1. A mutant TIMM13 gene or a mutant TIMM13 protein, wherein: the mutant TIMM13 gene has at least one of the following mutations compared to the human genome reference sequence GRCh 37:

the base with the physical position of No. 19 chromosome 2427459 is mutated from G to A, and the base with the physical position of No. 19 chromosome 2427310 is mutated from T to A;

the cDNA sequence of the mutant TIMM13 gene has at least one of the following mutations compared with the sequence of SEQ ID NO. 1:

c.73C>T、c.133A>T；

the sequence of the mutant TIMM13 protein has at least one of the following mutations compared to the sequence of SEQ ID No. 2:

p.Gln25Ter、p.Lys45Ter。

2. a method of detecting the mutant TIMM13 gene or mutant TIMM13 protein of claim 1 for a non-diagnostic purpose, wherein the method comprises: the method comprises detecting the presence or absence of a mutation site in the TIMM13 gene or the TIMM13 protein, wherein the mutation site is at least one of:

chr19(GRCh37) g.2427459G > A, cDNA sequence occurrence c.73C > T, p.Gln25Ter;

chr19(GRCh37): g.2427310T > A, cDNA sequence occurrence c.133A > T, p.Lys45Ter.

3. The method of claim 2, wherein: the method comprises the step of performing PCR amplification by using at least one set of primers as follows:

3 and 4;

SEQ ID NO 5 and SEQ ID NO 6.

4. The method of claim 3, wherein: the PCR amplification reaction program comprises: 94-100 deg.C, 1-10 min; 94-95 deg.C, 3-5min, 95-96 deg.C, 25-30s, 58-60 deg.C, 25-30s, 30-40 times of circulation, 70-72 deg.C, 1-10 min.

5. A reagent for detecting a mutant TIMM13 gene, comprising: the reagent is a nucleic acid detection probe or primer;

the nucleic acid detection probe is complementary to a mutant TIMM13 gene; the mutant TIMM13 gene has at least one of the following mutations compared to the human genome reference sequence GRCh 37:

the base with the physical position of No. 19 chromosome 2427459 is mutated from G to A, and the base with the physical position of No. 19 chromosome 2427310 is mutated from T to A;

the cDNA sequence of the mutant TIMM13 gene has at least one of the following mutations compared with the sequence of SEQ ID NO. 1:

c.73C>T、c.133A>T；

the region of the nucleic acid detection probe complementary to the mutant TIMM13 gene comprises a physical position or a cDNA sequence position selected from at least one of:

physical positions 2427459 th, 2427310 th; 73 rd and 133 th cDNA sequences;

the primer is at least one group of primers with the following sequences:

3 and 4;

SEQ ID NO 5 and SEQ ID NO 6.

6. A kit for detecting a mutant TIMM13 gene, comprising: comprising the reagent according to claim 5.

7. The application of a reagent for detecting mutant TIMM13 gene or mutant TIMM13 protein in preparing a reagent for detecting lethal mitochondrial diseases of infants;

the mutant TIMM13 gene has at least one of the following mutations compared to the human genome reference sequence GRCh 37:

the base with the physical position of No. 19 chromosome 2427459 is mutated from G to A, and the base with the physical position of No. 19 chromosome 2427310 is mutated from T to A;

the cDNA sequence of the mutant TIMM13 gene has at least one of the following mutations compared with the sequence of SEQ ID NO. 1:

c.73C>T、c.133A>T；

the sequence of the mutant TIMM13 protein has at least one of the following mutations compared to the sequence of SEQ ID No. 2:

p.Gln25Ter、p.Lys45Ter。

8. the use of claim 7, wherein the reagent for detecting lethal mitochondrial disease in infants is a reagent for gene chip, a reagent for DNA amplification, a reagent for reverse transcription amplification, a reagent for restriction enzyme digestion or a reagent for sequencing.

Background

The incidence of mitochondrial disease is highest among all inherited metabolic diseases. Mitochondria are primarily responsible for oxidative phosphorylation to produce adenosine triphosphate. The pathogenesis of mitochondrial diseases involves two distinct genomes: nuclear genome and maternal inherited 16.6kb mitochondrial genome. Mitochondrial diseases can be caused by mutations in any of these genomes. Defects in nuclear dna (ndna) can lead to problems such as respiratory chain complex structure, translation, and mitochondrial dna (mtdna) repair defects. Of the mitochondrial diseases diagnosed in childhood, about 25% are due to mitochondrial DNA abnormalities, while the remaining 75% are due to nDNA defects. Severe neonatal or infant onset mitochondrial disease usually leads to death within one year of birth, and infant lethal mitochondrial disease (LIMD) accounts for about 8.5% of cases with childhood onset mitochondrial disease, but LIMD has a low molecular genetic diagnosis rate, and most LIMD cases are diagnosed by biochemical and genetic methods after death of the subject. Thus, when parents become pregnant again, such neonatal onset of severe mitochondrial disease may reoccur due to a diagnosis that is not timely. Although nearly thousands of nuclear genomic genes have been found to be involved in mitochondrial function, only a small proportion have been implicated in the development of LIMD, suggesting that there are new LIMD virulence genes to be exploited.

Disclosure of Invention

The invention aims to provide a TIMM13 mutant gene related to infantile lethal mitochondrial diseases, a primer, a kit and a method for detecting the same and application thereof.

The purpose of the invention is realized by the following technical scheme:

a mutant TIMM13 gene or a mutant TIMM13 protein, the mutant TIMM13 gene having at least one of the following mutations compared to a human genomic reference sequence GRCh 37:

the base with the physical position of No. 19 chromosome 2427459 is mutated from G to A, and the base with the physical position of No. 19 chromosome 2427310 is mutated from T to A;

the cDNA sequence of the mutant TIMM13 gene has at least one of the following mutations compared with the sequence of SEQ ID NO. 1:

c.73C>T、c.133A>T；

the sequence of the mutant TIMM13 protein has at least one of the following mutations compared to the sequence of SEQ ID No. 2:

Gln25Ter (glutamine 25 mutated to stop codon), p.Lys45Ter (lysine 45 mutated to stop codon).

The TRANSLOCASE OF INNER MITOCHONDRAL MEMBRANE 13 (MITOCHONDRIAL INNER MEMBRANE TRANSLOCASE 13, TIMM13) gene is located on chromosome 19p13.3, and contains 3 exons, and encodes TIMM13 protein with 80 amino acids and a molecular weight OF about 9 kDa. TIMM13 is an inter-mitochondrial membrane chaperone that mediates the introduction and insertion of various multi-channel transmembrane proteins into the inner mitochondrial membrane; also mediates the transfer of the β -barrel precursor from the TOM complex to the outer membrane to form the SAM complex. TIMM13 acts as a chaperone-like protein, protecting hydrophobic precursors from aggregation, and directing them through the mitochondrial membrane space. The TIMM8-TIMM13 complex mediates the introduction of proteins such as TIMM23, SLC25A12/ARALAR1 and SLC25A13/ARALAR 2. At present, no report is found about the association of TIMM13 with diseases.

The gene of the wild-type TIMM13 gene in Ensemble database (www.ensembl.org) is encoded as ENSG00000099800, and the gene is located on chromosome 19. The inventor utilizes genetic research screening in a large number of normal people and LIMD patient families to find that the gene mutation of TIMM13 gene can cause lethal mitochondrial diseases of infants. The invention provides a new pathogenic mutation site of a pathogenic gene and provides a new molecular biology basis for early molecular screening of the disease.

The first mutation and the second mutation are both positioned in a translation region, wherein the physical position of the first mutation is 2427459, and the base G is mutated into A; RNA level: the 73 rd base of the cDNA sequence of the TIMM13 gene is mutated from C to T; protein level: the 25 th amino acid of protein coded by the TIMM13 gene is mutated into a stop codon from glutamine.

The second mutation was at the physical position of 2427310, base was mutated from T to a, RNA level: the 133 th base of the cDNA sequence of the TIMM13 gene is mutated from A to T; protein level: the 45 th amino acid of protein coded by the TIMM13 gene is mutated into a stop codon from lysine.

A method of detecting a mutant TIMM13 gene or a mutant TIMM13 protein for non-diagnostic purposes, the method comprising detecting the presence or absence of a mutation site in the TIMM13 gene or the TIMM13 protein; the mutation site is at least one of the following:

chr19(GRCh37) g.2427459G > A, C.73C > T generation of cDNA sequence, p.Gln25Ter (glutamine 25 is mutated into stop codon);

chr19(GRCh37): g.2427310T > A, cDNA sequence occurrence c.133A > T, p.Lys45Ter (lysine at position 45 is mutated to a stop codon).

In some embodiments, the purpose of the non-diagnostic diseases described in the present invention includes, but is not limited to, studying SNP distribution and polypeptidases for family evolution studies. Such applications will be understood by those skilled in the art.

Some individuals carry the mutant TIMM13 gene of the invention but do not suffer from LIMD, e.g., a heterozygous genotype with only one chromosome carrying the mutation. The detection of this portion of the population may not be relevant for any purpose of diagnosing the disease, since these individuals are not themselves diseased. But the results of their detection can be used as useful information, for example as important indicators for pre-natal examinations, to guide fertility, or for mutation carrier screening, or as a tool for SNP distribution and polymorphism studies or to follow gene mutations or family evolution. Such applications are also understood by those skilled in the art. Thus, the methods of detecting a mutant TIMM13 gene or a mutant TIMM13 protein provided by the present invention involve detecting heterozygous mutations.

However, the methods of the present invention for detecting a mutant TIMM13 gene or a mutant TIMM13 protein also include detecting a homozygous mutation.

In a preferred embodiment of the present invention, the method for detecting mutant TIMM13 gene or mutant TIMM13 protein comprises the following steps of PCR amplification using at least one set of primers:

TIMM13_ E1F: GACCTCGGTCCGGTTGACTT (SEQ ID NO:3) and

TIMM13_E1R:CCTGCTCGGAGTTGTCCAG(SEQ ID NO:4)；

TIMM13_ E2F: CGAAAGTGCAGATCGCCGTG (SEQ ID NO:5) and

TIMM13_E2R:CGTGTTCCAGGCGTCCATGT(SEQ ID NO:6)。

in a preferred embodiment of the present invention, the PCR reaction procedure using the primers for amplification comprises: 94-100 deg.C, 1-10 min; 94-95 deg.C, 3-5min, 95-96 deg.C, 25-30s, 58-60 deg.C, 25-30s, 30-40 times of circulation, 70-72 deg.C, 1-10 min.

The method for detecting the mutant TIMM13 gene comprises the following steps:

(1) establishing a family clinical and genetic resource library of LIMD patients, collecting clinical information and blood samples of LIMD families, and extracting genome DNA;

(2) designing amplification and sequencing primers covering the whole exon sequence of the TIMM13 gene for sequencing;

(3) and comparing the sequencing results of the family samples of the normal person and the LIMD patient.

In one embodiment, the sequencing is a Sanger sequencing.

In other embodiments, the method for detecting a mutant TIMM13 gene described above may be performed by a technique selected from the group consisting of:

electrophoresis, nucleic acid hybridization, in situ hybridization, PCR, reverse transcriptase chain reaction, and denaturing high performance liquid chromatography.

In other embodiments, methods of detecting mutations at exon and exon/intron boundaries of the TIMM13 gene are also contemplated, comprising the steps of:

(1) extracting a DNA sample from a subject;

(2) sequencing the exome and all exon/intron boundary sequences of the DNA sample to obtain sequencing fragments;

(3) and comparing the sequencing fragment with a reference sequence to obtain the exon and exon/intron boundary mutation of the gene.

A reagent for detecting a mutant TIMM13 gene, wherein the reagent is a nucleic acid detection probe or primer;

the nucleic acid detection probe is complementary to a mutant TIMM13 gene; the mutant TIMM13 gene has at least one of the following mutations compared to the human genome reference sequence GRCh 37:

the base with the physical position of No. 19 chromosome 2427459 is mutated from G to A, and the base with the physical position of No. 19 chromosome 2427310 is mutated from T to A;

the cDNA sequence of the mutant TIMM13 gene has at least one of the following mutations compared with the sequence of SEQ ID NO. 1:

c.73C>T、c.133A>T；

the region of the nucleic acid detection probe complementary to the mutant TIMM13 gene comprises a physical position or a cDNA sequence position selected from at least one of:

physical positions 2427459 th, 2427310 th; 73 rd and 133 th cDNA sequences;

the primer is at least one group of primers with the following sequences:

TIMM13_ E1F: GACCTCGGTCCGGTTGACTT (SEQ ID NO:3) and

TIMM13_E1R:CCTGCTCGGAGTTGTCCAG(SEQ ID NO:4)；

TIMM13_ E2F: CGAAAGTGCAGATCGCCGTG (SEQ ID NO:5) and

TIMM13_E2R:CGTGTTCCAGGCGTCCATGT(SEQ ID NO:6)。

the nucleic acid detection probes enabled detection of the mutant TIMM13 gene by nucleic acid pairing with the complementary region of the mutant TIMM13 gene.

In other embodiments, the reagents for detecting the mutant TIMM13 gene further comprise buffers, enzymes, and inorganic salts.

And (3) amplifying the template DNA by using a primer for detecting the mutant TIMM13 gene, and carrying out mutation identification on an amplification product by sequencing or gel electrophoresis.

A kit for detecting a mutant TIMM13 gene, comprising the reagents.

In other embodiments, the kit for detecting a mutant TIMM13 gene further comprises a buffer and instructions for use.

The application of a reagent for detecting mutant TIMM13 gene or mutant TIMM13 protein in preparing a reagent for detecting lethal mitochondrial diseases of infants;

the detection reagent for the fatal mitochondrial diseases of the infants is a reagent for a gene chip, a reagent for DNA amplification, a reagent for reverse transcription amplification, a reagent for a restriction enzyme digestion method or a reagent for sequencing.

The reagent for gene chip may be a probe for cDNA chip.

The DNA amplification reagent may be a primer or a probe.

The reagent for reverse transcription amplification can be a reverse transcription amplification primer and a reverse transcription amplification buffer solution.

The reagent for the restriction enzyme cutting method can be a primer containing a restriction enzyme site and a seamless cloning buffer solution.

The sequencing reagent may be a primer or a detection buffer.

The application of a reagent for detecting mutant TIMM13 gene in early molecular screening of lethal mitochondrial diseases of infants, which is used for the purpose of non-disease diagnosis.

The application of a kit for detecting a mutant TIMM13 gene in early molecular screening of lethal mitochondrial diseases of infants is a non-disease diagnosis purpose.

Compared with the prior art, the invention has the advantages that:

the invention provides a TIMM13 mutant gene, a reagent, a primer, a kit and a method for detecting the TIMM13 mutant gene and application thereof, creatively digs a LIMD pathogenic gene TIMM13, and provides a TIMM13 mutant gene locus, which provides important basis for early molecular screening, family genetic research and genetic consultation of lethal mitochondrial diseases of infants.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 is a family diagram;

FIG. 2 is a high throughput sequencing of the TIMM13 mutant sequence.

FIG. 3 is a Sanger sequencing of the mutant sequence of TIMM 13.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

The features and properties of the present invention are described in further detail below with reference to examples.

Example 1

This example performed whole exome high throughput sequencing assays for multiple families of patients with infantile fatal mitochondrial disease (LIMD), which included the following sequential steps:

(1) sample collection and extraction of genomic DNA.

Clinical data of family members and blood samples (EDTA anticoagulation) were collected, which were blood samples sent to forry medical laboratory ltd.

The Blood genomic DNA of each member of the family was extracted according to the instruction procedures of the Blood DNA extraction Kit (magenta, HiPure Blood & Tissue DNA Kit). The purity of the DNA was measured using Nanodrop one, OD260nm/OD280nm of the obtained genomic DNA were each between 1.7 and 2.0, and the concentration of the DNA was measured using Nanodrop one, the concentration of the obtained genomic DNA was 50 to 100 ng/. mu.L, and the total amount was 5 to 10. mu.g. Storing at-20 deg.C.

(2) Exome sequencing and bioinformatic analysis.

In order to find other pathogenic genes of LIMD, exome sequencing was used to screen 1 LIMD family for potential genetic variation (family map is shown in FIG. 1), and no pathological variation was found in the existing LIMD pathogenic gene test.

Exome sequencing was performed on the proband. Briefly, genomic DNA was fragmented, and subjected to enzymatic fragmentation, end repair, 3' -end addition of A, linker ligation, and PCR amplification by using a Kit of KAPA company (KAPA Hyperplus Library Preparation Kit); the exon regions were captured using a library construction kit (XGen outer Research Panel v2) from IGT. The library was sequenced on a Novaseq sequencer (Illumina, san diego, CA, usa) (sequencing depth 150X). NGS sequencing results were aligned to the human reference genome UCSC NCBI37/hg19 using Novocraft Novoalign to obtain a unique aligned sequence aligned to the genome. The variation of the target region was determined using VarScan mpileup2snp and VarScan mpileup2indel detection. Remove Run Common Variants and Remove Global Common Variants software were used to Remove Common variations in dbSNP and ExAC databases. The variants were then annotated using Interactive Biosoftware Alamut Batch. The database used for annotation includes: dbSNP, ExAC, 1000g, ClinVar, OMIM, etc. Py was used to rank the annotated variants by High, Medium, Low. In High and Medium packets, a precedence value and a classification reason are given to the variation. All mutations are initially in the Low group and when a mutation meets certain criteria, it can be classified as a higher level mutation. And performing SNP function prediction by using FATHMM, FATHMMMKL, METALR, METASVM, MUTATIONASSESSOR, MUTATIONTASTERAGGGD, AGVGD, LRT, PROVEAN and SIFT software.

After sequencing the whole exons of 1 LIMD family TIMM13 gene in figure 1 and bioinformatics analysis, we find that proband carries 2 complex heterozygous mutations, and a BAM file of mutation sequencing results is shown in figure 2, wherein the gene code of the TIMM13 gene in an Ensemble database (www.ensembl.org) is ENSG00000099800, wherein mutation TIMM13 p.Gln25Ter, and a base with the physical position of 2427459 is mutated from G to A; RNA level: the 73 rd base of the coding RNA of the TIMM13 gene is mutated from C to T; protein level: the 25 th amino acid of protein coded by the TIMM13 gene is mutated into a stop codon from glutamine; mutation TIMM13 p.Lys45Ter, wherein the base with the physical position of 2427310 is mutated from T to A; RNA level: the 133 th base of the coding RNA of the TIMM13 gene is mutated from A to T; protein level: the 45 th amino acid of protein coded by the TIMM13 gene is mutated into a stop codon from lysine; no other suspected site of mutation of the pathogenic gene was found.

The mutation p.Gln25Ter and p.Lys45Ter of the TIMM13 gene is not recorded in a normal population database such as gnomaD and the like, which leads to complete loss of the function of the protein of the proband TIMM13 and seriously influences the physiological function of the TIMM13 protein. According to the known biological function results, the clinical symptoms of proband LIMD are highly consistent.

According to the screening process designed by us, by means of high-throughput deep sequencing and bioinformatics analysis, we successfully found that the TIMM13 gene is a LIMD new pathogenic gene, and the mutations p.Gln25Ter and p.Lys45Ter are new pathogenic sites of the disease.

(3) And (5) carrying out Sanger sequencing verification to identify the mutant gene.

Sanger sequencing was used to verify 2 mutations of the TIMM13 gene detected by exon sequencing: c.73C > T, c.133A > T (see FIG. 3). Primer 3 Primer design software is adopted to design Primer sequences SEQ ID NO. 3-SEQ ID NO.6, and the Primer sequences amplify genome DNA fragments containing TIMM13 gene mutation sites.

The PCR amplification system (20. mu.l) included: PCR 5 Xbuffer mix 10. mu.l, forward primer (10. mu. mol) 1. mu.l, reverse primer (10. mu. mol) corresponding to the forward primer 1. mu.l, ddH₂O6. mu.l, DNA 2. mu.l. PCR reaction procedure: at 95 deg.C for 5min, for 35 cycles (95 deg.C for 5min, 95 deg.C for 30s, 60 deg.C for 30s), at 72 deg.C for 10min, and at 4 deg.C. After PCR amplification is finished, 1% agarose gel electrophoresis is adopted for detection, PCR product gel is recovered by cutting gel, and products are recovered by Taq enzyme purification. All PCR products were sequenced with forward and reverse primers, respectively. The sequencing results are shown in FIG. 3.

In summary, the identified mutant TIMM13 gene of the present invention can be used for early clinical screening of LIMD patients, and the above description is only a preferred embodiment of the present invention, and is not intended to limit the present invention, and various modifications and variations can be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> Fuzhou Furui medical laboratory Co., Ltd

<120> TIMM13 mutant gene, primer, kit and method for detecting same, and use thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 243

<212> DNA

<213> human (human)

<400> 1

atggagggcg gcttcggctc cgatttcggg ggctccggca gcgggaagct ggacccaggg 60

ctcataatgg agcagaggat gacggacaag tgtttccgga agtgtatagg gaaacctggg 120

ggctccctgg acaactccga gcagaagtgc atcgccatgt gcatggaccg ctacatggac 180

gcctggaaca ccgtgtctcg cgcctacaac tcgcggctgc agcgggaacg agccaacatg 240

tga 243

<210> 2

<211> 80

<212> PRT

<213> human (human)

<400> 2

Met Glu Gly Gly Phe Gly Ser Asp Phe Gly Gly Ser Gly Ser Gly Lys

1 5 10 15

Leu Asp Pro Gly Leu Ile Met Glu Gln Arg Met Thr Asp Lys Cys Phe

20 25 30

Arg Lys Cys Ile Gly Lys Pro Gly Gly Ser Leu Asp Asn Ser Glu Gln

35 40 45

Lys Cys Ile Ala Met Cys Met Asp Arg Tyr Met Asp Ala Trp Asn Thr

50 55 60

Val Ser Arg Ala Tyr Asn Ser Arg Leu Gln Arg Glu Arg Ala Asn Met

65 70 75 80

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gacctcggtc cggttgactt 20

<210> 4

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cctgctcgga gttgtccag 19

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cgaaagtgca gatcgccgtg 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cgtgttccag gcgtccatgt 20