Application of one or more of Sorcin, Smad4, ZEB1 and miR-142-5p as diagnostic markers in preparation of a detection kit for paclitaxel resistance of ovarian cancer individuals or a prognosis kit for paclitaxel resistance of ovarian cancer individuals.

2. The application of the reagent for detecting the expression level of one or more of Sorcin, Smad4, ZEB1 and miR-142-5p in the preparation of a detection kit for paclitaxel resistance of an ovarian cancer individual or a prognosis kit for the ovarian cancer paclitaxel resistance individual.

3. The use of claim 1 or 2, wherein the ovarian cancer is high-grade serous ovarian cancer.

4. Use according to claim 2, wherein said agent is selected from: primers for specifically amplifying coding genes of Sorcin, Smad4 and ZEB1 proteins; or a probe which specifically recognizes the coding gene of the Sorcin, Smad4 and ZEB1 protein or the transcript thereof; or antibodies specific to Sorcin, Smad4, ZEB1 protein; or a probe which is specifically combined with the cDNA corresponding to the miR-142-5p or miR-142-5 p; or a primer which is specifically combined with the cDNA corresponding to the miR-142-5p or miR-142-5 p.

5. The use according to claim 2, wherein the reagent detects the expression level of any one or more of Sorcin, Smad4, ZEB1 and miR-142-5p by fluorescent dye method, digital PCR, resonance light scattering method, real-time fluorescence quantitative PCR, sequencing or biomass spectrometry.

The application of one or more of an inhibitor of Sorcin, an inhibitor of ZEB1, an accelerant of Smad4 and an accelerant of miR-142-5p in the preparation of medicines for reversing the drug resistance of ovarian cancer taxol.

7. The use of claim 6, wherein the inhibitor is selected from the group consisting of small interfering RNA, dsRNA, shRNA, microRNA, antisense nucleic acid targeting a protein or a transcript thereof and capable of inhibiting protein expression or gene transcription; or a construct capable of expressing or forming said small interfering RNA, dsRNA, microRNA, antisense nucleic acid; the promoter of Smad4 is selected from an overexpression vector of Smad4 or an active fragment or a coding sequence thereof; the promoter of the miR-142-5p is selected from mimic nucleic acids thereof.

8. The use according to claim 7, wherein the inhibitor of Sorcin is a small interfering RNA having the sequence shown in SEQ ID NO. 4.

9. A method for screening potential substances for reversing paclitaxel resistance of ovarian cancer, which comprises the following steps: (1) treating a system expressing Sorcin, Smad4, ZEB1 and/or miR-142-5p with a candidate substance; (2) detecting the expression of Sorcin, Smad4, ZEB1 and/or miR-142-5p in the system; if the candidate substance can reduce the expression of Sorcin and ZEB1 or increase the expression of ZEB1 and miR-142-5p, the candidate substance is a needed potential substance, and otherwise, the candidate substance is an undesired potential substance.

Background

At present, a chemotherapy scheme of platinum and paclitaxel is a standard treatment mode after advanced ovarian cancer operation, the initial chemotherapy effect of most patients is obvious, but chemotherapy resistance and relapse occur in about 80% of patients in the later period, and the occurrence of the chemotherapy resistance is a great problem in the treatment of ovarian cancer. But at present, the marker for predicting the chemotherapy response of ovarian cancer patients is not clinically used.

The relation between soluble resistance-related calcium-binding protein (SRI) and the drug resistance of ovarian cancer chemotherapy and the influence on the survival time of patients are studied in the literature (Zhang Shujun, Deng Mengxian, Wang, et al. Sorcin expression level influences the drug resistance and the survival time of ovarian cancer patients). The function and mechanism of Peroxidase (PXDN) in ovarian cancer was studied preliminarily [ D ] southern medical university ] and it was disclosed that peroxidase promotes the proliferation, invasion and metastasis of ovarian cancer by promoting expression of Snaill and Smad4 in TGF- β pathway and activation of Smad2 and Smad 3.

However, Zinc Finger E-box Binding Homeobox 1(ZEB1) is highly expressed in human paclitaxel-resistant ovarian cancer, micro-interfering RNA miR-142-5p and TGF-beta signal transduction protein Smad4 are low expressed in human paclitaxel-resistant ovarian cancer, and Sorcin and the three form a Smad4/ZEB1/miRNA-142-5p/Sorcin negative feedback loop to mediate paclitaxel resistance of the ovarian cancer, which is not reported at present.

Disclosure of Invention

The invention aims to overcome the defects in the prior art and provides application of Smad4/ZEB1/miRNA-142-5p/Sorcin negative feedback loop in paclitaxel resistance of ovarian cancer.

In a first aspect, the invention provides application of one or more of Sorcin, Smad4, ZEB1 and miR-142-5p as a diagnostic marker in preparation of a detection kit for paclitaxel resistance of an ovarian cancer individual or a prognosis kit for paclitaxel resistance of the ovarian cancer individual.

In a preferred embodiment of the present invention, the ovarian cancer is high-grade serous ovarian cancer.

In a second aspect, the invention provides application of a reagent for detecting the expression level of one or more of Sorcin, Smad4, ZEB1 and miR-142-5p in preparation of a kit for detecting paclitaxel resistance of an ovarian cancer individual or a kit for prognosis of the ovarian cancer paclitaxel resistance individual.

In a preferred embodiment of the present invention, the ovarian cancer is high-grade serous ovarian cancer.

As another preferred embodiment of the present invention, the agent is selected from: primers for specifically amplifying coding genes of Sorcin, Smad4 and ZEB1 proteins; or a probe which specifically recognizes the coding gene of the Sorcin, Smad4 and ZEB1 protein or the transcript thereof; or antibodies specific to Sorcin, Smad4, ZEB1 protein; or a probe which is specifically combined with the cDNA corresponding to the miR-142-5p or miR-142-5 p; or a primer which is specifically combined with the cDNA corresponding to the miR-142-5p or miR-142-5 p.

As another preferred embodiment of the present invention, the reagent detects the expression level of any one or more of Sorcin, Smad4, ZEB1 and miR-142-5p by a fluorescent dye method, digital PCR, resonance light scattering method, real-time fluorescence quantitative PCR, sequencing or biomass spectrometry.

In a third aspect, the invention provides application of one or more of an inhibitor of Sorcin, an inhibitor of ZEB1, an accelerant of Smad4 and an accelerant of miR-142-5p in preparation of a medicine for reversing paclitaxel resistance of ovarian cancer.

In a preferred embodiment of the present invention, the inhibitor is selected from the group consisting of small interfering RNA, dsRNA, shRNA, microrna, antisense nucleic acid, which has a protein or a transcript thereof as a target sequence and is capable of inhibiting protein expression or gene transcription; or a construct capable of expressing or forming said small interfering RNA, dsRNA, microRNA, antisense nucleic acid; the promoter of Smad4 is selected from an overexpression vector of Smad4 or an active fragment or a coding sequence thereof; the promoter of the miR-142-5p is selected from mimic nucleic acids thereof.

More preferably, the inhibitor of Sorcin is a small interfering RNA with the sequence shown in SEQ ID NO. 4.

In a fourth aspect, the present invention provides a method for screening potential substances for reversing paclitaxel resistance of ovarian cancer, comprising: (1) treating a system expressing Sorcin, Smad4, ZEB1 and/or miR-142-5p with a candidate substance; (2) detecting the expression of Sorcin, Smad4, ZEB1 and/or miR-142-5p in the system; if the candidate substance can reduce the expression of Sorcin and ZEB1 or increase the expression of ZEB1 and miR-142-5p, the candidate substance is a needed potential substance, and otherwise, the candidate substance is an undesired potential substance.

The invention has the advantages that:

cell experiments and tumor big data prove that soluble drug-resistant related calcium binding protein (Sorcin) and zinc finger E box binding protein 1(ZEB1) are highly expressed in the human paclitaxel-resistant ovarian cancer, and micro-interference RNA miR-142-5p and TGF-beta signal transduction protein Smad4 are lowly expressed in the human paclitaxel-resistant ovarian cancer, the expression amounts are closely related to the life cycle of ovarian cancer patients, a Smad4/ZEB1/miRNA-142-5p/Sorcin negative feedback loop is formed among the above four to mediate the paclitaxel resistance of the ovarian cancer, and the miRNA-142-5p acts on the loop (for example, the miRNA-5 p is used for reducing Sorcin) to reverse the paclitaxel resistance of the ovarian cancer. Based on the molecular marker, the invention provides the molecular marker for detecting the drug resistance of the paclitaxel in the ovarian cancer and predicting the prognosis of patients with drug resistance of the paclitaxel in the ovarian cancer, and provides a new target for reversing the drug resistance of the paclitaxel in the ovarian cancer.

Drawings

FIG. 1: (A) sorcin is highly expressed in ovarian cancer paclitaxel-resistant cells OV3R-PTX compared with ovarian cancer paclitaxel-sensitive cells OVCAR-3; (B) compared with ovarian cancer taxol sensitive cells SKOV-3, Sorcin is highly expressed in ovarian cancer taxol resistant cells SK 3R-PTX; (C) in the GSE51373 data set, Sorcin tended to be highly expressed in human ovarian cancer chemotherapy-resistant tissues compared to chemotherapy-sensitive ovarian cancer patient tissues; (D) compared with ovarian cancer taxol sensitive cells OVCAR-3 and SKOV-3, ZEB1 is highly expressed in ovarian cancer taxol resistant cells OV3R-PTX and SK 3R-PTX; (E) in the GSE51373 dataset, ZEB1 was highly expressed in human ovarian cancer chemotherapy-resistant tissues compared to chemotherapy-sensitive ovarian cancer patient tissues; (F) compared with ovarian cancer paclitaxel sensitive cells SKOV-3, miR-142-5p has low expression in ovarian cancer paclitaxel resistant cells SK 3R-PTX; (G) compared with ovarian cancer taxol sensitive cells OVCAR-3 and SKOV-3, SMAD4 is low expressed in ovarian cancer taxol resistant cells OV3R-PTX and SK 3R-PTX; (H) in the GSE51373 data set, SMAD4 was poorly expressed in human ovarian cancer chemotherapy-resistant tissues compared to chemotherapy-sensitive ovarian cancer patient tissues.

FIG. 2: (A) high expression of Sorcin is closely related to the shortened overall survival of ovarian cancer patients; (B) high expression of ZEB1 was closely associated with shortened overall survival in ovarian cancer patients; (C) the high expression of miR-142 is closely related to the longer overall survival period of ovarian cancer patients; (D) low expression of Smad4 may predict shorter overall survival in ovarian cancer patients.

FIG. 3: smad4/ZEB1/miRNA-142-5p/Sorcin negative feedback axis mediates drug resistance to paclitaxel from ovarian cancer. (A and B) Western blot detection of changes in expression of ZEB1, P-SMAD2, SMAD2 and SMAD4 in OV3R-PTX and SK3R-PTX cells after intervention with TGF- β, knockdown of SMAD4 and a combination of both; semi-quantitative analysis of the numbers representing gray values; (C and D) expression of Pri-miR-142 is up-regulated upon knockdown of ZEB1 in OV3R-PTX and SK3R-PTX cells; (E and F) in OV3R-PTX and SK3R-PTX cells, after miR-142-5p imic is transfected, the expression of Sorcin is obviously reduced; (G and H) RT-qPCR assay the expression level of ZEB1 after knocking-down Sorcin in SK3R-PTX and SKOV3 cells (left); western blot analysis in SK3R-PTX and SKOV3 cells, knockdown the expression level of ZEB1 after Sorcin (right); (I) cell nucleus cytoplasm separation experiment Western blot detects that after Sorcin is knocked down in SK3R-PTX cells, the expression of SMAD2 and SMAD4 in cytoplasm and nucleus is up-regulated; (J) cell immunofluorescence confocal assay analysis after knocking down Sorcin in SK3R-PTX cells, the proportion of nucleus translocated cells of SMAD4 is obviously greater than that of NC control group.

FIG. 4: the knocking-down of the Sorcin protein can increase the sensitivity of ovarian cancer taxol-resistant cells to taxol, so that the activity of the taxol-resistant cells is reduced, the cell proliferation is slowed down, and the apoptosis is increased. (A) After Si-Sorcin is transfected, the protein level of Sorcin is obviously reduced; (B and C) concentration gradient and time gradient experiments, in OV3R-PTX, CCK8 experiment examined the change of PTX on cell viability after knocking down Sorcin. (D) Colony formation experiments analysis of the effect of silencing Sorcin on cell colony formation in OV3R-PTX cells and statistical analysis of cell colony numbers; (E) and analyzing the apoptosis rate of the Si-Sorcin group and the NC group in OV3R-PTX cells and the quantification of the proportion of the two groups of total apoptotic cells by a flow cytometer.

Detailed Description

The following detailed description of the present invention will be made with reference to the accompanying drawings.

Example 1

Comparison of the expression of Sorcin, Smad4, ZEB1 and miR-142-5p in human ovarian cancer paclitaxel sensitive cell lines and ovarian cancer paclitaxel resistant cells.

The experimental method comprises the following steps:

1. OVCAR3, OV3R-PTX, SKOV3 and SK3R-PTX cells (OV3R-PTX and SK3R-PTX sources as described in patent CN 104388389A) were added to an appropriate amount of lysate SDS and lysed on ice for 30 min. Then cell lysate is scraped, 4-degree centrifugation is carried out, SDS loading buffer with proper volume is added, and a metal bath is used for heating for 10min at 100 ℃ to obtain a total cell protein sample.

2. Protein samples were subjected to Western blot experiments (Western blot), after overnight incubation of the corresponding primary antibodies, Sorcin, ZEB1 and SMAD4, Actin was used as an internal reference, the secondary antibodies were incubated the next day, and developed by chemiluminescence after TBST washing several times.

3. And extracting total RNA of SKOV3 and SK3R-PTX cells by using an RNA extraction kit, and detecting the expression of miR-142-5p by a reverse transcription and fluorescence quantitative PCR method.

GSE51373 dataset comprised 12 cases of chemotherapy-resistant and 16 cases of chemotherapy-sensitive high-grade serous ovarian cancer patients, and expression profile matrices were extracted for each sample to compare the differences in expression of SRI, ZEB1 and SMAD4 mRNA in chemotherapy-sensitive and chemotherapy-resistant patients.

The experimental results are as follows:

sorcin, Smad4, ZEB1 and miR-142-5p are related markers of paclitaxel resistance of ovarian cancer: sorcin and ZEB1 are expressed in human paclitaxel resistant ovarian cancer, and miR-142-5p and Smad4 are expressed in human paclitaxel resistant ovarian cancer cells in a down-regulated manner. Sorcin and ZEB1 were up-regulated in human ovarian cancer chemotherapy-resistant tissues, and SMAD4 was down-regulated in human ovarian cancer chemotherapy-resistant tissues (FIG. 1).

Second, the effect of Sorcin, Smad4, ZEB1 and miR-142-5p on the survival prognosis of ovarian cancer patients.

The experimental method comprises the following steps:

the KM-PLOTTER online ovarian cancer database was used to evaluate the effect of Sorcin, Smad4, ZEB1 and miR-142-5p on the survival prognosis of ovarian cancer patients. For Sorcin using 208920_ s _ at probe, the high-low expression threshold value is 287; for ZEB1 using 239952_ at probe, high-low expression threshold was 78; the high-low expression threshold was 79 for SMAD4 using the 202526_ at probe; for miR-142-5p, a probe has-miR-142 is used, and the high-low expression threshold value is 2.

The experimental results are as follows: in ovarian cancer, high expression of Sorcin and ZEB1 was strongly correlated with poor overall survival of patients, while low expression of SMAD4 and miR-142 was strongly correlated with poor overall survival of patients (fig. 2).

And thirdly, Smad4/ZEB1/miRNA-142-5p/Sorcin negative feedback loop mediates the drug resistance of the ovarian cancer taxol.

The experimental method comprises the following steps:

1. in OV3R-PTX and SK3R-PTX cells, 10ng/ml TGF-beta 1 was intervened, Si-SMAD4 (sequence information 5 '→ 3': GCUCCUAGACGAAGUACUUTT, SEQ ID NO:1, wherein TT is a protected base) was transfected, total cell protein was extracted after 48 hours, and then the expression of ZEB1, P-SMAD2 and SMAD4 was detected by Western blot. In OV3R-PTX and SK3R-PTX cells, Si-ZEB1 (sequence information 5 '→ 3': GCUGAGAAGCCUGAGUCCUTT, SEQ ID NO:2, wherein TT is a protected base) was transfected, total RNA was extracted from the cells after 48 hours, and then expression of Pri-miR-142 was detected by RT-qPCR.

2. In OV3R-PTX and SK3R-PTX cells, miR-142-5p micic (CAUAAAGUAGAAAGCACUACU, SEQ ID NO:3) or Sh-Sorcin (sequence information 5 '→ 3': GCUGGAGACAACACUUUAUTT, SEQ ID NO:4, wherein TT is a protective base) is intervened, and then expression of Sorcin or ZEB1 is detected by Western blot.

3. After the Sorcin is knocked down, OV3R-PTX and SK3R-PTX cytoplasm and cell nucleus components are respectively extracted, and then SMAD4 expression is detected through Western blot. The immunofluorescence experiment detects the location of SMAD4 in the nucleus after the Sorcin is knocked down.

The experimental results are as follows:

in an ovarian cancer taxol-resistant cell, TGF-beta/Smad 4 directly regulates the expression of a transcription factor ZEB1, ZEB1 transcribes and inhibits the expression of miR-142-5p, miR-142-5p can silence the expression of Sorcin, and finally Sorcin regulates the expression of ZEB1 by mediating Smad4 nuclear translocation negative feedback. In conclusion, Sorcin negatively fed back through ZEB1/miR-142-5p/SMAD4 regulates axis-mediated paclitaxel drug resistance of ovarian cancer (figure 3).

And fourthly, the reduction of the Sorcin can obviously reverse the taxol resistance of the ovarian cancer cells.

The experimental method comprises the following steps:

1. OV3R-PTX cells were transfected with Si-Sorcin (sequence information 5 '→ 3': GCUGGAGACAACACUUUAUTT, SEQ ID NO:4), and Sorcin knock-down efficiency was measured by Western blot after 48 hours of protein extraction.

2. Si-Sorcin is transfected into PTX drug-resistant cells, and the cells to be treated are trypsinized 24 hours after transfection. Each hole 10⁴Individual cells were seeded in 96-well plates and complete medium containing PTX was added every other day at a concentration gradient. After 48h, 110. mu.l of the prepared culture medium containing CCK8 was added to each well, and after 2 hours of incubation, the absorbance of the sample was measured with a microplate reader. Percent (%) cell viability ═ PTX intervention-blank group]/[0 μ M PTX group-blank group]X 100, absorbance value of blank, i.e. wells without cells.

3. Si-Sorcin is transfected into PTX drug-resistant cells, and the cells to be treated are trypsinized 24 hours after transfection. Each hole 10³The cells were seeded in 6-well plates and two days later in the cell-adherent state, and different concentrations of PTX were added to the respective groups. After two weeks, remove the plate, discard the old medium and wash 2 times with PBS. Fixed with 4% paraformaldehyde solution, stained with 1% crystal violet, washed 2 times with PBS. Camera photographs saved data and ImageJ counted the number of cell colonies.

4. Preparing 1 × binding buffer absolute ethyl alcohol by double distilled water and placing the mixture in a 4-degree refrigerator for precooling. The cells to be treated are collected and cultured in a centrifuge tube. The cells were washed once with PBS and recovered, then digested with EDTA-free pancreatin, and the collected cell suspension was centrifuged at 4 degrees. Discard the supernatant, wash the cells 2 times with pre-cooled PBS, and centrifuge at 4 ℃. The supernatant was discarded and 100. mu.l of 1 XBinding buffer was pipetted to mix the cell pellet. Then Annexin V and PI are added, and the mixture is placed for 15min at room temperature in a dark place. The tubes were filled with 400. mu.l of 1 binding buffer and tested on the machine.

The experimental results are as follows:

in the ovarian cancer taxol-resistant cells, silencing Sorcin expression can reverse taxol resistance of the ovarian cancer cells and increase the sensitivity of the drug-resistant cells to taxol; and silencing Sorcin expression can promote apoptosis of ovarian cancer cells and inhibit proliferation of ovarian cancer cells (figure 4).

In conclusion, Sorcin and ZEB1 have high expression in the human paclitaxel resistant ovarian cancer, Smad4 and miR-142-5p have low expression in the human paclitaxel resistant ovarian cancer, and the expression is related to the survival prognosis of ovarian cancer patients. In ovarian cancer, they constitute the Smad4/ZEB1/miRNA-142-5p/Sorcin negative feedback loop to regulate ovarian paclitaxel drug resistance. Sorcin, ZEB1, Smad4 and miR-142-5p can predict drug resistance biomarkers of paclitaxel in ovarian cancer and potential drug resistance reversal targets.

The above description is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, several modifications and additions can be made without departing from the method of the present invention, and these modifications and additions should also be regarded as the protection scope of the present invention.

SEQUENCE LISTING

<110> Jinshan Hospital affiliated to Fudan university

<120> diagnosis, prediction and reversal of ovarian cancer paclitaxel drug resistance aiming at Sorcin regulation loop

<130> /

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 19

<212> RNA

<213> Artificial sequence

<400> 1

gcuccuagac gaaguacuu 19

<210> 2

<211> 19

<212> RNA

<213> Artificial sequence

<400> 2

gcugagaagc cugaguccu 19

<210> 3

<211> 21

<212> RNA

<213> Artificial sequence

<400> 3

cauaaaguag aaagcacuac u 21

<210> 4

<211> 19

<212> RNA

<213> Artificial sequence

<400> 4

gcuggagaca acacuuuau 19