1. Detection of SNP P in millet genome_psyl1697 polymorphism or genotype of siteThe application in distinguishing the content of millet yellow pigment is facilitated; the SNP P_psy11697A SNP site in the genome of millet has the nucleotide type G or T, and is 1697 th nucleotide of the promoter of psy1 gene.

2. Detection of SNP P in millet genome_psy11697 the application of polymorphic or genotypic substance at position point in preparing product for distinguishing or assisting in distinguishing the content of millet yellow pigment; the SNP P_psy11697A SNP site in the genome of millet has the nucleotide type G or T, and is 1697 th nucleotide of the promoter of psy1 gene.

3. Detection of SNP P in millet genome_psy11697 the application of the polymorphic or genotypic substance at position point in millet breeding or in the preparation of millet breeding products; the SNP P_psy11697A SNP site in the genome of millet has the nucleotide type G or T, and is 1697 th nucleotide of the promoter of psy1 gene.

4. The method for distinguishing or assisting in distinguishing the millet yellow pigment content is characterized by comprising the following steps of: detecting the genotype of the to-be-detected millet, and distinguishing or assisting to distinguish the yellow pigment content of the millet according to the genotype of the to-be-detected millet; the genotype is SNP P in the millet genome_psy11697 locus genotype, said SNP P_psy11697A SNP site in the genome of millet has the nucleotide type G or T, and is 1697 th nucleotide of the promoter of psy1 gene.

5. Use of the method of claim 4 in millet breeding.

6. A millet breeding method is characterized by comprising the following steps: comprising detecting the SNP P according to claim 1 in the genome of millet_psy11697 polymorphism of site, selecting said SNP P in the genome of millet_psy11697 homozygous millet with T nucleotide at position is used as parent to breed.

7. Containing SNPP in detection of millet genome_psy11697A substance having a polymorphism or genotype at position 1697, characterized in that: the product is any one of C1) -C3):

C1) detecting a product of single nucleotide polymorphism or genotype related to the content of the millet yellow pigment;

C2) distinguishing or assisting in distinguishing the products with the millet yellow pigment content;

C3) the product is used for millet breeding.

8. The use according to any one of claims 1-3 and 5, the method of claim 4 or 6, or the product of claim 7, wherein: the millet breeding is to cultivate millet with yellow rice color or breed millet with yellow rice color.

9. The use according to any one of claims 1-3, 5 and 8, the method of claim 4, 6 or 8 or the product of claim 7 or 8, wherein: the detection of SNP P in millet genome_psy11697 the polymorphism or genotype at site is D1), D2) or D3):

D1) the detection of SNP P in millet genome_psy11697 polymorphism or genotype of site containing amplification including said SNP P_psy11697 PCR primers of the millet genome DNA fragment including the locus;

D2) the detection of SNP P in millet genome_psyl1697 the polymorphism or genotype at site is PCR reagent containing the PCR primer;

D3) a kit containing the PCR primer described in D1) or the PCR reagent described in D2).

10. The use, method or product according to claim 9, wherein: the PCR primer is a primer group consisting of a single-stranded DNA shown in a sequence 1 in a sequence table, a single-stranded DNA shown in a sequence 2 in the sequence table and a single-stranded DNA shown in a sequence 3 in the sequence table.

Background

Millet (L.) Beauv) is an ancient food crop originated from China, has the characteristics of drought resistance, barren resistance, wide adaptability and the like, and is widely planted in northern areas of China. Millet is commonly called as millet after being peeled, has rich nutritive value, contains trace elements and a plurality of essential amino acids which are necessary for human bodies, and has high content of protein, fat and vitamin. The quality of millet mainly comprises appearance quality, nutrition quality, cooking quality and the like, wherein the appearance quality and the nutrition quality are indexes which are most directly and most preferably selected by consumers for evaluating the quality of millet. In appearance quality, the shade of millet yellow is the most important factor, and the shade is mainly determined by the content of yellow pigments such as carotenoid of millet.

The yellow pigment is a natural pigment in the grain of the millet, and the main component of the yellow pigment is carotenoid. The carotenoid is a precursor of the vitamin A, the vitamin A has a plurality of benefits to human health, not only has the function of protecting vision and epithelial cells, but also can improve the human immunity and prevent various cancers, and simultaneously has good prevention and treatment effects on oral ulcer, skin diseases and the like. The main components of carotenoid in millet are lutein and zeaxanthin. The content of the yellow pigment of the millet is obviously related to the apparent color, the yellow degree of the millet is high when the content of the yellow pigment is high, the yellow millet is more favored by consumers, and for example, the popular jin grain 21, the middle grain 2 and the like in the market are all varieties with high yellow pigment content and bright color.

Millet is a main crop in northern dry land originated in China, and various millet varieties with various yellow pigment contents are accumulated in the long-history cultivation process. In the breeding process, a variety with high yellow pigment content is selected, the concentration of vitamin A is increased, the appearance quality of millet is improved, and the method is always pursued by millet breeders. In the past, the quality breeding of millet is that single plant selection of yield characters is carried out in the early generation of hybrid offspring among varieties, and rice quality identification is carried out in the high generation after the strain is stable. The early generation of filial generation is single plant selection, and the single plant is difficult to perform rice quality identification. Even if high-generation materials form a series, a certain number of grains can be harvested for beige quality identification, and the operation workload is large. If a simple and rapid molecular marker selection method can be established, the quality breeding of the rice color of the millet is greatly promoted, the working efficiency and level of the rice quality breeding are rapidly improved, and the industrialized production of high-quality millet varieties is served.

Disclosure of Invention

The invention aims to solve the technical problem of how to distinguish or assist in distinguishing the content of the millet yellow pigment.

In order to solve the technical problems, the invention provides the following application and method.

The invention provides a method for detecting SNP P in millet genome_psy11697 the application of polymorphic or genotypic substance at position 1697 in distinguishing or assisting in distinguishing the content of millet yellow pigment; the SNP P_psy11697A SNP site in the genome of millet has the nucleotide type G or T, and is 1697 th nucleotide of the promoter of psy1 gene.

The invention also provides the detection of SNP P in the millet genome_psy11697 the application of polymorphic or genotypic substance at position point in preparing product for distinguishing or assisting in distinguishing the content of millet yellow pigment; the SNP P_psy11697A SNP site in the genome of millet has the nucleotide type G or T, and is 1697 th nucleotide of the promoter of psy1 gene.

The invention also provides the detection of SNP P in the millet genome_psy11697 the application of the polymorphic or genotypic substance at position point in millet breeding or in the preparation of millet breeding products; the SNP P_psy11697A SNP site in the genome of millet has the nucleotide type G or T, and is 1697 th nucleotide of the promoter of psy1 gene.

The invention also provides a method for distinguishing or assisting in distinguishing the yellow pigment content of the millet, which comprises the steps of detecting the genotype of the millet to be detected, and distinguishing or assisting in distinguishing the yellow pigment content of the millet according to the genotype of the millet to be detected; the genotype is SNP P in the millet genome_psy11697 locus genotype, said SNP P_psy11697A SNP site in the genome of millet has the nucleotide type G or T, and is 1697 th nucleotide of the promoter of psy1 gene.

Another technical problem to be solved by the present invention is how to perform millet breeding.

In order to solve the technical problems, the invention provides the following application and method.

The invention provides application of the method for distinguishing or assisting in distinguishing the yellow pigment content of the millet in millet breeding.

The invention also provides a method for breeding millet, which comprises the step of detecting the SNP P in the genome of the millet_psy11697 polymorphism of site, selecting said SNP P in the genome of millet_psy11697 homozygous millet with T nucleotide at position is used as parent to breed.

Containing the detection of SNP P in the genome of millet_psy11697 polymorphism or genotype of the substance, which is any one of C1-C3):

C1) detecting a product of single nucleotide polymorphism or genotype related to the content of the millet yellow pigment;

C2) distinguishing or assisting in distinguishing the products with the millet yellow pigment content;

C3) the product is used for millet breeding.

In the above application, the above method or the above product, the breeding of the foxtail millet is breeding of foxtail millet with yellow rice color or breeding of foxtail millet with yellow rice color.

In the above application, the above method or the above product, the detection of SNP P in millet genome_psy11697 the polymorphism or genotype at site is D1), D2) or D3):

D1) the detection of SNP P in millet genome_psy11697 polymorphism or genotype of site containing amplification including said SNP P_psy11697 PCR primers for the genomic DNA fragment of millet including, for example, the positions 22 to 47 of SEQ ID NO. 1 and the positions 22 to 46 of SEQ ID NO. 2;

D2) the detection of SNP P in millet genome_psy11697 the substance containing the polymorphism or genotype of the 1697 site is the one containing the PCR primerPCR reagents;

D3) a kit containing the PCR primer described in D1) or the PCR reagent described in D2).

Optionally, the PCR primer is a primer group consisting of a single-stranded DNA shown in a sequence 1 in the sequence table, a single-stranded DNA shown in a sequence 2 in the sequence table and a single-stranded DNA shown in a sequence 3 in the sequence table.

In the above applications, methods and products, the PCR primers may or may not be labeled with a label. The label refers to any atom or molecule that can be used to provide a detectable effect and that can be attached to a nucleic acid. Labels include, but are not limited to, dyes; radiolabels, e.g.³²p; binding moieties such as biotin (biotin); haptens such as Digoxin (DIG); a luminescent, phosphorescent, or fluorescent moiety; and a fluorescent dye alone or in combination with a portion of the emission spectrum that can be suppressed or shifted by Fluorescence Resonance Energy Transfer (FRET). Labels can provide signals detectable by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzymatic activity, and the like. Labels can be charged moieties (positive or negative) or alternatively, can be charge neutral. The label may comprise or be combined with a nucleic acid or protein sequence, provided that the sequence comprising the label is detectable. In some embodiments, the nucleic acid is detected directly (e.g., direct sequence read) without a label.

The invention designs a marker (SNPP) capable of effectively distinguishing high yellow pigment content from low yellow pigment content by analyzing the mutant haplotype and the yellow pigment content of the promoter region of a millet yellow pigment synthesis key gene psy1_psy11697 locus), the marker can be used for selecting millet yellow pigment content in early breeding generation, so as to achieve the purpose of selecting individual plants, strains and varieties with high yellow pigment content through marker selection, avoid blindness of early breeding generation selection, and remarkably improve the quality breeding efficiency of millet with yellow pigment content. In practical applications, to increase the accuracy, the detection of SNP P can be carried out_psy11697 combining polymorphic and genotypic substances with other substances to prepare the mixture for distinguishing the contents of millet yellow pigmentAmount of product.

Drawings

FIG. 1 is a plot of haplotype variation sites of the promoter of the psy1 gene, IN which 1769-1818bp site, 1 represents TGGTGCAAGGCTTAGGCCTCCTGCGCCAATGCAAGTTAAGTGGTTTGAT, 2 represents GTGCAGCTAGGCTCCTGCGCCAATGCAAGTAAGTGTTTGA, and 2106-2134bp site IN1 represents ACGTGCCAAAAGGAAATTCAGCGTATATC, representing sequence deletion.

FIG. 2 is a plot of the mutation sites of the three major haplotypes of the promoter of the psy1 gene, wherein the sequence of IN1 at 2106-2134bp is ACGTGCCAAAAGGAAATTCAGCGTATATC, which represents sequence deletion.

FIG. 3 is a box plot of the yellow pigment content of the major haplotype in the promoter region of the psy1 gene.

FIG. 4 shows the KASP marker assay of 295 samples of the material of example, wherein each dot corresponds to one sample, G: G indicates that the sample is homozygous genotype G: G, T: T indicates homozygous genotype T: T, G: T indicates heterozygous genotype G: T, and? Indicating no or weak signal, NTC indicates blank control.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The data were processed using EXCEL statistical software, and the experimental results were expressed as mean ± standard deviation, and examined using a two-tailed t-test.

The promoter sequence of the psy1 gene is shown in SEQ ID No. 4.

Example 1 determination of yellow pigment content and discovery of SNP marker associated therewith

Representative 100 parts of millet materials from various regions were selected, the yellow pigment content of these materials was measured (100 parts of millet materials are described in Jia G, Huang X, Zhi H, et al. A. halopeptide map of genetic variations and genome-side association students of virological trails [ J ]. Nature Genetics, 2013, 45 (8): 957.) (Table 4), and the promoter sequences of the varieties of psyl genes having different yellow pigment contents were amplified to perform sequencing analysis.

The determination method of the content of the yellow pigment refers to AACC method. Comprises preparing standard beta-carotene curve with beta-carotene standard, hulling semen Setariae with a rice huller, ultra-centrifugal grinding, weighing 2.000g of powder, placing into 30mL of centrifugal tube with plug, adding 10.0mL of water saturated n-butanol, covering plug tightly, and mixing in a mixer to thoroughly moisten sample. Placing the centrifuge tube on a reciprocating shaking machine, shaking for 1h, and standing for 10 min. Centrifuging at 4000r/min for about 10min until the liquid is clear. And (4) taking water saturated n-butanol as a reference, measuring the absorbance of the supernatant after centrifugation at 440nm, and calculating the content of the yellow pigment.

2800bp upstream of the initiation codon of the psy1 gene was amplified and sequenced altogether to obtain promoter sequences of 74 varieties. A promoter sequence No. 1 (sequence 4) of a reference genome is taken as a reference, DNAman software is used for sequence comparison, the sequence variation type of the promoter is shown in figure 1, and the promoter coexists at 78 variation sites, wherein the variation sites comprise an SNP site 76 and an indel site 2 and have abundant variation.

78 mutation sites exist in the promoter region, and 13 haplotypes are combined together (as shown in FIG. 1), wherein three haplotypes have more material ratios, are the main haplotypes, and are Hap2(25 parts of material), Hap4(26 parts of material) and Hap5(9 parts of material), respectively. The remaining haplotypes contain a smaller amount of material and are rare haplotypes. Except rare variation sites, the sequences of three main haplotypes in a promoter region have 42 variation sites which comprise 41 sites of SNP and 1 site of indel. The variation sites are shown in FIG. 2.

Analysis of the 42 variable sites found that 1697bp isThere is one SNP site, and two base types of G/T exist in different materials. This SNP site was designated as P_psy11697 (position 40048578 bp on chromosome 4), which is a polymorphic SNP site on the psy1 gene promoter, the psy1 gene promoter has a physical position 40046882 bp-40049681bp on chromosome 4 of millet variety Yu Gu No. 1 (reference genome https:// phytozome_psy11697 the nucleotide type is T or G, and its flanking sequence is shown in sequence table 4, P_psy11697 site is at position 1697 of SEQ ID No. 4. In the sequence 4, k is t or g.

All sequencing materials were divided into two classes based on this site, designated hap-G haplotypes (i.e., P)_psy11697 the nucleotide at position G) and hap-T haplotype (i.e., P)_psy11697 the nucleotide at position T). And performing correlation analysis on the variation of the locus and the yellow pigment content data of the corresponding variety, wherein the correlation analysis specifically comprises the following steps: and summarizing and grouping the materials in each haplotype according to haplotype typing results of all sequenced materials, performing double-tail t test on phenotype data of the materials classified by each haplotype by using an EXCEL table, and detecting whether the correlation between the haplotype and the target character reaches an obvious level or not.

The results show that there is a very significant difference in the yellow pigment content between the two haplotypes, and the results are shown in Table 1. The mean content of yellow pigment in the material with base T at this site was 22.74mg/kg, which is a high yellow pigment content type, and the mean content of yellow pigment in the material with base G at this site was 14.85mg/kg, which is lower.

TABLE 1 significance analysis of SNP associated yellow pigment difference at 1697bp of promoter region

Note: represents P < 0.01

The three major haplotype bases at this site are: hap2 and hap5 are bases G, hap4 is base T, and the yellow pigment content of the material contained in the three haplotypes is boxed as shown in FIG. 3. As seen from FIG. 3, hap4 has the highest content of yellow pigment, hap2 has the medium content of yellow pigment, and hap5 has the lowest content of yellow pigment, and particularly, all the materials contained in hap5 are materials with very low content of yellow pigment, and the hap4 type haplotype is an excellent haplotype with high content of yellow pigment. Therefore, the G/T variation at 1697bp distinguishes hap4 with the highest yellow pigment content from the other two types, and the site may play an important role. The contents of the three main haplotype yellow pigments are shown in Table 2, and the data of the related yellow pigments are analyzed for the significance of the difference as described in the above related analysis method, and the results are shown in Table 3.

TABLE 2 yellow pigment content of the three main haplotypes

TABLE 3 differential significance analysis of the major haplotype-associated flavochrome in the promoter region

Note: represents P < 0.01

TABLE 4 different haplotype material numbers and yellow pigment contents in promoter regions

Example 2 development of the marker KASP for millet yellow pigment content

1. Primer design

According to the result of analyzing the sequencing haplotype of the millet psy1 gene, P_psy11697 the locus has obvious distinguishing significance for distinguishing the content of yellow pigment in millet. At the position, the material with the base T has higher content of yellow pigment, the material with the base G has lower content of yellow pigment, and KASP mark is designed according to the difference of the position to aim atThe SNP sequence information is designed into primers with fluorescent labels. The primer sequences are shown in Table 5.

TABLE 5 KASP primer sequence information

Note: FAM and VIC represent primers with FAM fluorescent tag sequences (underlined is a straight base) at the 5 'end and VIC fluorescent tag sequences (underlined is a wavy base) at the 5' end, respectively, and COM represents a universal primer.

Amplifying the fragment with the SNP site as T by using a primer FAM and a primer COM, and reading a fluorescent signal of a FAM group by using an enzyme-labeling instrument or a fluorescent quantitative PCR instrument;

amplifying the fragment with the SNP site being G by the primer VIC and the primer COM, and reading the fluorescent signal of the VIC group by using an enzyme-labeling instrument or a fluorescent quantitative PCR instrument.

2. Determination of the yellow pigment content

The test material was 95 parts of millet material (shown in Table 6, millet material is described in Jia G, Huang X, Zhi H, et al. A. halophilic map of genetic variations and genome-wide association students of antigenic trails in foreign mileets (Setaria italica) [ J ]. Nature Genetics, 2013, 45 (8): 957.). The yellow pigment content was determined in the same manner as in example 1. The measurement results are shown in Table 6.

3. Detection of SNP sites

The test material was 95 parts of millet material (as shown in table 6). Extracting genomic DNA of the test material, adding ddH₂O lysis was used as DNA template.

Blank control is ddH₂O replaces the DNA template, and the rest conditions are consistent.

The primer mix included 46. mu.l ddH₂O, 30. mu.l of primer COM (100. mu.M), 12. mu.l of primer FAM (100. mu.M) and 12. mu.l of primer VIC (100. mu.M).

The PCR system included 10-20 ng/. mu.l of DNA template, 3. mu.l of 1 XKASP master mix (manufacturer LGC (laboratory of the Government Chemist) cat # KBS-1016 012) and 0.056. mu.l of primer mix.

PCR procedure: 15min at 94 ℃; 20s at 94 ℃, 25s at 67-61 ℃ (touchdown-0.6 ℃ per cycle), and 10 cycles; 94 ℃ for 10s, 55 ℃ for 60s, and 26 cycles.

Reading fluorescence data of a PCR reaction product by using a microplate reader or a fluorescence quantitative PCR (polymerase chain reaction) instrument, carrying out fluorescence signal processing by using an online software SNP decoder (http:// www.snpway.com/snpdecoder01/), and if only a fluorescence signal of a VIC group is displayed, detecting the SNP site P of the detection material_psy11697 the genotype is G: G (i.e. SNP site P in the genome of millet_psy11697A pure type of G, hereinafter referred to as P_psy11697 genotype G: G); if the fluorescence signal only with FAM group is displayed, the SNP site P of the millet to be detected_psy11697 the genotype is T: T (i.e. SNP site P in the genome of millet_psy11697A pure type of T, hereinafter referred to as P_psy11697 genotype T: T); if the fluorescence signal of both FAM group and VIC group is displayed, the SNP site P of the millet to be detected_psy11697 the genotype is G: t (i.e. SNP site P in the millet genome)_psy11697 is a G and T mixed type, hereinafter referred to as P_psy11697 genotype G: T).

The 95 material typing results are shown in FIG. 4 and Table 6, with P at the upper left of FIG. 4_psy11697 genotype G: G, P at bottom right_psy11697 genotype T: T, 56 parts of which base is G, 28 parts of which material is T, 5 parts of which is hybrid material, 6 parts of which signal is weak.

TABLE 6 genotype and yellow pigment content of the materials

Note: is there a Indicating no signal or a weak signal.

The two types of yellow pigment data are correlated for difference significance analysis, and the specific analysis method is the same as that of the correlation analysis in the example 1. The results are shown in Table 7.

TABLE 7 genotype-associated flavochrome differential significance analysis

The results show that the content of the yellow pigment is very obviously different between the two genotypes, the material yellow pigment of the genotype T to T belongs to the type with high content of the yellow pigment, the material yellow pigment of the genotype G to G is lower, and the two genotypes have obvious difference. The genotype G: T has no obvious difference from the two genotypes. The mark has high practicability and application efficiency.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Sequence listing

<110> institute of crop science of Chinese academy of agricultural sciences

<120> molecular marker related to millet yellow pigment content and application thereof

<130> 210486

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gaaggtgacc aagttcatgc tacaactttc agtccatgac agagaat 47

<210> 2

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gaaggtcgga gtcaacggat tcaactttca gtccatgaca gagaag 46

<210> 3

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gaggggttcg tagtggtatc agtta 25

<210> 4

<211> 2821

<212> DNA

<213> millet (Setaria italica)

<400> 4

agttaaccag gcagtatccg ccactcactt ttttttggtt cttcaccctt cttatacggt 60

ctatctgttt gatcaaccac ttttgaaccg ggaagacagt gaggtgatag attggttgtg 120

aagttaatac gcttttgact agtgtctctc ttcctgcaag ggatagcatt ttccccttcc 180

atcccgatag gcgtcctcca attttgtata agagtggttg aaagtctact cttctaaggg 240

tacatgtatg taaagggagg tccaagtact ttcctgggaa cgaggatacc tttccgggga 300

aatctgctag tgcttcggct acaatttctg gtgtgcatcg aattggaaag atttccatct 360

tgatcatgtt aaccctcagt cccgagcagt ccccaaatag ttgcaacagc tgtttaattc 420

tttgaagttc cgttctgttg ggatttgtaa aaattgttgc atcatcggca tacaaggagc 480

agcgcatttt tctgcccttg tcaagatcgg ctggataatg ttctgtgccg ccgctagttc 540

catgattcgg tgcagcgggt caattgtgat gataaaaagc attagggaca gggggtcgcc 600

ttgtctcatc cctcaggcgt gcttgaattt tttttcctgg acttccattg agtaggactc 660

gtgaggatgc agtggctaaa agcattaata tccaatctct ccatttctga ccaaagccta 720

atgcttgcaa agtctctaat aggaacgcca agctcaatga gtcaaaggct tttgagatgt 780

ccagtttaat gaaaaatgcg ctcttgttag ctttgtgcag tgtcttgatt acactatgga 840

catacgcaaa gtttgtcgtg gatacatctt tttttgatga aggcgctctg gcagctggag 900

atgaggtcat ttaattttgg cgccaaccgg tcggctagga tttttgtgat tattttgcaa 960

ggctgtttat gagactgatg ggcctaaagt cagcaatcct caccgtgtcg tctgttttgg 1020

ggattaggat gatgttggcc tcgtttatta gttctaggcg gcgcattcat aaggagtgga 1080

atgcctgtag tgcgtcagtg agatctgctc ctattatgtg ccagcatttc ttgtagaata 1140

atcctatgaa tccatcggtc ccagtgcttt ctcggtcagc atgttcatga ctactcgttt 1200

gacctcatcc tgctcgaatg gactttctag gtccgataga tcttgagcct ggtatcccag 1260

gtggctccaa tttagaccct gtactcggtt ttgtggcgtg cccagtagct ccacaaagtg 1320

cttgtatatt atttcctcct cctgctagtg gtcgctagtt tgtccttgcg ctgcagtcag 1380

tgtagggatg tggagctttc gttttctact gtttgcatgt agcatgaaaa gctttgtgca 1440

agatgttaca gcttttttat gacatttgga atggaaatgc aacttgacat ttttggaaac 1500

tcatgctgca cggagcgtac aaaagcacta gaaagtttgg cggggtgggc cggccattta 1560

caaaatctgc ccttggtagt tgggcttgaa cttgcggccc atccaaatac tgttgctact 1620

gccctgtgta cccgcgttgt gctgttgggc cacgcccatc tgaatactcg ggtccagctt 1680

gctgggccag tacaackttc agtccatgac agagaatgta aaaacactcc taacatttgc 1740

taactgatac cactacgaac ccctcaaaga cacactcctg cagcggcttg gtgcaaggct 1800

taggcctcct gcgccaatgc aagttaagtg gtttgattca tcagatgtaa aactgggatt 1860

atttttaccc tacacgtgta ggtcagatta tacaaatagt tagaaaccag gcagtatgta 1920

agatagctag atgtatagtg atatatgatc agtaagagca aactgcacat taaactatcc 1980

tcttaggtaa caccatcaat ataatccgac gtctacccaa gagaagagtg gagacaaatt 2040

attcttagaa catataatat agtgtaacaa tgcatgcatg tggacgcgac gatgatatta 2100

agccatcagg taagaaccag agtacctgaa ttgcatgcca tgtcagcgtc cacgtcggac 2160

aggagcagcc agggtgaatc cggagctttc caggtgtcac cactcagcgg cctcccaagt 2220

aggtgataag cttatctatc cgttgccggc tggctggccc tcgtccactc cacgtctgtt 2280

tctttcttct ctgtcgtccc tgagacttga gagtccagag catcaggtac tagcagcatg 2340

tccaatgcaa ggctatgatc cagccacaca ttgcttgatg gctatttgat tgatgattac 2400

ctgcacatgt agcatatgcc aacaatgcaa gcaggatacc gtaccgtgaa atgcatgaaa 2460

tccctcctgt tccatgaaaa aaaaagtgca tgaaatcccg gtaggagagg agagcagtag 2520

gagaggagac caacgataag aggtgagtgg cctgagctgt ttgcgtctgg atgtcctcca 2580

gcgcactccc ttccctcctt cccatggagc cttttgctcg tgtgtctgct aactgaaagt 2640

gtgtgactgt atgcaggtgc ccgtggcaga tagtgcggcg gccaccaccc agcgtgcgtc 2700

ttttttttct tcttccttgc agtcatccac ccatcccaga ctctctgatg agcatacctt 2760

gcagtaggag ctctgctgat tggccccgtc cgtcttgcag ataacaacag gcgacagaca 2820

c 2821