1. A real-time fluorescence quantitative PCR detection kit for rapidly detecting areca nut iron deficiency is characterized by comprising a group of detection primers based on a ZIP family and an internal reference primer.

2. The real-time fluorescence quantitative PCR detection kit for rapidly detecting the iron deficiency of the betel nut as claimed in claim 1, wherein the detection primers based on the ZIP family comprise a specific primer ZIP1 and a specific primer ZIP 2; wherein, the nucleotide sequence of the specific primer ZIP1 is SEQ ID NO: 1, the nucleotide sequence of the specific primer ZIP2 is shown as SEQ ID NO: 2 is shown in the specification; the nucleotide sequence of the internal reference primer is SEQ ID NO: 3, respectively.

3. The application of the real-time fluorescence quantitative PCR detection kit for rapidly detecting the iron deficiency of the betel nut as claimed in any one of claims 1 to 2 in detecting the iron deficiency or the zinc deficiency of the betel nut, wherein the application method of the real-time fluorescence quantitative PCR detection kit for rapidly detecting the iron deficiency of the betel nut in detecting the iron deficiency or the zinc deficiency of the betel nut is as follows:

extracting genome RNA of a sample to be detected by using a total RNA extraction kit of a Tiangen polysaccharide polyphenol plant, carrying out reverse transcription to obtain cDNA (complementary deoxyribonucleic acid) as a template, carrying out RT-qPCR (reverse transcription-quantitative polymerase chain reaction) by using a ZIP (zinc azide) gene detection primer in the kit and an internal reference primer, and calculating relative abundance according to 2^ (-delta Ct) by using a normal sample as a control to obtain the relative expression quantity of the gene; according to the relative expression of AcZIP family, if the expression of ZIP1 in leaves and roots is not significantly different, while the expression of ZIP2 in new leaves is sharply reduced and is not significantly changed in roots, the plant is stressed by iron deficiency; wherein the sample comprises betel nut leaves and betel nut taproots.

4. A method for judging the iron deficiency state of areca seedlings through differential expression of AcZIP family genes by using the real-time fluorescence quantitative PCR detection kit for rapidly detecting areca iron deficiency as claimed in any one of claims 1-2, wherein the method for judging the iron deficiency state of the areca seedlings through differential expression of the AcZIP family genes comprises the following steps:

step one, performing betel nut iron deficiency treatment in an experiment base: hoagland is used as a formula, and the areca seedling subjected to adaptive culture in one leaf stage is subjected to iron deficiency treatment by adopting a water culture method;

step two, collecting samples: collecting leaves and main roots of areca seedlings with yellowing phenomenon, wiping the leaves and the main roots with 75% ethanol, and freeze-drying with liquid nitrogen;

step three, ZIP family analysis: designing primers according to the existing plant ZIP genes for PCR amplification, wherein the two groups of ZIP genes are simply named ZIP1 and ZIP 2;

step four, primer design: designing specific primers of each gene by using primer5 software according to the sequence of the ZIP gene;

step five, verifying the specificity of the primers: taking cDNA of the extracted normal sample as a template, performing PCR amplification, sequencing, comparing with a nucleic acid sequence, and detecting the specificity of the primer;

step six, real-time fluorescence quantitative PCR: and (3) carrying out fluorescent quantitative PCR detection and melting curve analysis on the cDNA template by using a fluorescent quantitative PCR instrument, and verifying the specificity of amplification again.

5. The method for determining betel nut seedling iron deficiency status through differential expression of AcZIP family genes as claimed in claim 4, wherein in the first step, the experimental base is used for betel nut iron deficiency treatment, comprising:

in an experimental base, Hoagland is used as a formula, the areca seedlings subjected to adaptive culture in one leaf stage are subjected to iron deficiency treatment by adopting a water culture method, and the culture solution is replaced every other week until the areca seedlings have an obvious phenotype; wherein, the new leaves of the betel nut seedlings with iron deficiency are all yellow.

6. The method for determining the iron deficiency status of betel nut seedlings through differential expression of AcZIP family genes as claimed in claim 4, wherein the step two, the collecting of the sample comprises:

collecting leaves and main roots of areca seedlings with yellowing phenomenon, wiping the leaves and the main roots with 75% ethanol, freeze-drying the leaves and the main roots with liquid nitrogen, extracting RNA of a sample by using a radix asparagi polysaccharide polyphenol plant total RNA extraction kit, and carrying out cDNA synthesis and cryopreservation at-20 ℃ according to the operation of a reverse transcription kit.

7. The method for judging the iron deficiency state of areca seedlings through differential expression of AcZIP family genes as claimed in claim 4, wherein in the fifth step, the specificity verification of the primers comprises:

performing PCR amplification by using the extracted cDNA of the normal sample as a template, wherein the sizes of amplified target bands are 229bp and 100bp respectively; recovering the PCR product, ligating the T-vector, sequencing, and comparing the sequence with the nucleic acid sequences of ZIP1 and ZIP2 to detect the specificity of the primers;

wherein the nucleotide sequence of ZIP1 is SEQ ID NO: 4, the nucleotide sequence of ZIP2 is shown as SEQ ID NO: 5, respectively.

8. The method for judging the iron deficiency state of areca seedlings through differential expression of AcZIP family genes as claimed in claim 4, wherein in the fifth step, the common PCR reaction system is as follows:

total reaction 25 μ L:

2*Vazyme LAMP Master Mix：12.5μL；

ZIP-F：1μL；

ZIP-R：1μL；

cDNA：1μL；

ddH2O：9.5μL；

the general PCR reaction procedure: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 30s, annealing at 54 ℃ for 30s, and extension at 72 ℃ for 45s for 35 cycles; supplementary extension at 72 ℃ for 10 min; PCR amplification products were detected by electrophoresis on 1.5% agarose gel.

9. The method for determining the iron deficiency status of betel nut seedlings through differential expression of AcZIP family genes as claimed in claim 4, wherein in the sixth step, the real-time fluorescence quantitative PCR detection comprises:

using iTaq^TMPerforming fluorescent quantitative PCR detection on a cDNA template by adopting a fluorescent quantitative PCR instrument through a Universal SYBR Green Supermix, namely a Bio-RAD kit, a ZIP gene detection primer and an internal reference primer; and (5) after the fluorescent quantitative PCR is finished, performing melting curve analysis on the result, and verifying the specificity of amplification again.

10. The method for determining the iron deficiency status of betel nut seedlings through differential expression of AcZIP family genes as claimed in claim 4, wherein in the sixth step, the amplification procedure in the real-time fluorescent quantitative PCR process is as follows: pre-denaturation at 95 ℃ for 15 min; denaturation at 95 ℃ for 10 s; annealing at 60 ℃ for 30 s; a total of 40 cycles; after the PCR is finished, the temperature is controlled at 0.1 ℃ s^-1The temperature rise rate is increased from 72 ℃ to 95 ℃ to carry out analysis and verification of a dissolution curve; a real-time fluorescent quantitative PCR instrument is adopted for carrying out the detection; after the circulation is finished, analyzing the amplification result by adopting the analysis software carried by the instrument;

each qPCR reaction was repeated three times; recording the Ct value of a qPCR reaction system; according to the relative expression amount of the gene under different treatments calculated by 2^ (-delta Ct), the expression amount of the ZIP1 in the leaves and the roots is not obviously different, while the expression amount of the ZIP2 in new leaves is sharply reduced and is not obviously changed in the roots.

Background

Currently, iron (Fe) is an essential trace element for plant growth, and has irreplaceable effects on plant growth and metabolism. Iron plays a role in various important processes such as photosynthesis, chloroplast development, chlorophyll synthesis, nitrogen metabolism, respiration, enzymatic redox reactions, and the like. Fe²⁺And Fe³⁺The presence of (b) makes it suitable for redox reactions and plays an important role in electron transfer. If used in excess, can be potentially toxic. Free Fe can produce toxic levels of oxygen and hydroxyl radicals by the Fenton reaction.

The principle of the fluorescent quantitative PCR is that a PCR product is marked and tracked through a fluorescent dye or a fluorescent marked specific probe, the reaction process is monitored in real time, and the information such as the initial concentration of a template, the type of nucleic acid, the type of gene mutation and the like can be accurately judged finally through the real-time analysis of the product amount. At present, the fluorescence quantitative PCR has wide application in the fields of biological research and gene detection of individual medicine.

ZIP is a gene playing an important role in plant iron transport, responds to plant iron deficiency, and is verified in plants such as rice, corn, wheat and the like. The ZIP gene family may show differential expression in case of iron deficiency. However, no report is found about a method for judging the iron deficiency state of areca seedlings by differential expression of AcZIP family genes in the prior art. Therefore, a method for determining whether the betel nut seedlings are in an iron deficiency state through the expression of differential genes is needed.

Through the above analysis, the problems and defects of the prior art are as follows: in the prior art, the state of the areca nut iron deficiency is not detected in detail through a molecular level, whether the areca nut is in the state of the areca nut iron deficiency is mostly detected through a physiological and biochemical means, and a method for judging the state of the areca nut iron deficiency through differential expression of AcZIP family genes is not reported.

The difficulty in solving the above problems and defects is: the fact that the ZIP genes of the betel nuts can respond to the iron deficiency of the betel nuts needs to be verified through multiple aspects, then the genes with relatively obvious change degrees are selected according to the response degrees, and the ZIP genes which can specifically respond to the iron deficiency of the betel nuts can be distinguished from the ZIP genes with inconsistent change trends of other metal ions of the betel nuts.

The significance of solving the problems and the defects is as follows: the iron-deficiency state of the betel nut is reflected through the response condition of the ZIP gene on the molecular level, and the molecular response of the betel nut under the condition of iron deficiency is more accurately explained.

Disclosure of Invention

Aiming at the problems in the prior art, the invention provides a kit for detecting the iron deficiency of betel nuts and a method for judging the iron deficiency state of betel nut seedlings, and particularly relates to a kit for detecting the expression level of betel nut differential genes by utilizing differential expression genes treated in the iron deficiency process through a fluorescence quantitative PCR technology and application thereof.

The invention is realized in such a way that the real-time fluorescence quantitative PCR detection kit for rapidly detecting the iron deficiency of the betel nut comprises a group of detection primers based on a ZIP family and an internal reference primer.

Further, the ZIP family-based detection primers comprise a specific primer ZIP1 and a specific primer ZIP 2; wherein, the nucleotide sequence of the specific primer ZIP1 is SEQ ID NO: 1, the nucleotide sequence of the specific primer ZIP2 is shown as SEQ ID NO: 2 is shown in the specification; the nucleotide sequence of the internal reference primer is SEQ ID NO: 3, respectively.

The invention also aims to provide an application of the real-time fluorescence quantitative PCR detection kit for rapidly detecting the iron deficiency of the betel nut in detecting the iron deficiency or the zinc deficiency of the betel nut, and the application method of the real-time fluorescence quantitative PCR detection kit for rapidly detecting the iron deficiency of the betel nut in detecting the iron deficiency or the zinc deficiency of the betel nut comprises the following steps:

extracting genome RNA of a sample to be detected by using a total RNA extraction kit of a Tiangen polysaccharide polyphenol plant, carrying out reverse transcription to obtain cDNA (complementary deoxyribonucleic acid) as a template, carrying out RT-qPCR (reverse transcription-quantitative polymerase chain reaction) by using a ZIP (zinc azide) gene detection primer in the kit and an internal reference primer, and calculating relative abundance according to 2^ (-delta Ct) by using a normal sample as a control to obtain the relative expression quantity of the gene; according to the relative expression of AcZIP family, if the expression of ZIP1 in leaves and roots is not significantly different, while the expression of ZIP2 in new leaves is sharply reduced and is not significantly changed in roots, the plant is stressed by iron deficiency; wherein the sample comprises betel nut leaves and betel nut taproots.

The invention also aims to provide a method for judging the iron deficiency state of areca seedlings by differential expression of AcZIP family genes by applying the real-time fluorescence quantitative PCR detection kit for rapidly detecting the iron deficiency of the areca seedlings, wherein the method for judging the iron deficiency state of the areca seedlings by differential expression of the AcZIP family genes comprises the following steps:

step one, performing betel nut iron deficiency treatment in an experiment base: hoagland is used as a formula, and the areca seedling subjected to adaptive culture in one leaf stage is subjected to iron deficiency treatment by adopting a water culture method;

step two, collecting samples: collecting leaves and main roots of areca seedlings with yellowing phenomenon, wiping the leaves and the main roots with 75% ethanol, and freeze-drying with liquid nitrogen;

step three, ZIP family analysis: designing primers according to the existing plant ZIP genes for PCR amplification, wherein the two groups of ZIP genes are simply named ZIP1 and ZIP 2;

step four, primer design: designing specific primers of each gene by using primer5 software according to the sequence of the ZIP gene;

step five, verifying the specificity of the primers: taking cDNA of the extracted normal sample as a template, performing PCR amplification, sequencing, comparing with a nucleic acid sequence, and detecting the specificity of the primer;

step six, real-time fluorescence quantitative PCR: and (3) carrying out fluorescent quantitative PCR detection and melting curve analysis on the cDNA template by using a fluorescent quantitative PCR instrument, and verifying the specificity of amplification again.

Further, in the first step, the betel nut iron deficiency treatment in the experimental base comprises:

in an experimental base, Hoagland is used as a formula, the areca seedlings subjected to adaptive culture in one leaf stage are subjected to iron deficiency treatment by adopting a water culture method, and the culture solution is replaced every other week until the areca seedlings have an obvious phenotype; wherein, the new leaves of the betel nut seedlings with iron deficiency are all yellow.

Further, in the second step, the collecting of the sample includes:

collecting leaves and main roots of areca seedlings with yellowing phenomenon, wiping the leaves and the main roots with 75% ethanol, freeze-drying the leaves and the main roots with liquid nitrogen, extracting RNA of a sample by using a radix asparagi polysaccharide polyphenol plant total RNA extraction kit, and carrying out cDNA synthesis and cryopreservation at-20 ℃ according to the operation of a reverse transcription kit.

Further, in step five, the specificity verification of the primers comprises:

performing PCR amplification by using the extracted cDNA of the normal sample as a template, wherein the sizes of amplified target bands are 229bp and 100bp respectively; the PCR products were recovered, ligated to T-vector, sequenced and compared to the nucleic acid sequences of ZIP1 and ZIP2 to detect the specificity of the primers.

Wherein the nucleotide sequence of ZIP1 is SEQ ID NO: 4, the nucleotide sequence of ZIP2 is shown as SEQ ID NO: 5, respectively.

Further, in step five, the general PCR reaction system is as follows:

total reaction 25 μ L:

2*Vazyme LAMP Master Mix：12.5μL；

ZIP-F：1μL；

ZIP-R：1μL；

cDNA：1μL；

ddH2O：9.5μL。

the general PCR reaction procedure: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 30s, annealing at 54 ℃ for 30s, and extension at 72 ℃ for 45s for 35 cycles; supplementary extension at 72 ℃ for 10 min; PCR amplification products were detected by electrophoresis on 1.5% agarose gel.

Further, in the sixth step, the real-time fluorescent quantitative PCR detection includes:

using iTaq^TMPerforming fluorescent quantitative PCR detection on a cDNA template by adopting a fluorescent quantitative PCR instrument through a Universal SYBR Green Supermix, namely a Bio-RAD kit, a ZIP gene detection primer and an internal reference primer; and (5) after the fluorescent quantitative PCR is finished, performing melting curve analysis on the result, and verifying the specificity of amplification again.

Further, in the sixth step, in the real-time fluorescent quantitative PCR process, the amplification procedure is as follows: pre-denaturation at 95 ℃ for 15 min; denaturation at 95 ℃ for 10 s; annealing at 60 ℃ for 30 s; a total of 40 cycles; after the PCR is finished, the temperature is controlled at 0.1 ℃ s^-1Rate of temperature rise from 72The temperature is increased to 95 ℃ for analysis and verification of a dissolution curve; a real-time fluorescent quantitative PCR instrument is adopted for carrying out the detection; after the circulation is finished, the amplification result is analyzed by adopting the analysis software carried by the instrument.

Each qPCR reaction was repeated three times; recording the Ct value of a qPCR reaction system; according to the relative expression amount of the gene under different treatments calculated by 2^ (-delta Ct), the expression amount of the ZIP1 in the leaves and the roots is not obviously different, while the expression amount of the ZIP2 in new leaves is sharply reduced and is not obviously changed in the roots.

By combining all the technical schemes, the invention has the advantages and positive effects that: the real-time fluorescent quantitative PCR detection kit for rapidly detecting the iron deficiency of the betel nut provided by the invention utilizes the difference of gene expression amount caused by iron deficiency treatment, and obtains a detection primer for detecting the iron deficiency of the betel nut according to different trend changes of the expression amount of different genes in different treatments; the detection primers in the kit have high specificity, and only a normal sample and a sample with yellowing are needed to be provided, and then the condition that whether the betel nut seedlings are in iron deficiency or not is judged through a real-time fluorescence quantitative PCR technology, so that a basis is provided for subsequent treatment.

The invention aims to provide a kit for judging the iron deficiency state of areca seedlings by differential expression of AcZIP and application thereof. The kit determines the iron deficiency of the betel nut by the differential expression of betel nut related genes caused by the response of the betel nut to the iron deficiency and the zinc deficiency, has the characteristics of strong specificity, easy operation and reliable result, and has great potential application value. The real-time fluorescence quantification betel nut iron deficiency diagnostic kit based on the ZIP family can determine whether betel nut seedlings are iron deficiency or not by only providing a sample and detecting according to the provided method, and provides a basis for subsequent prevention.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments of the present invention will be briefly described below, and it is obvious that the drawings described below are only some embodiments of the present invention, and it is obvious for those skilled in the art that other drawings can be obtained according to the drawings without creative efforts.

FIG. 1 is a flowchart of a method for determining the iron deficiency status of betel nut seedlings through differential expression of AcZIP family genes, provided by an embodiment of the present invention.

FIG. 2 is a gel imaging verification chart for verifying primer specificity by PCR using primers provided in the embodiments of the present invention.

FIG. 3 is a graph showing the results of detecting the relative expression level of betel nut gene by the fluorescent quantitative PCR method according to the embodiment of the present invention.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

Aiming at the problems in the prior art, the invention provides a method for judging the iron deficiency state of areca seedlings by differential expression of AcZIP family genes, and the invention is described in detail by combining the attached drawings.

The real-time fluorescence quantitative PCR detection kit for rapidly detecting the iron deficiency of the betel nuts, provided by the embodiment of the invention, comprises a group of detection primers based on a ZIP family and an internal reference primer.

The detection primer based on the ZIP family provided by the embodiment of the invention comprises a specific primer ZIP1 and a specific primer ZIP 2; wherein, the nucleotide sequence of the specific primer ZIP1 is SEQ ID NO: 1, the nucleotide sequence of the specific primer ZIP2 is shown as SEQ ID NO: 2 is shown in the specification; the nucleotide sequence of the internal reference primer is SEQ ID NO: 3, respectively.

As shown in fig. 1, the method for determining the iron deficiency state of betel nut seedlings through differential expression of AcZIP family genes provided by the embodiment of the present invention includes the following steps:

s101, performing betel nut iron deficiency treatment in an experimental base: hoagland is used as a formula, and the areca seedling subjected to adaptive culture in one leaf stage is subjected to iron deficiency treatment by adopting a water culture method;

s102, collecting a sample: collecting leaves and main roots of areca seedlings with yellowing phenomenon, wiping the leaves and the main roots with 75% ethanol, and freeze-drying with liquid nitrogen;

s103, ZIP family analysis: designing primers according to the existing plant ZIP genes for PCR amplification, wherein the two groups of ZIP genes are simply named ZIP1 and ZIP 2;

s104, primer design: designing specific primers of each gene by using primer5 software according to the sequence of the ZIP gene;

s105, primer specificity verification: taking cDNA of the extracted normal sample as a template, performing PCR amplification, sequencing, comparing with a nucleic acid sequence, and detecting the specificity of the primer;

s106, real-time fluorescence quantitative PCR: and (3) carrying out fluorescent quantitative PCR detection and melting curve analysis on the cDNA template by using a fluorescent quantitative PCR instrument, and verifying the specificity of amplification again.

The technical solution of the present invention will be further described with reference to the following examples.

The invention discloses a real-time fluorescence quantification betel nut iron deficiency diagnostic kit based on ZIP family, which can determine whether betel nut seedlings are iron deficiency or not by only providing a sample and detecting according to the provided method, and provides basis for subsequent prevention.

The invention aims to provide a kit for judging the iron deficiency state of areca seedlings by differential expression of AcZIP and application thereof. The kit determines the iron deficiency of the betel nut by the differential expression of betel nut related genes caused by the response of the betel nut to the iron deficiency and the zinc deficiency, has the characteristics of strong specificity, easy operation and reliable result, and has great potential application value.

The technical scheme adopted by the invention is as follows:

the invention provides a real-time fluorescence quantitative kit for rapidly detecting iron deficiency of betel nuts, which comprises a group of detection primers based on a ZIP family and an internal reference primer.

The invention comprises the following steps:

1. betel nut iron deficiency treatment in experimental base

In an experimental base, Hoagland is used as a formula, the areca seedlings subjected to adaptive culture in one leaf stage are subjected to iron deficiency treatment by adopting a water culture method, and the culture solution is replaced every other week until the areca seedlings have an obvious phenotype. As shown in FIGS. 2-3, the new leaves of the betel nut seedlings with iron deficiency showed total yellowing of the leaves.

2. Collection of samples

Collecting leaves and main roots of areca seedlings with yellowing phenomenon, wiping the leaves and the main roots with 75% ethanol, freeze-drying the leaves and the main roots with liquid nitrogen, extracting RNA of a sample by using a radix asparagi polysaccharide polyphenol plant total RNA extraction kit, and carrying out cDNA synthesis and cryopreservation at-20 ℃ according to the reverse transcription kit operation of TaKaRa company.

3. ZIP family analysis

The ZIP family (PF02535) plays an important role in plant iron transport. The primers are designed according to the existing plant ZIP genes for PCR amplification, and the two groups of ZIP genes are simply named ZIP1 and ZIP 2.

4. Primer design

Based on the sequence of the ZIP gene, primer5 software was used to design primers specific to each gene.

ZIP1-F：TGAGCCCTGGTTCTACCTCACTCGC

ZIP1-R：GCCGCAAAGGACTTGGAGAAGACGA

ZIP2-F：CGTGCCTCAAGGACAACCCG

ZIP2-R：CGATGCCCAACTCCAAGACC

The internal reference primer Actin-F: GTATCGTGCTTGATTATGG, respectively;

Actin-R：GCTACTCTTGGCTGTCTCC

wherein, the two single-stranded DNAs in the primer pair can be packaged separately by shellfish or can be packaged in an equimolar mixture.

5. Primer specificity verification

Taking the extracted cDNA of the normal sample as a template, carrying out PCR amplification, wherein the sizes of amplified target bands are 229bp and 100bp respectively. The PCR product was recovered, ligated to T-vector, sent to Biotechnology (Shanghai) Inc., for sequencing, and compared with the following nucleic acid sequence to detect the specificity of the primer.

Sequence of ZIP 1:

ATGTCTTTCTTTGAGGATCTTGAGCCCTGGTTCTACCTCACTCGCTTCCGCGACCAGCTGAGCGTTTTCTCTGAAACCATGTCAGCATCGATGGCGACGGCGAGCTGCACCGACGACGCGGCGGACGAGTGCCGCGATGACGCGGCGGCGCTGCGGCTGAAAATGGTAGCGATAGTGACGATCCTTGTGGCGGGGGTGACCGGGGTGACGATCCCCCTGGTGGGGCGCAAGCGGCGGTTACTGCGCACCGACGGCGGCCTCTTCGTCTTCTCCAAGTCCTTTGCGGCCGGCGTCATCCTTGCAACGGGGTTCGTCCACATGCTCCACGACGCCCAGTCGTCGCTGACGGACCCCTGCCTCCCGGAGTCGCCATGGCGGCGATTCCCGTTCTCCGGCTTCGTGGCAATGATGGCGGCGCTGGGGACCCTCTTGGTCGACTTCGTCGGGACTCAGTTCTACGAGCGGAAGCACCGGGAAGAGGCCAGGGGGGTCAAGGCGGCCACCGTGGCGGCGGTTGAGGCGGCGACAGCGGCCGAGGAGGATATCACCGTCATCTCGGTCTCGCCGGAGCCGGAAGAGGCGGCGGACGGCGTCAAGAGCCCGATGCACATTGTGGGGATGCACGCCCACGCGGCGGCGCACCGGCATAGCCACCCCTACGAGCACGGGGCGTGCGACGGCCCCGCGCTGCGGGAACGCGTCCCTGGCCACGCCCACGAGGACGAGGGCGTGGGCGAGGTCCCTTCTCATGTGCGCCACGTGGTCGTATCCCAGATACTGGAACTAGGAATCGTGTCCCACTCGGTGATCATCGGGTTGTCACTCGGTGTCTCCCGGAGTCCGTGCACCATAAGGCCACTCATTGCAGCCTTATCCTTCCACCAGTTCTTCGAAGGCTTCGCATTGGGTGGATGCATCTCCCAGGCACAGTTCAGGAACTTGTCGGCCGCGCTGATGGCGTGCTTCTTTGCGATCACGACGCCGACCGGCATCGGCGTCGGAGCGGGTGTTGCGTCGTTCTACAACGCCAACAGCCCGAGGGCGCTGGTGGTGGAGGGGATACTGGACTCGATATCCGCCGGCATTCTCATCTACATGGCATTGGTTGATCTAATCGCGGCGGATTTTCTTAGCAGGAGGATGAGCTGCAATGTTAGGCTTCAGGTGGCGTCTTACATGGCCCTTTTTCTTGGCGCTGGTTCCATGTCCGCCCTCGCAGTCTGGGCTTGA

sequence of ZIP 2:

ATGAGACCCCTGGCCCTTCTCTTCCTCCTCTCCCTCCTCCTATTGCCTCTTTTCACCGTCGTCGCCGGAGACTGCGACTGCTCCGCCGACGAGGAGGACCGCAGCAAATCCAAAGCCCGGCCGCTCAAAATCGCCGCGTTCTTCTCCATCCTCGTCTGCGGCGCCATTGGCGTCTGCCTCCCACTCTTGAGCAAATACATCCCCGCTCTCAGTCCCGAGAAGGATATCTTCTTCGTGATCAAAGCCTTCGCCGCCGGCGTCATACTCGCCACGGGATTCATCCACATACTTCCGGACGCTTTCGACAACCTGACATCGCCGTGCCTCAAGGACAACCCGTGGGGGAAGTTTCCGTTCGCTGGATTCGGGGCCATGCTTGGTGCCCTCGGGACGCTGATGGTGGACGCTGTGGCGACGAGCTATTTCAGCCGGTCGGTGACGGCGGCGATCGATGGTGATGACAAAGGGGATGAGGGGGTGACTGCACCTGCGGGAGAGTATGTGGTCCACGTCCACGCCACGCACGGGCATGCTCATGGGCCCTCCACCGATGGCTCGGAGAAGCTCGTCCGCCATCGCGTCATCTCCCAGGTCTTGGAGTTGGGCATCGTGGTCCATTCGGTAATAATTGGGATATCTCTGGGTGCATCGGATAGTCCCTCTACCATAAGGCCCCTGGTAGCAGCTTTGAGCTTTCATCAATTCTTTGAGGGCATGGGGCTTGGGGGATGTATTGCTCAGGCAAATTTTAAAATCAAGTCAACGGCAACAATGATCCTCTTCTTCTCCCTCACCACTCCCGTTGGAATAGCAATCGGTTTTGGAATATCATCGGTTTACAATGAGAATAGCCCCACTGCTCTAATTGTCGAAGGTTGTCTCAATTCAGTAGCTGCTGGAATTTTAATCTACATGGCTCTTGTTGATCTTCTAGCTGAAGATTTTATGAACCCAAAGGTACAGAGCAGGGGAAAGCTACAATTGGGGATAAATGTCTCCCTCCTTATAGGAGCAGGCTTGATGTCACTTCTTGCTAAATGGGCATAG

common PCR reaction system (total reaction system 25. mu.L) comprises the following specific systems:

2*Vazyme LAMP Master Mix：12.5μL

ZIP-F：1μL

ZIP-R：1μL

cDNA：1μL

ddH₂O：9.5μL

general PCR reaction procedure: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 30s, annealing at 54 ℃ for 30s, and extension at 72 ℃ for 45s for 35 cycles; extension was supplemented at 72 ℃ for 10 min. PCR amplification products were detected by electrophoresis on 1.5% agarose gel.

6. Real-time fluorescent quantitative PCR

Using iTaq^TMThe Universal SYBR Green Supermix (Bio-RAD) kit, the ZIP gene detection primer and the internal reference primer adopt a fluorescent quantitative PCR instrument to carry out fluorescent quantitative PCR detection on a cDNA template. And (4) after the fluorescent quantitative PCR is finished, performing melting curve analysis on the result, and verifying the specificity of amplification again.

The fluorescence quantification system was as follows (20. mu.L total reaction):

LightCycler SYBR Green I Master(2*)：10μL

an upstream primer-F: 0.5. mu.L

Downstream primer-R: 0.5. mu.L

Template: 1 μ L

ddH₂O: adding water to a total volume of 20 μ L

In the real-time fluorescent quantitative PCR process, the amplification procedure is as follows: pre-denaturation at 95 ℃ for 15 min; denaturation at 95 ℃ for 10 s; annealing at 60 ℃ for 30 s; a total of 40And (6) circulating. After the PCR is finished, the temperature is controlled at 0.1 ℃ s^-1The rate of temperature increase from 72 ℃ to 95 ℃ was used for analytical verification of the dissolution curve. The method is carried out by adopting a real-time fluorescent quantitative PCR instrument. After the circulation is finished, the amplification result is analyzed by adopting the analysis software carried by the instrument.

Each qPCR reaction was repeated three times. Ct values were recorded for qPCR reaction systems. According to the relative expression amount of the gene under different treatments calculated by 2^ (-delta Ct), the expression amount of the ZIP1 in the leaves and the roots is not obviously different, while the expression amount of the ZIP2 in the new leaves is sharply reduced and is not obviously changed in the roots.

The RNA extraction method, the reverse transcription method and the reagents used in the present invention can be replaced under the condition of confirming the principle.

According to the invention, ZIP family genes are obtained through the difference of structural domains, and AcZIP genes capable of judging the betel nut in an iron deficiency state are obtained through real-time fluorescent quantitative PCR verification. Primer gel imaging and melting curves illustrate the specificity of the primers, and the real-time fluorescent quantitative PCR result provides a basis.

The kit extracts RNA of a sample by using a total RNA extraction kit of a Tiangen polysaccharide polyphenol plant, cDNA synthesis is carried out according to the operation of a reverse transcription kit of TaKaRa company, and iTaq is utilized^TMThe Universal SYBR Green Supermix (Bio-RAD) kit, the ZIP gene detection primer and the internal reference primer adopt a fluorescent quantitative PCR instrument to carry out fluorescent quantitative PCR detection on a cDNA template.

The invention also provides application of the real-time fluorescence quantitative PCR detection kit for the ZIP gene in detecting the iron deficiency or the zinc deficiency of the betel nut, the application method comprises the steps of extracting genome RNA of a sample to be detected, carrying out reverse transcription to obtain cDNA as a template, carrying out RT-qPCR reaction by using a ZIP gene detection primer in the kit and an internal reference primer, and calculating the relative abundance according to 2^ (-delta Ct) by using a normal sample as a control to obtain the relative expression quantity of the gene. According to the relative expression of AcZIP family, if the expression of ZIP1 in leaf and root is not significantly different, while the expression of ZIP2 in new leaf is sharply reduced and has no obvious change in root, the plant is stressed by iron deficiency.

In the present invention, the method for extracting RNA from a sample to be tested and the inversion is not limited, and any known extraction method or kit may be used.

The sample of the invention comprises betel nut leaves and betel nut taproots.

In the experiment, the detection primers for detecting the iron deficiency of the betel nuts are obtained by utilizing the difference of the gene expression amount caused by the iron deficiency treatment and according to the different trend changes of the expression amount of the difference gene in different treatments; the detection primers in the kit have high specificity, and only a normal sample and a sample with yellowing are needed to be provided, and then the condition that whether the betel nut seedlings are in iron deficiency or not is judged through a real-time fluorescence quantitative PCR technology, so that a basis is provided for subsequent treatment.

In the description of the present invention, "a plurality" means two or more unless otherwise specified; the terms "upper", "lower", "left", "right", "inner", "outer", "front", "rear", "head", "tail", and the like, indicate orientations or positional relationships based on the orientations or positional relationships shown in the drawings, are only for convenience in describing and simplifying the description, and do not indicate or imply that the device or element referred to must have a particular orientation, be constructed in a particular orientation, and be operated, and thus, should not be construed as limiting the invention. Furthermore, the terms "first," "second," "third," and the like are used for descriptive purposes only and are not to be construed as indicating or implying relative importance.

The above description is only for the purpose of illustrating the present invention and the appended claims are not to be construed as limiting the scope of the invention, which is intended to cover all modifications, equivalents and improvements that are within the spirit and scope of the invention as defined by the appended claims.

Sequence listing

<110> university of Hainan

<120> reagent kit for detecting areca nut iron deficiency and method for judging areca nut seedling iron deficiency state

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tgagccctgg ttctacctca ctcgcgccgc aaaggacttg gagaagacga 50

<210> 2

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

cgtgcctcaa ggacaacccg cgatgcccaa ctccaagacc 40

<210> 3

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gtatcgtgct tgattatggg ctactcttgg ctgtctcc 38

<210> 4

<211> 1230

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atgtctttct ttgaggatct tgagccctgg ttctacctca ctcgcttccg cgaccagctg 60

agcgttttct ctgaaaccat gtcagcatcg atggcgacgg cgagctgcac cgacgacgcg 120

gcggacgagt gccgcgatga cgcggcggcg ctgcggctga aaatggtagc gatagtgacg 180

atccttgtgg cgggggtgac cggggtgacg atccccctgg tggggcgcaa gcggcggtta 240

ctgcgcaccg acggcggcct cttcgtcttc tccaagtcct ttgcggccgg cgtcatcctt 300

gcaacggggt tcgtccacat gctccacgac gcccagtcgt cgctgacgga cccctgcctc 360

ccggagtcgc catggcggcg attcccgttc tccggcttcg tggcaatgat ggcggcgctg 420

gggaccctct tggtcgactt cgtcgggact cagttctacg agcggaagca ccgggaagag 480

gccagggggg tcaaggcggc caccgtggcg gcggttgagg cggcgacagc ggccgaggag 540

gatatcaccg tcatctcggt ctcgccggag ccggaagagg cggcggacgg cgtcaagagc 600

ccgatgcaca ttgtggggat gcacgcccac gcggcggcgc accggcatag ccacccctac 660

gagcacgggg cgtgcgacgg ccccgcgctg cgggaacgcg tccctggcca cgcccacgag 720

gacgagggcg tgggcgaggt cccttctcat gtgcgccacg tggtcgtatc ccagatactg 780

gaactaggaa tcgtgtccca ctcggtgatc atcgggttgt cactcggtgt ctcccggagt 840

ccgtgcacca taaggccact cattgcagcc ttatccttcc accagttctt cgaaggcttc 900

gcattgggtg gatgcatctc ccaggcacag ttcaggaact tgtcggccgc gctgatggcg 960

tgcttctttg cgatcacgac gccgaccggc atcggcgtcg gagcgggtgt tgcgtcgttc 1020

tacaacgcca acagcccgag ggcgctggtg gtggagggga tactggactc gatatccgcc 1080

ggcattctca tctacatggc attggttgat ctaatcgcgg cggattttct tagcaggagg 1140

atgagctgca atgttaggct tcaggtggcg tcttacatgg ccctttttct tggcgctggt 1200

tccatgtccg ccctcgcagt ctgggcttga 1230

<210> 5

<211> 1047

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atgagacccc tggcccttct cttcctcctc tccctcctcc tattgcctct tttcaccgtc 60

gtcgccggag actgcgactg ctccgccgac gaggaggacc gcagcaaatc caaagcccgg 120

ccgctcaaaa tcgccgcgtt cttctccatc ctcgtctgcg gcgccattgg cgtctgcctc 180

ccactcttga gcaaatacat ccccgctctc agtcccgaga aggatatctt cttcgtgatc 240

aaagccttcg ccgccggcgt catactcgcc acgggattca tccacatact tccggacgct 300

ttcgacaacc tgacatcgcc gtgcctcaag gacaacccgt gggggaagtt tccgttcgct 360

ggattcgggg ccatgcttgg tgccctcggg acgctgatgg tggacgctgt ggcgacgagc 420

tatttcagcc ggtcggtgac ggcggcgatc gatggtgatg acaaagggga tgagggggtg 480

actgcacctg cgggagagta tgtggtccac gtccacgcca cgcacgggca tgctcatggg 540

ccctccaccg atggctcgga gaagctcgtc cgccatcgcg tcatctccca ggtcttggag 600

ttgggcatcg tggtccattc ggtaataatt gggatatctc tgggtgcatc ggatagtccc 660

tctaccataa ggcccctggt agcagctttg agctttcatc aattctttga gggcatgggg 720

cttgggggat gtattgctca ggcaaatttt aaaatcaagt caacggcaac aatgatcctc 780

ttcttctccc tcaccactcc cgttggaata gcaatcggtt ttggaatatc atcggtttac 840

aatgagaata gccccactgc tctaattgtc gaaggttgtc tcaattcagt agctgctgga 900

attttaatct acatggctct tgttgatctt ctagctgaag attttatgaa cccaaaggta 960

cagagcaggg gaaagctaca attggggata aatgtctccc tccttatagg agcaggcttg 1020

atgtcacttc ttgctaaatg ggcatag 1047