1. A real-time fluorescence quantitative PCR detection kit for ZIP genes is characterized by comprising a group of AcZIP expression level detection primers and a pair of areca catechu internal reference genes.

2. The kit for real-time fluorescent quantitative PCR detection of ZIP genes according to claim 1, characterized in that the nucleotide sequence of the primer ZIP1 is as set forth in SEQ ID NO: 1, and the nucleotide sequence of the primer ZIP2 is shown as SEQ ID NO: 2, the nucleotide sequence of the internal reference primer is shown as SEQ ID NO: 3 is shown in the specification; the two single-stranded DNAs in the primer pair can be separately packaged by shellfish or can be packaged by equimolar mixture.

3. The application of the real-time fluorescence quantitative PCR detection kit for the ZIP genes in detecting the iron deficiency or the zinc deficiency of the betel nuts as claimed in claim 1, wherein the application method of the real-time fluorescence quantitative PCR detection kit for the ZIP genes in detecting the iron deficiency or the zinc deficiency of the betel nuts comprises the following steps:

extracting genome RNA of a sample to be detected, performing reverse transcription to obtain cDNA as a template, performing RT-qPCR reaction by using a ZIP gene detection primer in the kit and an internal reference primer, and calculating relative abundance according to 2^ (-delta Ct) by using a normal sample as a control to obtain the relative expression quantity of the gene;

according to the relative expression of AcZIP family, if the expression of ZIP1 in the new leaves is not significantly changed, the expression of ZIP1 in the roots is significantly increased, the expression of ZIP2 in the new leaves is significantly up-regulated, and the expression of ZIP2 in the roots is not significantly changed, which indicates that the plants are stressed by zinc deficiency.

4. A method for judging the zinc deficiency state of areca seedlings through differential expression of AcZIP family genes is characterized by comprising the following steps of:

firstly, treating areca for zinc deficiency in an experimental base;

collecting a sample;

step three, carrying out ZIP family analysis;

step four, designing a primer;

fifthly, verifying the specificity of the primer;

and step six, performing real-time fluorescent quantitative PCR detection.

5. The method for determining the zinc deficiency status of betel nut seedlings through differential expression of AcZIP family genes as claimed in claim 4, wherein in the first step, the experimental base performs the treatment of betel nut zinc deficiency, comprising:

in an experimental base, Hoagland is used as a formula, the areca seedlings subjected to adaptive culture in one leaf stage are subjected to iron deficiency and zinc deficiency treatment by adopting a water culture method, and the culture solution is replaced every other week until the areca seedlings have an obvious phenotype; wherein, the new leaves of the betel nut seedlings lack of zinc are in a latticed yellowing phenomenon.

6. The method for determining the zinc deficiency status of areca seedlings through differential expression of AcZIP family genes as claimed in claim 4, wherein the step two, the collecting of the sample comprises:

collecting leaves and main roots of areca seedlings with yellowing phenomenon, wiping the leaves and the main roots with 75% ethanol, freeze-drying the leaves and the main roots with liquid nitrogen, extracting RNA of a sample by using a radix asparagi polysaccharide polyphenol plant total RNA extraction kit, and carrying out cDNA synthesis and cryopreservation at-20 ℃ according to the operation of a reverse transcription kit.

7. The method for determining the zinc deficiency status of areca seedlings through differential expression of AcZIP family genes as claimed in claim 4, wherein in step three, the ZIP family analysis comprises:

the ZIP family PF02535 plays an important role in the transport of plant iron and zinc; two groups of ZIP genes which are differentially expressed in a transcriptome are selected to distinguish zinc deficiency, and four groups of ZIP genes are simply named ZIP1 and ZIP 2.

8. The method for judging the zinc deficiency state of areca seedlings through differential expression of AcZIP family genes as claimed in claim 4, wherein in the fifth step, the specificity verification of the primers comprises:

performing PCR amplification by using the extracted cDNA of the normal sample as a template, wherein the sizes of amplified target bands are 267bp and 291bp respectively; recovering the PCR product, ligating the T-vector, sequencing, and comparing the sequence with the nucleic acid sequences of ZIP1 and ZIP2 to detect the specificity of the primers; wherein the nucleic acid sequence of ZIP1 is shown in SEQ ID NO: 4, the nucleotide sequence of ZIP2 is shown as SEQ ID NO: 5 is shown in the specification;

wherein, the PCR reaction system comprises:

the total reaction system is as follows: 25 mu L of the solution; 2 Vazyme LAMP Master Mix: 12.5 mu L; ZIP-F: 1 mu L of the solution; ZIP-R: 1 muL；cDNA：1μL；ddH₂O：9.5μL；

The PCR reaction procedure: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 30s, annealing at 54 ℃ for 30s, and extension at 72 ℃ for 45s for 35 cycles; supplementary extension at 72 ℃ for 10 min; PCR amplification products were detected by electrophoresis on 1.5% agarose gel.

9. The method for determining the zinc deficiency status of areca seedlings through differential expression of AcZIP family genes as claimed in claim 4, wherein in step six, the real-time fluorescence quantitative PCR detection comprises:

using iTaq^TMPerforming fluorescent quantitative PCR detection on a cDNA template by adopting a fluorescent quantitative PCR instrument through a Universal SYBR Green Supermix, namely a Bio-RAD kit, a ZIP gene detection primer and an internal reference primer; after the fluorescent quantitative PCR is finished, performing melting curve analysis on the result, and verifying the specificity of amplification again;

wherein, the fluorescence quantitative system comprises the following components:

the total reaction system is 20 mu L; 2 LightCycler SYBR Green I Master: 10 mu L of the solution; an upstream primer-F: 0.5 mu L; downstream primer-R: 0.5 mu L; template: 1 mu L of the solution; ddH₂O: adding water to the mixture until the total volume is 20 mu L;

in the real-time fluorescent quantitative PCR process, the amplification procedure is as follows: pre-denaturation at 95 ℃ for 15 min; denaturation at 95 ℃ for 10 s; annealing at 60 ℃ for 30 s; a total of 40 cycles; after the PCR is finished, the temperature is controlled at 0.1 ℃ s^-1The temperature rise rate is increased from 72 ℃ to 95 ℃ to carry out analysis and verification of a dissolution curve; a real-time fluorescent quantitative PCR instrument is adopted for carrying out the detection; after the circulation is finished, the amplification result is analyzed by adopting the analysis software carried by the instrument.

10. The use of the real-time fluorescent quantitative PCR detection kit for ZIP genes according to claim 1 for detecting the iron deficiency or zinc deficiency of betel nuts, wherein the sample to be detected comprises betel nut leaves and betel nut taproots.

Background

At present, zinc (Zn) is a trace element essential for plant growth, and has irreplaceable effects on plant growth and metabolism. Zinc ions exist primarily as complexes of proteins and activators of various proteins, and are involved in a variety of vital activities, including carbohydrate metabolism, protein synthesis, maintenance of cell membrane integrity, regulation of auxin synthesis, and pollen formation. Plants also need to regulate and maintain gene expression required for tolerance to environmental stresses, such as high light intensity and high temperature. If used in excess, can be potentially toxic. Excess Zn binds to sulfur, nitrogen and oxygen containing functional groups in biomolecules due to its unregulated high affinity.

The principle of the fluorescent quantitative PCR is that a PCR product is marked and tracked through a fluorescent dye or a fluorescent marked specific probe, the reaction process is monitored in real time, and the information such as the initial concentration of a template, the type of nucleic acid, the type of gene mutation and the like can be accurately judged finally through the real-time analysis of the product amount. At present, the fluorescence quantitative PCR has wide application in the fields of biological research and gene detection of individual medicine.

ZIP is a gene playing an important role in the transport of plant zinc, responds to the zinc deficiency of plants, and is verified in plants such as rice, corn, wheat and the like. The ZIP gene family may have a phenomenon of differential expression under the condition of zinc deficiency, but in the prior art, no report is found on a method for judging the zinc deficiency state of areca seedlings through differential expression of the ZIP gene family. Therefore, a method for determining whether the betel nut seedling is in a zinc deficiency state through the expression of the differential gene is needed.

Through the above analysis, the problems and defects of the prior art are as follows: in the prior art, the zinc deficiency state of betel nuts is not detected in detail through a molecular level, whether the betel nuts are in the zinc deficiency state is detected through physiological and biochemical indexes, and a method for judging the zinc deficiency state of betel nut seedlings through differential expression of AcZIP gene families is not reported.

The difficulty in solving the above problems and defects is: the zinc deficiency of the betel nut can be responded by the betel nut ZIP gene through multiple aspects, then the gene with relatively obvious change degree is selected according to the response degree, and the change trend of the zinc deficiency of the betel nut can be inconsistent with that of other metal ions of the betel nut, so that the zinc deficiency of the betel nut can be distinguished through the ZIP gene.

The significance of solving the problems and the defects is as follows: the zinc deficiency state of the betel nut is reflected through the response condition of the ZIP gene on the molecular level, and the molecular response of the betel nut under the zinc deficiency condition is more accurately explained.

Disclosure of Invention

Aiming at the problems in the prior art, the invention provides a real-time fluorescence quantitative PCR detection kit and a method for judging the zinc deficiency state of areca seedlings, and particularly relates to a kit for detecting the differential gene expression level of areca seeds by utilizing genes differentially expressed in zinc deficiency through a fluorescence quantitative PCR technology and application thereof.

The method for judging the zinc deficiency state of the betel nut seedlings through differential expression of the AcZIP family genes comprises the following steps:

firstly, treating areca for zinc deficiency in an experimental base;

collecting a sample;

step three, carrying out ZIP family analysis;

step four, designing a primer;

fifthly, verifying the specificity of the primer;

and step six, performing real-time fluorescent quantitative PCR detection.

Further, in the first step, the treatment of areca zinc deficiency in the experimental base comprises:

in an experimental base, Hoagland is used as a formula, the areca seedlings subjected to adaptive culture in one leaf stage are subjected to iron deficiency and zinc deficiency treatment by adopting a water culture method, and the culture solution is replaced every other week until the areca seedlings have an obvious phenotype; wherein, the new leaves of the betel nut seedlings lack of zinc are in a latticed yellowing phenomenon.

Further, in the second step, the collecting of the sample includes:

collecting leaves and main roots of areca seedlings with yellowing phenomenon, wiping the leaves and the main roots with 75% ethanol, freeze-drying the leaves and the main roots with liquid nitrogen, extracting RNA of a sample by using a radix asparagi polysaccharide polyphenol plant total RNA extraction kit, and carrying out cDNA synthesis and cryopreservation at-20 ℃ according to the operation of a reverse transcription kit.

Further, in step three, the ZIP family analysis, comprising:

the ZIP family PF02535 plays an important role in the transport of plant iron and zinc; two groups of ZIP genes which are differentially expressed in a transcriptome are selected to distinguish zinc deficiency, and four groups of ZIP genes are simply named ZIP1 and ZIP 2.

Further, in the fourth step, the primer design comprises:

designing specific primers of each gene by using primer5 software according to the sequence of the ZIP gene; wherein the nucleotide sequence of the primer ZIP1 is shown as SEQ ID NO: 1, and the nucleotide sequence of the primer ZIP2 is shown as SEQ ID NO: 2, the nucleotide sequence of the internal reference primer is shown as SEQ ID NO: 3 is shown in the specification; the two single-stranded DNAs in the primer pair can be separately packaged by shellfish or can be packaged by equimolar mixture.

Further, in step five, the specificity verification of the primers comprises:

performing PCR amplification by using the extracted cDNA of the normal sample as a template, wherein the sizes of amplified target bands are 267bp and 291bp respectively; recovering the PCR product, ligating the T-vector, sequencing, and comparing the sequence with the nucleic acid sequences of ZIP1 and ZIP2 to detect the specificity of the primers; wherein the nucleic acid sequence of ZIP1 is shown in SEQ ID NO: 4, the nucleotide sequence of ZIP2 is shown as SEQ ID NO: 5, respectively.

Wherein, the PCR reaction system comprises:

the total reaction system is as follows: 25 mu L of the solution; 2 Vazyme LAMP Master Mix: 12.5 mu L; ZIP-F: 1 mu L of the solution; ZIP-R: 1 mu L of the solution; cDNA: 1 mu L of the solution; ddH₂O：9.5μL。

The PCR reaction procedure: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 30s, annealing at 54 ℃ for 30s, and extension at 72 ℃ for 45s for 35 cycles; supplementary extension at 72 ℃ for 10 min; PCR amplification products were detected by electrophoresis on 1.5% agarose gel.

Further, in the sixth step, the real-time fluorescent quantitative PCR detection includes:

using iTaq^TMPerforming fluorescent quantitative PCR detection on a cDNA template by adopting a fluorescent quantitative PCR instrument through a Universal SYBR Green Supermix, namely a Bio-RAD kit, a ZIP gene detection primer and an internal reference primer; and (5) after the fluorescent quantitative PCR is finished, performing melting curve analysis on the result, and verifying the specificity of amplification again.

Wherein, the fluorescence quantitative system comprises the following components:

the total reaction system is 20 mu L; 2 LightCycler SYBR Green I Master: 10 mu L of the solution; an upstream primer-F: 0.5 mu L; downstream primer-R: 0.5 mu L; template: 1 mu L of the solution; ddH₂O: water was added to a total volume of 20. mu.L.

In the real-time fluorescent quantitative PCR process, the amplification procedure is as follows: pre-denaturation at 95 ℃ for 15 min; denaturation at 95 ℃ for 10 s; annealing at 60 ℃ for 30 s; a total of 40 cycles; after the PCR is finished, the temperature is controlled at 0.1 ℃ s^-1The temperature rise rate is increased from 72 ℃ to 95 ℃ to carry out analysis and verification of a dissolution curve; a real-time fluorescent quantitative PCR instrument is adopted for carrying out the detection; after the circulation is finished, the amplification result is analyzed by adopting the analysis software carried by the instrument.

The invention also aims to provide a real-time fluorescence quantitative PCR detection kit for the ZIP genes, which is applied to the method for judging the zinc deficiency state of the betel nut seedlings through differential expression of the AcZIP family genes.

The invention also aims to provide an application of the real-time fluorescence quantitative PCR detection kit for the ZIP gene in detecting the iron deficiency or the zinc deficiency of the betel nut, and the application method comprises the following steps:

extracting genome RNA of a sample to be detected, performing reverse transcription to obtain cDNA as a template, performing RT-qPCR reaction by using a ZIP gene detection primer in the kit and an internal reference primer, and calculating relative abundance according to 2^ (-delta Ct) by using a normal sample as a control to obtain the relative expression quantity of the gene;

according to the relative expression of AcZIP family, if the expression of ZIP1 in the new leaves is not significantly changed, the expression of ZIP1 in the roots is significantly increased, the expression of ZIP2 in the new leaves is significantly up-regulated, and the expression of ZIP2 in the roots is not significantly changed, which indicates that the plants are stressed by zinc deficiency.

Further, the sample to be detected comprises betel nut leaves and betel nut main roots.

By combining all the technical schemes, the invention has the advantages and positive effects that: according to the method for judging the zinc deficiency state of the betel nut seedlings through differential expression of the AcZIP family genes, provided by the invention, the detection primers for detecting the zinc deficiency of the betel nuts are obtained by utilizing the difference of gene expression levels caused by zinc deficiency treatment and according to different trend changes of the expression levels of the differential genes in different treatments; the detection primers in the kit have high specificity, and only a normal sample and a sample with yellowing are needed to be provided, and then whether the areca seedling is in a zinc deficiency state is judged by a real-time fluorescence quantitative PCR technology so as to provide a basis for subsequent treatment.

The invention also develops a real-time fluorescence quantification diagnosis kit for areca zinc deficiency based on the ZIP family, and the reasons of the iron deficiency and zinc deficiency states of areca seedlings can be determined by only providing samples and detecting according to the provided method, so that a basis is provided for subsequent prevention.

According to the invention, ZIP family genes are obtained through the difference of structural domains, and AcZIP genes capable of judging the zinc deficiency state of areca nuts are obtained through real-time fluorescent quantitative PCR verification. The specificity of the primers is illustrated by primer gel imaging and a melting curve, and the reliability of the result is illustrated by mutual verification of real-time fluorescence quantitative PCR results.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments of the present invention will be briefly described below, and it is obvious that the drawings described below are only some embodiments of the present invention, and it is obvious for those skilled in the art that other drawings can be obtained according to the drawings without creative efforts.

FIG. 1 is a flowchart of a method for determining a zinc deficiency status of a betel nut seedling by differential expression of AcZIP family genes, provided by an embodiment of the present invention.

FIG. 2 is a gel imaging verification chart for verifying primer specificity by PCR using primers provided in the embodiments of the present invention.

FIGS. 3(a) and 3(b) are graphs showing the results of detecting the relative expression level of areca gene by the fluorescence quantitative PCR method according to the embodiment of the present invention.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

Aiming at the problems in the prior art, the invention provides a method for judging the zinc deficiency state of areca seedlings by differential expression of AcZIP family genes, and the invention is described in detail by combining the attached drawings.

As shown in fig. 1, the method for determining the zinc deficiency status of betel nut seedlings through differential expression of AcZIP family genes provided by the embodiment of the present invention includes the following steps:

s101, performing zinc deficiency treatment on the betel nuts in an experiment base;

s102, collecting a sample;

s103, carrying out ZIP family analysis;

s104, designing a primer;

s105, carrying out specificity verification on the primer;

and S106, carrying out real-time fluorescent quantitative PCR detection.

The technical solution of the present invention will be further described with reference to the following examples.

The invention develops a ZIP family-based real-time fluorescence quantification diagnosis kit for areca zinc deficiency, and the reasons of the iron deficiency and zinc deficiency states of areca seedlings can be determined by only providing samples and detecting according to the provided method, so that a basis is provided for subsequent prevention.

The invention aims to provide a kit for judging the zinc deficiency state of areca seedlings by differential expression of AcZIP and application thereof. The kit determines whether the areca is deficient in zinc or not by differential expression of areca-nut related genes caused by response of the areca to the deficiency in zinc, has the characteristics of strong specificity, easiness in operation and reliable result, and has great potential application value.

The invention provides a real-time fluorescence quantitative kit for rapidly detecting zinc deficiency of betel nuts, which comprises a group of detection primers based on a ZIP family and an internal reference primer.

The invention comprises the following steps:

1. treatment for zinc deficiency of areca nuts in experimental base

In an experimental base, Hoagland is used as a formula, the areca seedlings subjected to adaptive culture in one leaf stage are subjected to iron deficiency and zinc deficiency treatment by adopting a water culture method, and the culture solution is replaced every other week until the areca seedlings have an obvious phenotype. The new leaves of the betel nut seedlings lack of zinc are in a latticed yellowing phenomenon.

2. Collection of samples

Collecting leaves and main roots of areca seedlings with yellowing phenomenon, wiping the leaves and the main roots with 75% ethanol, freeze-drying the leaves and the main roots with liquid nitrogen, extracting RNA of a sample by using a radix asparagi polysaccharide polyphenol plant total RNA extraction kit, and carrying out cDNA synthesis and cryopreservation at-20 ℃ according to the reverse transcription kit operation of TaKaRa company.

3. ZIP family analysis

The ZIP family (PF02535) plays an important role in the transport of plant iron and zinc. Two groups of ZIP genes which are differentially expressed in the transcriptome are selected to distinguish zinc deficiency (the result is shown in figure 2-3), and four groups of ZIP genes are simply named as ZIP1 and ZIP 2.

4. Primer design

Based on the sequence of the ZIP gene, primer5 software was used to design primers specific to each gene.

ZIP1-F：ATAGCCATTGCTTCGATTCTGACG

ZIP1-R：CGGCGAACGGGAAGTTATGC

ZIP2-F：CTGTCCTTCCACCAGTTC

ZIP2-R：CAAAGAAGCACGCCATCA

Internal reference primers: an action-F: GTATCGTGCTTGATTATGG, respectively;

Actin-R：GCTACTCTTGGCTGTCTCC

wherein, the two single-stranded DNAs in the primer pair can be packaged separately by shellfish or can be packaged in an equimolar mixture.

5. Primer specificity verification

The extracted cDNA of the normal sample is used as a template to carry out PCR amplification, and the sizes of amplified target bands are 267bp and 291bp respectively. The PCR product was recovered, ligated to T-vector, sent to Biotechnology (Shanghai) Inc., for sequencing, and compared with the following nucleic acid sequence to detect the specificity of the primer.

Sequence of ZIP 1:

ATGAAGCCTCTTTTTCTCCTCTCCTCCATCTTCCTCCTCCTCCTCCTCCTCCCTCTCCATGTTCTAGCAGACTGCGAGTGCACCAGCAACCCCGAAGGCCTCGACACACCGAAGGCTCTAAAGCTGAAGTTTATAGCCATTGCTTCGATTCTGACGGCGGGTGCGATTGGAGTCCTCCTTCCGATCCTCGGGAGGTCGGTCGCAGCCCTCCGGCCGGAGAACGATGTGTTCTTCGTAATCAAGACCTTTGCGGCCGGTGTCATACTTGCGACCGGCCTGATTCACATCCTCCCGGCCGCCTTCGAGAGCTTGACATCTCCTTGTCTAAAGGATGATCCATGGCATAACTTCCCGTTCGCCGGCTTTGTGGCCATGCTGTCGGCCATCGGGACGATGATGGTGGACTCGTTTGCCACCAGCTACTATAGAAGGTCTCACTTCAGCAAGGCGCGGCCTGTGGAAGGAGACGAGGGGGGTATCGGGGATGAGGAGAACTCGGTAGGCCATGCTGACCACGTGCATGTCCACACGCACGCCACCCATGGCCACGCGCATGGCTCGGTGCCGGTCTCGCCGGAGGACGCCTCCCTTGCTGAAAGAATCCGGCATCGGATTATTTCCCAAGTTTTGGAGTTGGGCATTGTAGTACATTCTCTGGTTATTGGTATTTCTCTGGGTGCTTCTGAAAGGCCCTCCACCATAAGGCCTTTGCTGGGAGCCCTGAGTTTCCATCAATTCTTTGAAGGTATAGGACTTGGTGGATGCATAGTGCAGGCAAACTTTAGAGCTAAGGCTACGGTGATCATGGCAGTCTTTTTCTCTCTCACAGCTCCAATTGGCATTGCATTAGGGATTGCAATATCATCAAGCTATGACGAAAATAGCGCAATTGCCCTTATCATTGAGGGTATTTTCAATGCTGCCTCTGCTGGAATTCTAATTTATATGGCTCTCGTTGATCTCTTGGCAGCTGATTTAGCCAACCCTAAGATACAAAATAATGGGAGGCTTCAACTAAGAACACATCTTGCCCTTCTTCTTGGTGCAGCTTTAATGTCCATTCTTGCCAAATGGGCTTAG

sequence of ZIP 2:

ATGGTGGCGGGCGATGGAGAATGCCGTGACGACGAGGCTGCGATACCCTTGAAACTGGCCGCAATCGCCGCGATCCTCGTCGCCAGCATAGCCGGTGTGGCGATCCCGCTCGCCGGGAGACGGCGGCCGTTCCTCCTCCCCGACGGTGGCGGGTTCCTCTTCGTCAAGGCCTTTGGAGCGGGCTTGATCCTGGCGACGGGATTCGTCCACATGCTCCCCGAGGCGGCGGAGTCGCTGGCGGACGCCGCCATGTCGGCGCGGGCGTGGCCTGAGTTCCCATTCGCGGGCTTTGCGGCGATATATGGTGGCCGCCCTCGCTACGTTCGTGCTGGACTTCGTCGGAACGACGTTCTACGAGCGGGAGCACGGAACGGAGGAGGGAAGCAGGAGGCGAGGGTTTGGGTCCGGTCCCCGGGGAGTGGCGAGTCAGGCTTGTCCTTGGGGATATCACAAAACCGATGCACGATTAGGCCCCTGAAATCTGCCCTGTCCTTCCACCAGTTCTTCGAGGGTTTTGCGCTGGGGGGATACATCTCTCAGGCTCAATTCAGCAGTCTCAAAGAAACGGTGATGGCGTGCTTCTTTGGCCTTGACAACACCTGGAGGGATCGGCCTGGGGCTCTCAGTGGCATCATTTTATGA

common PCR reaction system (total reaction system 25. mu.L) comprises the following specific systems:

2*Vazyme LAMP Master Mix：12.5μL

ZIP-F：1μL

ZIP-R：1μL

cDNA：1μL

ddH₂O：9.5μL

general PCR reaction procedure: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 30s, annealing at 54 ℃ for 30s, and extension at 72 ℃ for 45s for 35 cycles; extension was supplemented at 72 ℃ for 10 min. PCR amplification products were detected by electrophoresis on 1.5% agarose gel.

6. Real-time fluorescent quantitative PCR

Using iTaq^TMThe Universal SYBR Green Supermix (Bio-RAD) kit, the ZIP gene detection primer and the internal reference primer adopt a fluorescent quantitative PCR instrument to carry out fluorescent quantitative PCR detection on a cDNA template. And (4) after the fluorescent quantitative PCR is finished, performing melting curve analysis on the result, and verifying the specificity of amplification again.

The fluorescence quantification system was as follows (20. mu.L total reaction):

LightCycler SYBR Green I Master(2*)：10μL

an upstream primer-F: 0.5. mu.L

Downstream primer-R: 0.5. mu.L

Template: 1 μ L

ddH₂O: adding water to a total volume of 20 μ L

In the real-time fluorescent quantitative PCR process, the amplification procedure is as follows: pre-denaturation at 95 ℃ for 15 min; denaturation at 95 ℃ for 10 s; annealing at 60 ℃ for 30 s; for a total of 40 cycles. After the PCR is finished, the temperature is controlled at 0.1 ℃ s^-1The rate of temperature increase from 72 ℃ to 95 ℃ was used for analytical verification of the dissolution curve. The method is carried out by adopting a real-time fluorescent quantitative PCR instrument. After the circulation is finished, the amplification result is analyzed by adopting the analysis software carried by the instrument.

Each qPCR reaction was repeated three times. Ct values were recorded for qPCR reaction systems. According to the relative expression amount of the gene under different treatments calculated by 2^ (-delta Ct), it can be seen that ZIP1 is hardly expressed in the leaf, the expression amount is obviously increased in the root with zinc deficiency, the expression amount of ZIP1 is not obviously changed in the new leaf, the expression amount is obviously increased in the root, the expression amount of ZIP2 is obviously up-regulated in the new leaf, and the expression amount is not obviously changed in the root.

The RNA extraction method, the reverse transcription method and the reagents used in the present invention can be replaced under the condition of confirming the principle.

According to the invention, ZIP family genes are obtained through the difference of structural domains, and AcZIP genes capable of judging the zinc deficiency state of areca nuts are obtained through real-time fluorescent quantitative PCR verification. Primer gel imaging and melting curves illustrate the specificity of the primers, while the mutual impression of the real-time fluorescence quantitative PCR results demonstrates the reliability of the results.

The kit extracts RNA of a sample by using a total RNA extraction kit of a Tiangen polysaccharide polyphenol plant, cDNA synthesis is carried out according to the operation of a reverse transcription kit of TaKaRa company, and iTaq is utilized^TMThe Universal SYBR Green Supermix (Bio-RAD) kit, the ZIP gene detection primer and the internal reference primer adopt a fluorescent quantitative PCR instrument to carry out fluorescent quantitative PCR detection on a cDNA template.

The invention also provides application of the real-time fluorescence quantitative PCR detection kit for the ZIP gene in detecting the iron deficiency or the zinc deficiency of the betel nut, the application method comprises the steps of extracting genome RNA of a sample to be detected, carrying out reverse transcription to obtain cDNA as a template, carrying out RT-qPCR reaction by using a ZIP gene detection primer in the kit and an internal reference primer, and calculating the relative abundance according to 2^ (-delta Ct) by using a normal sample as a control to obtain the relative expression quantity of the gene. According to the relative expression of AcZIP family, if the expression of ZIP1 in the new leaves is not significantly changed, the expression of ZIP1 in the roots is significantly increased, the expression of ZIP2 in the new leaves is significantly up-regulated, and the expression of ZIP2 in the roots is not significantly changed, which indicates that the plants are stressed by zinc deficiency.

In the present invention, the method for extracting RNA from a sample to be tested and the inversion is not limited, and any known extraction method or kit may be used.

The sample of the invention comprises betel nut leaves and betel nut taproots.

The experiment utilizes the difference of gene expression quantity caused by zinc deficiency treatment, and obtains a detection primer for detecting the zinc deficiency of the betel nut according to different trend changes of the expression quantity of the difference gene in different treatments; the detection primers in the kit have high specificity, and only a normal sample and a sample with yellowing are needed to be provided, and then whether the areca seedling is in a zinc deficiency state is judged by a real-time fluorescence quantitative PCR technology so as to provide a basis for subsequent treatment.

In the description of the present invention, "a plurality" means two or more unless otherwise specified; the terms "upper", "lower", "left", "right", "inner", "outer", "front", "rear", "head", "tail", and the like, indicate orientations or positional relationships based on the orientations or positional relationships shown in the drawings, are only for convenience in describing and simplifying the description, and do not indicate or imply that the device or element referred to must have a particular orientation, be constructed in a particular orientation, and be operated, and thus, should not be construed as limiting the invention. Furthermore, the terms "first," "second," "third," and the like are used for descriptive purposes only and are not to be construed as indicating or implying relative importance.

The above description is only for the purpose of illustrating the present invention and the appended claims are not to be construed as limiting the scope of the invention, which is intended to cover all modifications, equivalents and improvements that are within the spirit and scope of the invention as defined by the appended claims.

Sequence listing

<110> university of Hainan

<120> real-time fluorescence quantitative PCR detection kit and method for judging zinc deficiency state of betel nut seedlings

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atagccattg cttcgattct gacgcggcga acgggaagtt atgc 44

<210> 2

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ctgtccttcc accagttcca aagaagcacg ccatca 36

<210> 3

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gtatcgtgct tgattatggg ctactcttgg ctgtctcc 38

<210> 4

<211> 1080

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atgaagcctc tttttctcct ctcctccatc ttcctcctcc tcctcctcct ccctctccat 60

gttctagcag actgcgagtg caccagcaac cccgaaggcc tcgacacacc gaaggctcta 120

aagctgaagt ttatagccat tgcttcgatt ctgacggcgg gtgcgattgg agtcctcctt 180

ccgatcctcg ggaggtcggt cgcagccctc cggccggaga acgatgtgtt cttcgtaatc 240

aagacctttg cggccggtgt catacttgcg accggcctga ttcacatcct cccggccgcc 300

ttcgagagct tgacatctcc ttgtctaaag gatgatccat ggcataactt cccgttcgcc 360

ggctttgtgg ccatgctgtc ggccatcggg acgatgatgg tggactcgtt tgccaccagc 420

tactatagaa ggtctcactt cagcaaggcg cggcctgtgg aaggagacga ggggggtatc 480

ggggatgagg agaactcggt aggccatgct gaccacgtgc atgtccacac gcacgccacc 540

catggccacg cgcatggctc ggtgccggtc tcgccggagg acgcctccct tgctgaaaga 600

atccggcatc ggattatttc ccaagttttg gagttgggca ttgtagtaca ttctctggtt 660

attggtattt ctctgggtgc ttctgaaagg ccctccacca taaggccttt gctgggagcc 720

ctgagtttcc atcaattctt tgaaggtata ggacttggtg gatgcatagt gcaggcaaac 780

tttagagcta aggctacggt gatcatggca gtctttttct ctctcacagc tccaattggc 840

attgcattag ggattgcaat atcatcaagc tatgacgaaa atagcgcaat tgcccttatc 900

attgagggta ttttcaatgc tgcctctgct ggaattctaa tttatatggc tctcgttgat 960

ctcttggcag ctgatttagc caaccctaag atacaaaata atgggaggct tcaactaaga 1020

acacatcttg cccttcttct tggtgcagct ttaatgtcca ttcttgccaa atgggcttag 1080

<210> 5

<211> 642

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atggtggcgg gcgatggaga atgccgtgac gacgaggctg cgataccctt gaaactggcc 60

gcaatcgccg cgatcctcgt cgccagcata gccggtgtgg cgatcccgct cgccgggaga 120

cggcggccgt tcctcctccc cgacggtggc gggttcctct tcgtcaaggc ctttggagcg 180

ggcttgatcc tggcgacggg attcgtccac atgctccccg aggcggcgga gtcgctggcg 240

gacgccgcca tgtcggcgcg ggcgtggcct gagttcccat tcgcgggctt tgcggcgata 300

tatggtggcc gccctcgcta cgttcgtgct ggacttcgtc ggaacgacgt tctacgagcg 360

ggagcacgga acggaggagg gaagcaggag gcgagggttt gggtccggtc cccggggagt 420

ggcgagtcag gcttgtcctt ggggatatca caaaaccgat gcacgattag gcccctgaaa 480

tctgccctgt ccttccacca gttcttcgag ggttttgcgc tggggggata catctctcag 540

gctcaattca gcagtctcaa agaaacggtg atggcgtgct tctttggcct tgacaacacc 600

tggagggatc ggcctggggc tctcagtggc atcattttat ga 642