equivalently replaced; and such modifications or substitutions do not depart from the spirit and scope of the corresponding technical solutions of the embodiments of the present invention.

Sequence listing

<110> Shenyang agriculture university

<120> CAPS molecular marker for distinguishing white rust resistance of chrysanthemum and application thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgaaaccac cttcagaaac 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

aactccggat gtgcttccat 20

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atgaaaccac cttcagaaac 20

<210> 4

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tcaaatcgcg tacattttc 19

<210> 5

<211> 2156

<212> DNA

<213> Chrysanthemum flower (Chrysanthemum morifolium)

<400> 5

atgaaaccac cttcagaaac cgggctgcca ccccccactc ctcgtaaaaa gatggtgaaa 60

caggtgacag gaaaacgcga tgacacccct ttgcatgcgg ccgctagagc ggggaacatt 120

cacacgatca taaatctttt gggtgattgt tactcagaag aagaatttat ttctttgctg 180

tcgaagcaga attatgcagg cgagacacct ttgtatgtgg cagcagaata tggttatgtt 240

gatttggtta gactcttgat agatcaatgt gatattgcta ctgctagcat taaagctaac 300

aacggttttg atgctcttca tattgctgct aaacaaggag atttaggtaa gatatcactt 360

ttgtctttta agtatattta tagggtgttt gtaattgctt atttatgatg atatctgctt 420

atttcttagc agattagttg agtttttaaa taactgctta tttgtatcta cttgttatta 480

agtagataca ctttaaaata aacagtttca agcacccctt aaattttatc aatactatta 540

ttatttagct gttttttaaa ctattttcgc tcctttggcg tgtagagata ttaaaagtgt 600

taatggaagc acatccggag ttatcaatga cggtggatat atcaaacacc acagctttgc 660

acaccgcggc aatgcaaggc aacattgagg tgatgaacta tctactagag atagagagta 720

gtttggcatc gatagcgaga agtaatggga aaacagcatt acattcggct tcaagaaatg 780

ggcatcttag agtggtgaaa gctcttttgg agaaggcacc agggatttca gcgaggaatg 840

ataagaaggg gcagaccgcc cttcacatgg ctgcgaaagg ccagaatcat gagttggttg 900

aggagttgat caaggtggat ccgtcgttga taaatatggc tgatgctaag ggtaacacgg 960

ctttgcatat agcaacacgt aaaggacgtg ttcaggtaaa aattcggttt tgagcatctt 1020

ggttaaatat agtgatgtag ttgcagtcag gaaaatatat gtaatatgca ttgtgcacat 1080

gctttaacat atattttacc cggggtaacc cattacccaa aaacatacat aatgtccatt 1140

tagggatgcc atatgcacta gtgttgtagt gcatatggag tctaggatgt caaatgtgac 1200

tcgctagtag gattgttagt ttcctagtct cacgcattag gtattgtact tttatgcaga 1260

ttgtaaagat gttactagct cgtagcgaaa ccaacacaag agccgtgaat aggtcgaatg 1320

agaccgcctt cgacacagct caaaaaatgg gccatcccca cattggaatc atcttacaag 1380

aacacggagt cccaagtgct cgggtcctaa aacctccaac gactccagct cgagagctca 1440

agcaaaccgt gagtgacata aaacacgagg tccaccacca attagaacac acacgtcaaa 1500

ctcgaagaag agtccaaggc attgcaaaac atctcaacaa aatgcacgcc gaaggcctca 1560

acaatgcaat aaattcaacg acggtcgttg ctgttttgat cgccaccgtg gcctttgcag 1620

caatctttac agtcccgggc caatatgccg atgacccaaa taacattccc gaagggtttt 1680

cgctaggtga ggcgaacgtg gcaccacaac cattatttat agtatttttt gtttttgact 1740

cagtggctct atttatttca ttagccgtgg tcgtggttca aacatctgtg gtggttatcg 1800

aaagtaaagc gaagaagcaa atgatggcca taatcaacaa gctaatgtgg ttagcttgtg 1860

tgcttatctc ggtggcattt ttggcccttg cgtttattgt ggttggggag catgagaaat 1920

ggctagcgat ttgtgtcacc attattggaa caacgataat ggtcacgact ttgggtttaa 1980

tgtgttactg ggttatcatg catcggattg aaagtaagaa tatgagaaat ttgagaaaga 2040

actcgttgac gggtagtgga agtaggtctc ggtcaaggtc tagatcatgg tcgatgtctg 2100

tactttcaga cacagatgca atgaatacgg agtttaagaa aatgtacgcg attgaa 2156

<210> 6

<211> 2267

<212> DNA

<213> Chrysanthemum flower (Chrysanthemum morifolium)

<400> 6

atgaaaccac cttcagaaac cgggctgcca ccccccactc ctcgtaaaaa gatggtgaaa 60

caggtgacag gaaaacgcga tgatacccct ttgcatacgg ctgctagagc ggggaacatt 120

cacacgatca taaatctttt gggtgattgt tactcagaag aagaatttat ttctttgctg 180

tcgaagcaga attatgcagg cgagacacct ttgtatgtgg cagcggaata tggttatgtt 240

gatttggtta gactcttgat agatcaatgt gatattgcta ctgctagcat taaagcaaac 300

aacggttttg atgctcttca tattgctgct aaacaaggag atttaggtaa gatatcactt 360

ttgtctttta agtatattta taggttgttt gaaattgctt atttatattg aaatctgctt 420

atttttttaa cagattagta gtttgagttt ttaaataact acttatttgt atcttgttat 480

ttttaagcag atacacttta agataagcag tttcaagcac tccttaaata atttatcaat 540

agtaacacta ttactattat ttaactgtct tttaaactga tttcgctcct ttaatttggc 600

gtatagagat attaaaagtg ttaatggaag cacatccgga gttatcaatg acggtggata 660

tatcaaacac cacggctttg cacaccgcgg ccatgcaagg caacattgag gtgatgaact 720

atctactaga gatagagagt agtttggcat ctatagcgag aagtaatggg aaaacagcat 780

tgcattcggc ctcaagaaat gggcatctta gagtggtgaa agctcttttg gagaaggcac 840

ccgggatttc agcgaggaat gataagaagg ggcagaccgc ccttcacatg gctgcgaaag 900

gccagaatca tgaggtggtt gaggagttga taaaagtgga tccgtcgttg ataaatatgg 960

ctgatgctaa gggtaacacg gctttgcata tagcaacacg taaaggacgt gttcaggtaa 1020

aaattcggtt ttgagcatct tgtaaaagta aagtaactcc cagtaccgtc ttccacgggt 1080

tatgggtccc aataccgtct tccacggtgt atgggggagg ttaagacgta gacaaccata 1140

cccctaccta aggtagagag gctgcttccg gttctaccaa aggtagaaaa ggacctccgg 1200

ccttgcgagg ggtgaggatc gaaccttgac ctctgtctcc agaggcaaag gtgttaacca 1260

cttgatccaa ccttgctcca gaggcaaggg ttttgagcat cttgtaaagt acttaaatgt 1320

attgatgtat tgttgcagtc tcacgcatta aatattgtac ttttatgcag attgtaaaga 1380

tgttactagc tcgcagcgaa accaacacga aagctgtgaa taggtcgaac gagactgcct 1440

tcgacacagc tcaaaaaatg ggtcatcccc acattggaat catcttacaa gaacacggag 1500

tcccaagtgc tcgggttcta aaacctccaa cgactccagc tcgagagctc aagcaaaccg 1560

tgagtgacat aaaacacgag gtccaccacc aattggaaca cactcgtcaa actcgaagaa 1620

gagtccaagg cattgcaaaa catctcaaca aaatgcatgc cgaaggcctc aacaatgcaa 1680

taaattcaac gacggttgtt gctgttttga tcgccaccgt ggcctttgca gcaatcttta 1740

cagtcccggg ccaatatgcc gatgacccaa ataacattcc cgaagggttt tcgctaggtg 1800

aggcgaacgt ggcaccacaa cctttattta tagtattttt tgttttcgac tcagtggctc 1860

tatttatttc attagccgtg gtcgtggttc aaacatctgt ggtggttatc gaaagtaaag 1920

cgaagaagca aatgatggcc ataatcaaca agctaatgtg gttagcttgt gtgcttatct 1980

cggtggcatt tttggccctt gcgtttattg tggttgggga gcatgagaaa tggctagcga 2040

tttgtgtcac cattattgga acaacgataa tggtcacgac tttgggttta atgtgttact 2100

ggattatcat gcatcggatt gaaagtaaga atatgagaaa tttgagaaag aactcgttga 2160

cgggtagtgg aagtaggtct cggtcaaggt ctagatcatg gtcgatgtct gtactttcgg 2220

acacagatgc tatgaatacg gagtttaaga aaatgtacgc gattgaa 2267