Kit for detecting cancer and/or precancerous lesion
1. A cancer, preferably colorectal cancer, and/or precancerous lesion detection kit comprising reagents for detecting the methylation status or level of NeuroG1 gene and reagents for detecting the methylation status or level of SDC2 gene, the precancerous lesion being an Advanced Adenoma (AA).
2. The kit of claim 1, wherein the reagents for detecting methylation of the NeuroG1 gene are directed to one or more of the following detection segments in the NeuroG1DNA sequence: segment A (SEQ ID NO:21), segment B (SEQ ID NO:22) and segment C (SEQ ID NO:13), and/or
The reagent for detecting methylation of SDC2 gene is directed to detection segment D (SEQ ID NO:17) in SDC2 DNA sequence.
3. The kit of claim 2, wherein the reagents for detecting methylation of the NeuroG1 gene are directed to one or more of the following detection segments: segment A1 (positions 56-114 of SEQ ID NO:21), segment A2 (positions 151-227 of SEQ ID NO:21), segment A3 (positions 254-320 of SEQ ID NO:21), segment B1 (positions 91-170 of SEQ ID NO:22), segment B2 (positions 206-275 of SEQ ID NO:22), segment B3 (positions 273-344 of SEQ ID NO:22), segment C1 (positions 22-95 of SEQ ID NO:13), segment C2 (positions 84-150 of SEQ ID NO:13) and segment C3 (positions 160-222 of SEQ ID NO: 13); and/or
The reagent for detecting methylation of SDC2 gene is directed to a detection segment in SDC2 DNA sequence: segment D1 (position 141-194 of SEQ ID NO:17), segment D2 (position 183-256 of SEQ ID NO:17) and segment D3 (position 259-326 of SEQ ID NO: 17).
4. The kit of claim 3,
the reagent for detecting methylation state or level of neuroG1 gene and the reagent for detecting methylation state or level of SDC2 gene contained in the kit are directed to a combination of detection segments selected from the group consisting of: C1D2, B3D2, B1D2, C3D2, A2D2, C1D3, C1D1, B3D3, B3D1, C3D3, B1D3, C3D1 and B1D1, preferably C1D 2.
5. The kit of any one of claims 1 to 3, wherein the reagents for detecting methylation of the NeuroG1 gene comprise primer pairs selected from the group consisting of: SEQ ID NO. 3 and SEQ ID NO. 4; SEQ ID NO. 31 and SEQ ID NO. 32; SEQ ID NO. 34 and SEQ ID NO. 35; SEQ ID NO. 37 and SEQ ID NO. 38; SEQ ID NO. 40 and SEQ ID NO. 41; SEQ ID NO 43 and SEQ ID NO 44; SEQ ID NO. 46 and SEQ ID NO. 47; SEQ ID NO. 49 and 50 and SEQ ID NO. 52 and 53, preferably SEQ ID NO. 3 and 4.
6. The kit of any one of claims 1 to 3, wherein the reagents for detecting methylation of the SDC2 gene comprise primer pairs selected from the group consisting of: SEQ ID NO. 1 and SEQ ID NO. 2; SEQ ID NO. 55 and SEQ ID NO. 56; and SEQ ID NO:58 and SEQ ID NO:59, preferably SEQ ID NO:1 and SEQ ID NO: 2.
7. The kit of any one of claims 1 to 3, wherein the reagents for detecting methylation of the NeuroG1 gene comprise capture probes selected from the group consisting of: SEQ ID NO. 8, SEQ ID NO. 94 to SEQ ID NO. 101, preferably SEQ ID NO. 8.
8. The kit of any one of claims 1 to 3, wherein the reagents for detecting methylation of the SDC2 gene comprise capture probes selected from the group consisting of: SEQ ID NO. 7, SEQ ID NO. 102 and SEQ ID NO. 103, preferably SEQ ID NO. 7.
9. The kit of any one of claims 1 to 3, wherein the reagents for detecting methylation of the NeuroG1 gene comprise detection probes selected from the group consisting of: 11, 33, 36, 39, 42, 45, 48, 51 and 54, preferably 11 and/or 54
The reagents for detecting methylation of the SDC2 gene include detection probes selected from the group consisting of: SEQ ID NO. 10, SEQ ID NO. 57 and SEQ ID NO: 60, preferably SEQ ID NO: 10.
10. A kit according to any one of claims 1 to 3, wherein the kit is for detecting methylation of the NeuroG1 and SDC2 genes in a sample, preferably a tissue sample, preferably intestinal tissue, body fluid, or faeces, preferably stool, sputum, urine or saliva, from a subject.
11. Use of a reagent for detecting methylation of the NeuroG1 gene and a reagent for detecting methylation of the SDC2 gene in the manufacture of a kit for the detection of cancer, preferably colorectal cancer, and/or a precancerous lesion, preferably an Advanced Adenoma (AA).
12. Use of a detection segment, primer pair, capture probe or detection probe in a kit according to any one of claims 2 to 9 in the preparation of a methylation detection reagent or kit, or a cancer, preferably colorectal cancer, and/or a pre-cancerous lesion, preferably a progressing adenoma (AA).
Technical Field
Colorectal cancer (CRC) is the third most malignant tumor in the world, accounting for 10% of all malignant tumors, and is the 3 rd most malignant tumor, which seriously threatens human health. In recent years, with the improvement of the living standard of people in China, the change of dietary structure and habits, the prolongation of the expected life, the aging trend of population and the like, the incidence of colorectal cancer in China rises year by year, the 5 th position is arranged in the incidence of tumor in males, and the 4 th position is arranged in the incidence of tumor in females; especially in the last decade, the incidence of colorectal cancer has increased by > 4% per year, at an international level far exceeding 2%, with an estimated 40 million cases per year, the second most prevalent in digestive system malignancies in our country. Colorectal cancer ranks at 5 th in tumor mortality in both men and women. Colorectal cancer usually develops slowly from precancerous polyps through a series of genetic and epigenetic changes and histological and morphological changes, with most colorectal tumors growing slowly, remaining silent or asymptomatic until they reach a certain size or stage of development. Therefore, colorectal cancer is an ideal target that can intervene by screening. The 5-year survival rate of early colorectal cancer patients can reach more than 90 percent after operation, the 5-year survival rate of middle and late stage patients is only about 10 percent, and about 80 percent of clinically diagnosed colorectal cancer is in the middle and late stage, which is one of the key factors causing the death rate to be high. The incidence rate of early colorectal cancer patients effectively treated is reduced by 60 percent, and the fatality rate is reduced by 80 percent, so the early discovery, early diagnosis and early treatment of colorectal cancer are particularly important.
Since 93% of colorectal cancers originate from adenomas, there are many symptoms characteristic in the early stage, and it takes about 10 years to develop from adenomas to cancers, which provides a time base for early screening. Therefore, the screening of the high risk group of the colorectal cancer and the early discovery and early diagnosis of the colorectal cancer patient so as to realize the early treatment of the colorectal cancer patient are important aspects for improving the overall survival rate of the patient.
Adenomas can be classified into non-progressive adenomas (NAA) and progressive adenomas (AA: diameter > 10mm or containing villous components or having severe dysplasia or high grade intraepithelial neoplasia). Advanced Adenomas (AA) are at higher risk of secondary colorectal cancer, while non-advanced adenomas (NAA) are at comparable risk of developing secondary colorectal cancer as those without polyps. Therefore, it is more meaningful to detect, diagnose Advanced Adenomas (AA) early.
Non-patent document 1 ("Methylation of NEUROG1in Serum Is a Sensitive Marker for The detection of Early color Cancer", Herbst et al, The American Journal of GASTROENTEROLOGY, 2011; 106: 1110-1118; doi:10.1038/ajg.2011.6) discloses a method for detecting Early Colorectal Cancer by NEUROG 1. With a specificity of 91%, the sensitivity for detecting colon cancer reaches 61%.
ES2683866a1 discloses an in vitro method for diagnosing and screening for advanced colorectal and adenomas in human biological fluids comprising determining the overall levels of sCD26 and NDKA protein, the percentage of methylation gene NEUROG1in combination.
RU2630669C1 discloses a method for identifying malignant lesions in colon and rectum, in which tens of tumor marker genomes of colorectal cancer, such as ADHFE1, ALX4, CNRIP1, EID3, ELMO1, ESR1, FBN1, HLTF, LAMA1, NEUROG1, NGFR, RARB, RXRG, RYR2, SDC2, SEPT9, SFRP2, SOCS3, SOX17, THBD, TMEFF2, UCHL1, VIM, etc., are exemplified, and sample detection results of SEPT9 are specifically given.
Overall, there are four major colorectal cancer screening methods available: 1) colonoscopy, the traditional method for early screening of CRC, is also the gold standard for colorectal cancer detection and diagnosis. But it requires a complicated intestinal tract preparation process, is invasive and requires professional technical personnel, resulting in low screening compliance in china; 2) stool occult blood test (FOBT), which is non-invasive but less sensitive to advanced tumors (27.1%) and aggressive cancers (65.8%); 3) stool occult blood immunochemical detection (FIT), the method is non-invasive, the sensitivity and the specificity to colorectal cancer are respectively 79 percent and 94 percent, but the sensitivity to advanced adenoma is insufficient, generally only 20 to 30 percent; 4) the method is noninvasive and convenient for detecting the plasma Septin9 methylation gene, but has only 45 percent of sensitivity to the CRC in the I stage and extremely low sensitivity (5 percent to 15 percent) to the detection of precancerous polyps, which indicates that the marker has poor capacity of identifying precancerous lesions. Therefore, a noninvasive detection method with high sensitivity and specificity is urgently needed for detecting colorectal cancer and precancerous lesions (especially advanced adenoma AA).
The fecal exfoliated cell and gene detection (sDNA) is the leading technology for screening colorectal cancer and advanced adenoma at present, is a non-invasive screening method, compared with the normal large intestine mucous membrane, the renewal and metabolism speed of the colorectal cancer and advanced adenoma cell is obviously increased, the exfoliated cell is increased, and partial colorectal cancer and advanced adenoma can be effectively screened out by quantitatively analyzing the DNA of the fecal exfoliated cell. Research shows that the methylation gene in the tumor cell shed from the excrement of the patient has high consistency with the methylation gene of the tumor tissue. Methylation is an epigenetic modification, and abnormal changes can cause changes in DNA conformation, DNA-protein interaction pattern and the like, thereby controlling gene expression. DNA methylation plays an important role in gene expression regulation, cell proliferation and differentiation, development, gene imprinting and the like, and has close relation with the occurrence and development of tumors. The research shows that DNA methylation abnormality is an early event of cancer occurrence, changes of DNA methylation level and pattern exist in the occurrence and development of colorectal cancer, and specific methylation fragments are searched for, thereby playing a decisive role in early detection of colorectal cancer.
CN110343764A provides an application and a kit of a detection reagent for detecting methylation of colorectal cancer related genes, wherein the related genes are selected from one or a combination of two of SDC2 genes and TFPI2 genes. This application is capable of detecting colorectal carcinoma and colorectal adenoma, but it has low sensitivity to adenomas, even if methylation of both genes is detected in combination, the sensitivity is only 73-78%, and more importantly, it cannot distinguish between Advanced Adenomas (AA) and non-advanced adenomas (NAA). Since non-advanced adenomas (NAA) account for the vast majority of adenomas, there are limitations to their clinical guidance.
In order to overcome the defects of the prior art, the technical problems to be solved by the invention are as follows: a kit for detecting cancer, particularly colorectal cancer, more particularly Advanced Adenoma (AA), with high sensitivity and high specificity is provided.
The invention content is as follows:
the main object of the present invention is to provide a kit for detecting methylation sites of genes related to cancers and/or precancerous lesions, particularly colorectal cancer and colorectal Advanced Adenoma (AA).
In one aspect, the invention provides a cancer and/or pre-cancerous lesion detection kit comprising reagents for detecting methylation of the NeuroG1 gene and reagents for detecting methylation of the SDC2 gene, the cancer preferably being colorectal cancer, and the pre-cancerous lesion being an Advanced Adenoma (AA).
Among them, the reagent for detecting methylation of NeuroG1 gene and the reagent for detecting methylation of SDC2 gene can be designed according to a probe method or a dye method. From the viewpoint of specificity and accuracy, the design according to the probe method is preferable.
As previously described, in the prior art, there are methods for identifying colorectal cancer by detecting methylation of SDC2 gene alone or NeuroG1 gene alone. However, these methods have poor specificity and sensitivity (especially advanced adenomas), especially have too low negative predictive value, and low total coincidence rate, which limits their practical application. The inventor surprisingly finds that the specificity and the sensitivity can be greatly improved, and the negative predictive value is improved by jointly detecting the methylation of the neuroG1 gene and the methylation of the SDC2 gene, so that the total coincidence rate exceeds 85 percent, and the detection result is improved.
In a preferred embodiment, the reagent for detecting methylation of the NeuroG1 gene is directed against one or more of the following detection segments in the NeuroG1DNA sequence: segment A (SEQ ID NO:21), segment A (SEQ ID NO:22) and segment C (SEQ ID NO:13), and/or
The reagent for detecting the methylation of the SDC2 gene is directed to a detection segment D (SEQ ID NO:17) in the SDC2 DNA sequence;
preferably, the reagent for detecting methylation of NeuroG1 gene is directed to one or more of the following detection segments: segment A1 (positions 56-114 of SEQ ID NO:21), segment A2 (positions 151-227 of SEQ ID NO:21), segment A3 (positions 254-320 of SEQ ID NO:21), segment B1 (positions 91-170 of SEQ ID NO:22), segment B2 (positions 206-275 of SEQ ID NO:22), segment B3 (positions 273-344 of SEQ ID NO:22), segment C1 (positions 22-95 of SEQ ID NO:13), segment C2 (positions 84-150 of SEQ ID NO:13) and segment C3 (positions 160-222 of SEQ ID NO: 13); and/or
Preferably, the reagent for detecting methylation of SDC2 gene is directed to a detection segment in SDC2 DNA sequence: segment D1 (141-194 of SEQ ID NO:17), segment D1 (183-256 of SEQ ID NO:17) and segment D3 (259-326 of SEQ ID NO: 17);
more preferably, the reagent for detecting methylation state or level of NeuroG1 gene and the reagent for detecting methylation state or level of SDC2 gene contained in the kit are directed to a combination of detection segments selected from the group consisting of: C1D2, B3D2, B1D2, C3D2, A2D2, C1D3, C1D1, B3D3, B3D1, C3D3, B1D3, C3D1, and B1D 1. Where C1D2 represents the combination of section C1 and section D2, and so on.
The method for detecting the DNA methylation of the specific sites mainly comprises the following steps: 1. methylation-specific PCR (MS-PCR); 2. bisulfite treatment + sequencing; 3. restriction enzyme analysis combined with sodium bisulfite (COBRA); 4. fluorescence (Methylight); 5. methylation sensitivity high-resolution melting curve analysis; 6. and (4) pyrosequencing. Methylight, which has high throughput and high sensitivity, and does not require operations such as electrophoresis and hybridization after PCR, and reduces contamination and operation errors, is used as an example. However, the present invention is not limited thereto, and other suitable DNA methylation detection methods may be employed.
Based on Methylight method, the transformation mode of the DNA sequence of the NeuroG1 gene detected by the invention is shown as follows, and the detection of the methylation state or level of the gene can be realized by detecting the complete sequence of the methylation sequence of the positive strand and the reverse strand of the DNA.
NeuroG1DNA plus strand sequence
acaCGactggcctcaggaccccttaagtaccCGgCGcaacaatgggCGcccccctcccttgccacctcCGccccCGCGgcagccCGggtgaatggagCGaggCGgcaggtcatcccCGtgcagCGccCGggtatttgcataatttatgctCGCGggaggcCGccatCGcccctcccccaaccCGgagtgtgccCGtaattacCGcCGgccaatCGgCGgCGtCGCGCGgcccCGggagtCGgctCGggctaagctggccagggCGtctccaggcagtgaaacagaggCGgggtCGgCGggCGattagCGgcCGaggcaCGctcctcttggggCGggctgggCGcccctCGctggggtgggaCG(SEQIDNO:13)
NeuroG1 plus strand methylated sequence
TtCGgCGtaataatgggCGttttttttttttgttattttCGttttCGCGgtagttCGggtgaatggagCGaggCGgtaggttattttCGtgtagCGttCGggtatttgtataatttatgttCGCGggaggtCGttatCGttttttttttaattCGgagtgtgttCGtaattatCGtCGgttaatCGgCGgCGtCGCGCGgtttCGggagtCGgttCGggttaagttggttagggCGtttttaggtagtgaaatagaggCGgggtCGgCGggCGattagCGgtCGaggtaCGttttttttggggCGggttgggCGtttttCGttggggt(SEQIDNO:14)
NeuroG1DNA reverse strand sequence
CGtcccaccccagCGaggggCGcccagccCGccccaagaggagCGtgcctCGgcCGctaatCGccCGcCGacccCGcctctgtttcactgcctggagaCGccctggccagcttagccCGagcCGactccCGgggcCGCGCGaCGcCGcCGattggcCGgCGgtaattaCGggcacactcCGggttgggggaggggCGatggCGgcctccCGCGagcataaattatgcaaataccCGggCGctgcaCGgggatgacctgcCGcctCGctccattcaccCGggctgcCGCGggggCGgaggtggcaagggaggggggCGcccattgttgCGcCGggtacttaaggggtcctgaggccagtCGtgt(SEQIDNO:15)
NeuroG1 reverse strand methylation sequence
CGttttattttagCGaggggCGtttagttCGttttaagaggagCGtgtttCGgtCGttaatCGttCGtCGatttCGtttttgttttattgtttggagaCGttttggttagtttagttCGagtCGattttCGgggtCGCGCGaCGtCGtCGattggtCGgCGgtaattaCGggtatatttCGggttgggggaggggCGatggCGgtttttCGCGagtataaattatgtaaatattCGggCGttgtaCGgggatgatttgtCGtttCGttttatttattCGggttgtCGCGggggCGgaggtggtaagggaggggggCGtttattgttgCGtCGggtatttaaggggttttgaggttagtCGtgt(SEQIDNO:16)
Based on Methylight method, the DNA sequence transformation mode of the SDC2 gene detected by the invention is shown as follows, and the detection of the methylation state or level of the gene can be realized by detecting the complete sequence of the methylation sequence of the positive strand and the reverse strand of DNA.
SDC2 DNA sequence
AccagaaactgaacctCGgcaCGggaaaggagtcCGCGgaggagcaaaaccacagcagagcaagaagagcttcagagagcagccttccCGgagcaccaactcCGtgtCGggagtgcagaaaccaacaagtgagagggCGcCGCGttccCGgggCGcagctgCGggCGgCGggagcaggCGcaggaggaggaagCGagCGccccCGagcccCGagccCGagtcccCGagcctgagcCGcaatCGctgCGgtactctgctcCGgattCGtgtgCGCGggctgCGcCGagCGctgggcaggaggcttCGttttgccctggttgcaagcagCGgctgggagcagcCGgtccctggggaatatgCGgCGCGCGtggatcctgctcaccttgggcttggtggcctgCGtgtCGgCGgagtCGagagcagagctgacatctgat(SEQIDNO:17)
SDC2 methylation sequence
AttagaaattgaatttCGgtaCGggaaaggagttCGCGgaggagtaaaattatagtagagtaagaagagttttagagagtagttttttCGgagtattaatttCGtgtCGggagtgtagaaattaataagtgagagggCGtCGCGttttCGgggCGtagttgCGggCGgCGggagtaggCGtaggaggaggaagCGagCGttttCGagtttCGagttCGagttttCGagtttgagtCGtaatCGttgCGgtattttgtttCGgattCGtgtgCGCGggttgCGtCGagCGttgggtaggaggtttCGttttgttttggttgtaagtagCGgttgggagtagtCGgtttttggggaatatgCGgCGCGCGtggattttgtttattttgggtttggtggtttgCGtgtCGgCGgagtCGagagtagagttgatatttgat(SEQIDNO:18)
In addition, detection of the methylation state or level of a gene can also be achieved by detecting partial sequences of the methylated sequences of the sense and antisense strands of DNA, such as the NeuroG1 alternative
cgtgcagcgcccgggtatttgcataatttatgctcgcgggaggccgccatcgcccctcccccaacccggagtgtgcccgtaattac cg (SEQ ID NO:19), SDC2 can be selected
gaggaagCGagCGccccCGagcccCGagccCGagtcccCGagcctgagcCGcaatCGctgCGgtactctg(SEQIDNO:20)。
In a preferred embodiment, the reagent for detecting methylation of NeuroG1 gene comprises a primer pair selected from the group consisting of: SEQ ID NO. 31 and SEQ ID NO. 32; SEQ ID NO. 34 and SEQ ID NO. 35; SEQ ID NO. 37 and SEQ ID NO. 38; SEQ ID NO. 40 and SEQ ID NO. 41; SEQ ID NO 43 and SEQ ID NO 44; SEQ ID NO. 46 and SEQ ID NO. 47; SEQ ID NO. 49 and 50 and SEQ ID NO. 52 and 53, preferably SEQ ID NO. 3 and 4.
In a preferred embodiment, the reagent for detecting methylation of the SDC2 gene comprises a primer pair selected from the group consisting of: SEQ ID NO. 1 and SEQ ID NO. 2; SEQ ID NO. 55 and SEQ ID NO. 56; and SEQ ID NO:58 and SEQ ID NO:59, preferably SEQ ID NO:1 and SEQ ID NO: 2.
However, it is to be noted that the primer and/or primer pair of the present invention is not limited to those described above. Since both NeuroG1 gene and SDC2 gene are known. Those skilled in the art can design appropriate primers based on known genes and with reference to the above primer pairs without undue effort.
In a preferred embodiment, the reagent for detecting methylation of the NeuroG1 gene comprises a capture probe selected from the group consisting of: SEQ ID NO. 8, SEQ ID NO. 94 to SEQ ID NO. 101, preferably SEQ ID NO. 8.
In a preferred embodiment, the reagent for detecting methylation of the SDC2 gene comprises a capture probe selected from the group consisting of: SEQ ID NO. 7, SEQ ID NO. 102 and SEQ ID NO. 103, preferably SEQ ID NO. 7.
However, it is to be noted that the capture probe of the present invention is not limited to those described above. Since both NeuroG1 gene and SDC2 gene are known. The person skilled in the art can design suitable capture probes on the basis of known genes and with reference to the above-mentioned capture probes without undue effort.
In addition, it should be noted that capture probes are not necessary. In samples such as tissue, blood, plasma, serum, etc., the capture probe may not be used. In order to obtain desired DNA by avoiding the interference factors as much as possible in a complicated sample such as a fecal sample, it is preferable to perform the above function using a capture probe in the step of extracting DNA from the fecal sample.
In a preferred embodiment, the reagent for detecting methylation of NeuroG1 gene comprises a detection probe selected from the group consisting of: SEQ ID NO. 11, SEQ ID NO. 33, SEQ ID NO. 36, SEQ ID NO. 39, SEQ ID NO. 42, SEQ ID NO. 45, SEQ ID NO. 48, SEQ ID NO. 51 and SEQ ID NO. 54, preferably SEQ ID NO. 11.
In a preferred embodiment, the reagent for detecting methylation of the SDC2 gene comprises a detection probe selected from the group consisting of: SEQ ID NO. 10, SEQ ID NO. 57 and SEQ ID NO: 60, preferably SEQ ID NO: 10.
However, it is to be noted that the detection probe of the present invention is not limited to those described above. Since both NeuroG1 gene and SDC2 gene are known. Those skilled in the art can design an appropriate detection probe based on a known gene and with reference to the above detection probes without undue effort.
In a preferred embodiment, the kit is for detecting methylation of NeuroG1 and SDC2 genes in a sample, preferably a tissue sample, preferably intestinal tissue, or feces, preferably stool, from a subject.
In a preferred embodiment, the kit is for detecting methylation of NeuroG1 and SDC2 genes in a sample, preferably a body fluid, preferably blood, sputum, urine or saliva, from a subject.
In another aspect, the invention provides the use of reagents for detecting methylation of the NeuroG1 gene and reagents for detecting methylation of the SDC2 gene in the manufacture of a kit for the detection of cancer, preferably colorectal cancer, and/or a pre-cancerous lesion, which is an Advanced Adenoma (AA).
In a further aspect, the present invention provides the use of the above primer pair, capture probe or detection probe in the preparation of a methylation detection reagent or kit, or a kit for detecting a cancer, preferably colorectal cancer, and/or a precancerous lesion, which is an Advanced Adenoma (AA).
In addition, the present invention provides a method of detecting cancer and/or precancerous lesions, the method comprising (a) detecting NeuroG1 gene methylation in a sample from a subject, and (b) detecting SDC2 gene methylation in the sample; the two steps are not in sequence, and can be carried out simultaneously or sequentially.
Wherein (a) detecting NeuroG1 gene methylation in a sample from a subject, and (b) detecting SDC2 gene methylation in the sample, can be performed according to a probe method or a dye method. From the viewpoint of specificity and accuracy, it is preferably carried out according to a probe method,
preferably, the cancer is colorectal cancer and the precancerous lesion is an Advanced Adenoma (AA).
More specifically, the present invention is to provide a novel,
1. the invention aims to provide a cancer detection reagent and a kit with strong specificity and high sensitivity, particularly colorectal tumors, more particularly Advanced Adenomas (AA), and detection genes are NeuroG1 and SDC2 genes;
2. another object of the present invention is to provide a detection segment that can be used for colorectal tumor early screening and diagnosis assistance in methylation detection of NeuroG1 and SDC2 genes;
3. the invention also aims to provide a series of primers and probes for detecting the detection sections and application of the primers and probes in preparing a reagent or a kit for detecting colorectal tumors.
4. Another object of the present invention is to provide a series of capture sequences for capturing the above detection segments, and the use thereof in the preparation of a reagent or a kit for detecting colorectal tumor.
5. It is also an object of the present invention to provide a method for detecting cancer, in particular colorectal cancer and precancerous lesions, more particularly Advanced Adenomas (AA), by combined detection of methylation of NeuroG1 and SDC2 genes.
In some embodiments of the invention, the methylation detection reagents provided herein comprise capture sequences, primers and/or probes obtained for CpG islands in or near the promoter region of each gene in the NeuroG1 and SDC2 gene combination. In general, a CpG island refers to some regions rich in CpG dinucleotides, and usually located in a promoter and its vicinity, and a CpG island in the present invention refers to not only a promoter and its vicinity rich in CpG dinucleotides, but also includes hybrid methylated CpG sites or isolated CpG sites.
The "neuroG 1" in the present invention is also called "neuroD 3 or neurogenin1 or neuroG1N 1". Located on chromosome 5 of the human genome.
The "detection" in the present invention is the same as the diagnosis, and includes the diagnosis of colorectal tumor in the middle and late stages, and also includes the detection of colorectal advanced adenoma. Among them, the early diagnosis means that the risk of intestinal cancer is indicated before cancer is found before metastasis of intestinal cancer cells, and even before the intestinal cancer cells become cancerous, preferably before morphological changes of tissues or cells are observed.
The combined methylation detection reagent of the neuroG1 and SDC2 genes can be a methylation detection reagent in the prior art. In the prior art, there are several methods for detecting methylation of a gene of interest, such as methylation specific PCR (msp), methylation specific quantitative PCR (qmsp), PCR of methylated DNA specific binding proteins, quantitative PCR and DNA chips, methylation sensitive restriction enzymes, bisulfite sequencing or pyrosequencing, etc. Each assay method has its corresponding reagents, which can be used in the present invention to detect methylation of the combination of the NeuroG1 and SDC2 genes.
In some embodiments of the invention, the kits provided herein further comprise reagents commonly used in kits, such as a conversion reagent commonly used in qMSP, for converting unmethylated cytosine bases to uracil, while methylated cytosine bases remain unchanged. The conversion agent is not particularly limited, and any agent capable of converting cytosine into uracil reported in the prior art may be, for example, one or more of hydrazine salt, bisulfite and bisulfite (e.g., sodium metabisulfite, potassium bisulfite, cesium bisulfite, ammonium bisulfite, etc.). And DNA polymerase, dNTPs, Mg2+ ions, buffer and the like which are commonly used in the amplification of the NeuroG1 gene.
The invention also provides the application of the methylation detection reagent, the kit, the capture sequence, the primer and the probe in the preparation of a methylation detection reagent or kit or a reagent or kit for detecting cancer, particularly colorectal tumor.
The invention also provides the application of the methylation detection reagent, the kit, the capture sequence, the primer and the probe in methylation detection or in cancer detection, particularly colorectal tumor detection.
In some embodiments of the invention, the tissue of the invention is intestinal tissue.
In some embodiments of the invention, the fecal material is stool and the bodily fluid is blood, sputum, urine, or saliva.
Compared with the existing marker for detecting the intestinal cancer, the primer, the capture reagent, the nucleic acid probe, the neuroG1 and SDC2 gene combination and the technical scheme provided by the invention can detect the colorectal cancer with extremely high sensitivity and specificity, the detection sensitivity of the technical scheme of the invention on the colorectal cancer is 97.8%, the sensitivity on the advanced adenoma is 89.5%, the specificity is 82.2%, the positive prediction value is 90.59%, and the negative prediction value is 88.09%. The method specifically comprises the following points:
1. according to the technical scheme, combined detection is carried out on methylation of the NeuroG1 and SDC2 gene combination, the method can realize combined detection on multiple genes, the complexity of the test is greatly reduced, and the detection efficiency is improved.
2. According to the invention, the methylation detection reagent of the combination of the neuroG1 and the SDC2 genes can detect 97.8% of colorectal cancer and 89.5% of advanced adenoma in a stool sample when the specificity is 82.2%, and the colorectal cancer can be reliably diagnosed only by taking the stool as a detection sample. The fecal sample is very easy to obtain, the sampling is noninvasive and simple, and the pain and inconvenience of the patient can not be caused. The invention can improve the negative prediction value and greatly improve the total coincidence rate.
3. The technical scheme comprises the methylation detection reagent containing the NeuroG1 and SDC2 gene combination, the extraction detection method can conveniently and accurately judge the high risk (colorectal cancer and advanced adenoma) and the low risk (non-advanced adenoma and healthy people) of colorectal cancer, and the methylation detection reagent of the gene combination is expected to be used for a fecal gene detection kit and serves for clinical detection of intestinal cancer.
4. The reagent/kit in the technical scheme detects and diagnoses cancer through methylation level, more and more researches prove that methylation change is an early event in the tumorigenesis process, and early lesions are more easily discovered by detecting methylation abnormality.
Drawings
FIG. 1 shows a scatter plot of Ct values for SDC2 paraffin tissue detection
Detailed Description
The technical solutions of the present invention are further illustrated by the following specific examples, which do not represent limitations to the scope of the present invention. Insubstantial modifications and adaptations of the present invention by others of the concepts fall within the scope of the invention.
Example 1
NeuroG1 and SDC2 genes are screened with colorectal cancer related promoter regions.
NeuroG1 and SDC2 gene sequences are downloaded from NCBI websites (https:// www.ncbi.nlm.nih.gov /), MethPrimer is used for analyzing CpG island concentrated areas, amplification primers are respectively designed aiming at the areas, paraffin tissue samples of patients with colorectal cancer, advanced adenoma and non-advanced adenoma are amplified, amplicons are sent to Suzhou Jinzhi biotechnology limited for sequencing, sequencing primers and amplicons are shown in Table 1, and colorectal cancer related promoter areas are screened.
Sequencing results show that the colorectal cancer samples have the following correlated sites with methylation sequences of neuroG1 and SDC2 genes:
NeuroG1-i DNA sequence:
GTAGGTGAAGTCTTmCGGAGGmCGGCTGGGCTACTGGGGTCAGAGAGmCGGGGAGGmCGGmCGGmCGGCACCTGAGCCCCAGGACTCmCGmCGTmCGCTGGmCGGGGCTTGGGGGACmCGGGCAGGCAGGGGAmCGCACTGmCGGmCGGCAGGAGGmCGCTCCmCGGGCACmCGCCTCmCGGGCAGCCCTTGATCmCGCCAGGmCGCAGTGTCTmCGGCCAGAGCCCAGATGTAGTTGTAGGmCGAAGmCGCAGmCGTCTmCGATTTTGGTGAGCTTGGTGTmCGTmCGGGGAAmCGAGGGCAGCAmCGCTGmCGCAGTGmCGTCCAGGGCmCGmCGTTCAAGTTGTGCATGmCGGTTGmCGCTmCGmCGATmCGTTGGCCTTGAmCGmCGCmCGGCTCCTGmCGCAGmCGA(SEQIDNO:21)
neuroG1-II DNA sequence:
CmCGGCTCCTGmCGCAGmCGAGTGCAGCAGmCGCCTmCGGAGmCGGACCmCGmCGTCmCGGCmCGmCGGmCGCmCGCmCGCCTCTCCTGCTmCGTmCGTCCTGTGCCCCTGGAACCTCAGAmCGCCmCGGGAGATATTGGGmCGmCGCCCCTGmCGGGCmCGGmCGmCGGGmCGGCCCmCGAAGmCGGAGGCTGCCTGTTGGAGTCTGGCACAGTCTTCCTmCGTmCGGTGAGGAAGCmCGGATAGGTCACTGCmCGCTGCTGCTGGmCGCAGTmCGAGGTmCGGAGATGCAGGTCTCAAGGmCGGGCTGGCATmCGTTGmCGCTGTGCAGGACmCGAmCGGACAGATAGAAAGGmCGCTCAGAGmCGCTGCAGCCmCGGACTGAGGGCAGAG(SEQIDNO:22)
NeuroG1-IIIDNA sequence:
ACAmCGACTGGCCTCAGGACCCCTTAAGTACCmCGGmCGCAACAATGGGmCGCCCCCCTCCCTTGCCACCTCmCGCCCCmCGmCGGCAGCCmCGGGTGAATGGAGmCGAGGmCGGCAGGTCATCCCmCGTGCAGmCGCCmCGGGTATTTGCATAATTTATGCTmCGmCGGGAGGCmCGCCATmCGCCCCTCCCCCAACCmCGGAGTGTGCCmCGTAATTACmCGCmCGGCCAATmCGGmCGGmCGTmCGmCGmCGGCCCmCGGGAGTmCGGCTmCGGGCTAAGCTGGCCAGGGmCGTCTCCAGGCAGTGAAACAGAGGmCGGGGTmCGGmCGGGmCGATTAGmCGGCmCGAGGCAmCGCTCCTCTTGGGGmCGGGCTGGGmCGCCCCTmCGCTGGGGTGGGAmCG(SEQIDNO:13)
SDC2-I DNA sequence:
ACCAGAAACTGAACCTmCGGCAmCGGGAAAGGAGTCmCGmCGGAGGAGCAAAACCACAGCAGAGCAAGAAGAGCTTCAGAGAGCAGCCTTCCmCGGAGCACCAACTCmCGTGTmCGGGAGTGCAGAAACCAACAAGTGAGAGGGmCGCmCGmCGTTCCmCGGGGmCGCAGCTGmCGGGmCGGmCGGGAGCAGGmCGCAGGAGGAGGAAGmCGAGmCGCCCCmCGAGCCCmCGAGCCmCGAGTCCCmCGAGCCTGAGCmCGCAATmCGCTGmCGGTACTCTGCTCmCGGATTmCGTGTGmCGmCGGGCTGmCGCmCGAGmCGCTGGGCAGGAGGCTTmCGTTTTGCCCTGGTTGCAAGCAGmCGGCTGGGAGCAGCmCGGTCCCTGGGGAATATGmCGGmCGmCGmCGTGGATCCTGCTCACCTTGGGCTTGGTGGCCTGmCGTGTmCGGmCGGAGTmCGAGAGCAGAGCTGACATCTGAT(SEQIDNO:17)
remarking:mCG indicates that the C of the CpG island is methylated.
TABLE 1
Remarking: in the name of the oligonucleotide, F refers to Forward primer, i.e., upstream primer; r refers to Reverse primer, namely downstream primer.
Example 2
According to the screened area, a kit for auxiliary diagnosis of colorectal cancer or intestinal advanced adenoma is designed, which comprises a detection reagent for detecting the methylation state or level of the colorectal cancer related gene, wherein the colorectal cancer related gene is neuroG1 gene and SDC2 gene.
The neuroG1 gene detection target region is selected from any one or combination of the following segments: segment A, segment B, and segment C. The three segments are respectively selected from the complete DNA sequence of neuroG1-I, neuroG1-II and neuroG1-III and the complementary sequence thereof.
The detection target region of the SDC2 gene is selected from the whole DNA sequence of SDC2-I and the complementary sequence thereof.
Example 3
The kit for auxiliary diagnosis of colorectal cancer or intestinal advanced adenoma provided in this example is substantially the same as in example 2, except that in this example, the selected region in example 2 is further selected as follows:
segment A is selected from the group consisting of the partial DNA sequence of NeuroG1-I and its complement. In particular, the method comprises the following steps of,
segment A1 is selected from NeuroG 1-I: 56-114
Segment A2 is selected from NeuroG 1-I: 151-227
Segment A3 is selected from NeuroG 1-I: 254-320
Segment B is selected from the group consisting of the DNA partial sequence of NeuroG1-II and its complement. In particular, the method comprises the following steps of,
segment B1 is selected from NeuroG 1-II: 91-170
Segment B2 is selected from NeuroG 1-II: 206-275
Segment B3 is selected from NeuroG 1-II: 273-344
Segment C is selected from the group consisting of the DNA partial sequence of NeuroG1-III and its complement. In particular, the method comprises the following steps of,
segment C1 is selected from NeuroG 1-III: 22-95
Segment C2 is selected from NeuroG 1-III: 84-150
Segment C3 is selected from NeuroG 1-III: 160-222
Segment D is selected from the DNA partial sequence of SDC2 and its complement. In particular, the method comprises the following steps of,
section D1 is selected from SDC 2-I: 141-194
Section D2 is selected from SDC 2-I: 183-256
Section D3 is selected from SDC 2-I: 259-326
Further, the kit of this embodiment further includes a primer pair and a fluorescent probe for detecting each of the above target regions, and the specific sequences are shown in table 2 below.
TABLE 2
Remarking: in the name of the oligonucleotide, F refers to forwardmer, namely an upstream primer; r refers to Reverse primer, namely a downstream primer needle.
Example 4
A method for auxiliary diagnosis of colorectal cancer or colorectal-progressing adenoma using the kit of examples 2-3, as follows:
DNA extraction:
a. tissue sample:
using a commercial kit: DNA is extracted by adopting a radix et rhizoma Helminthostachydis Zeylanicae tissue extraction kit, and 1ug of DNA is taken for vulcanization treatment after the concentration is determined.
b. Blood sample:
using a commercial kit: 2mL of plasma samples, cfDNA was extracted using QIAampDNA Blood Mini Kit (cat # 51104) according to the instructions.
c. Stool sample:
the treatment was carried out according to the procedure of example 2 of patent CN 110699427A.
d. Urine sample:
using a commercial kit: the initial 4mL urine, first 3500rpm centrifugal 20 minutes, discarded the supernatant, retained the sediment. The urinary sediment was resuspended in 500ul urine rinse, centrifuged at 3500rpm for 10 minutes, the supernatant was discarded, and then resuspended in 500ul urine rinse, and DNA was extracted using Tiangen commercial kit (blood/tissue/cell genome extraction kit, cat # DP304-02), following the instructions.
DNA sulfuration transformation:
using a commercial kit: ZYMO (EZ DNA Methylation Gold kit), and DNA fragments were purified by sulfurization according to the protocol.
PCR detection
(1) A detection system: see Table 3 below
TABLE 3
(2) And (3) PCR reaction conditions: table 4 below shows
TABLE 4
The instrument used was a Roche LightCycler 480 II.
And (4) interpretation of results: for the same sample, when the NeuroG1 and the SDC2 respectively adopt joint inspection of any one or more regions:
if the Ct value of each gene is less than or equal to the CutOff value, the sample is judged to be positive; if the Ct value of each gene is larger than the CutOff value or not amplified, the sample is judged to be negative;
if any detection area of each gene is positive, the sample is judged to be positive; if all the detection areas of each gene are negative, the sample is judged to be negative;
if any gene is positive, the sample is positive; if both genes are negative, the sample is negative.
Example 5 differences in colorectal cancer diagnostic Effect of different detection regions of NeuroG1
Sample type: 45 tissue samples with clinical diagnostic results, 15 each of colorectal cancer (CRC), advanced adenoma (AA: diameter > 10mm or containing villous components or having severe dysplasia or high grade intraepithelial neoplasia) and non-advanced adenoma (NAA) paraffin tissue.
The test method comprises the following steps: using the kit provided in example 3, the method provided in example 4 was used to perform the assay, wherein primers and probes for detecting NeuroG1-I, NeuroG1-II, and NeuroG1-III are shown in Table 2 of example 3.
The experimental results are as follows: as shown in tables 5 and 6 below (number of detected sections/total number), the detection effects of the sections are relatively close, and the detection effects of a1, a2, B2, B3, C1 and C3 are particularly excellent.
TABLE 5
TABLE 6 NeuroG1 information on paraffin tissue samples
Example 6 differences in the diagnostic efficacy of different test areas of SDC2 on colorectal cancer and its advanced adenomas
Sample type: 30 tissue samples with clinical diagnostic results, 10 of CRC, AA and NAA paraffin tissues each.
The test method comprises the following steps: the kit provided in example 2 was used to perform the assay using the method provided in example 4, wherein the primers and probes for detecting SDC2-I, SDC2-II, and SDC2-III are shown in Table 2 of example 3.
The experimental results are as follows: as shown in table 7 below, fig. 1: the result of the scatter diagram shows that when equal amount of methylated DNA is added for detection, the difference between the Ct value detected by the CRC and AA paraffin tissue samples and the Ct value detected by the NAA paraffin tissue samples is obvious (p is less than 0.05), and the effect of each section in the D detection area is basically consistent.
TABLE 7 SDC2 detection of Paraffin tissue sample information
Example 7, NeuroG1 and SDC2 different test areas in combination with differences in the diagnostic effect of colorectal cancer and its progressive adenoma
Test 1: test effect on fecal samples
Sample type: 127 stool samples with clinical diagnostic results, of which 44 CRC, 38 AA and 21 NAA, 24 healthy people were all confirmed by enteroscopy or pathology.
The test method comprises the following steps: the kit provided in example 2 was used to perform the detection using the method provided in example 4, wherein the primers and probes for detecting NeuroG1 and SDC2 are shown in table 2 in example 3, and the capture probes are shown in table 8 below.
TABLE 8
Remarking: capure in the oligonucleotide name refers to the capture probe.
The results are shown in tables 9-13 below.
As shown in table 9, in the case of comprehensive analysis of the total coincidence rate, the positive predictive value and the negative predictive value, C1 and D2 were the best amplicons in the detection of each segment of the NeuroG1 and SDC2 genes, respectively, and the total coincidence rate was 73.23% and 80.31%, respectively, although the positive predictive values both exceeded 90%, but the negative predictive value was only 58.21% and 66.13%.
In order to improve the coincidence rate of the detection result and clinic, the amplicons of the double genes are combined in pairs, and the results show that the detection sensitivity of the combination of C1D2, B3D2, B1D2, C3D2, A2D2, C1D3, C1D1, B3D3, B3D1, C3D3, B1D3, C3D1 and B1D1 exceeds 90%, the specificity exceeds 80%, the positive predicted value 89.16-90.59%, the negative predicted value 81.81-88.09%, the total coincidence rate is 86.61-89.76%, and the detection result is superior to any detection section.
TABLE 9, NeuroG1 and SDC2 stool samples tested individually, combined test results for each segment
TABLE 11 advanced adenoma stool sample information
Test 2: test effect on blood samples
Sample type: selecting plasma samples of 30 CRC patients and plasma samples of 30 healthy people (all confirmed by enteroscopy or pathology), treating plasma by using a kit to extract DNA, vulcanizing by using a ZYMO kit, operating according to the following technical scheme,
the test method comprises the following steps: the kit provided in example 2 was used to perform the detection using the method provided in example 4, wherein the detection primers and probes were the same as those in example 4, and the detection combination was C1D 2.
The results are shown in table 14, and the combined detection of NeuroG1 and SDC2 gene methylation has high CRC sensitivity of 86.6% and specificity of 83.3% for healthy people.
TABLE 14 plasma sample test results
Test 3: test effect on urine samples
Sample type: 85 urine samples with clinical diagnosis results, wherein the CRC30 cases, the AA 22 cases, the NAA 18 cases and the healthy people 15 cases are confirmed by enteroscopy or pathology.
The test method comprises the following steps: the kit provided in example 2 was used to perform the detection using the method provided in example 4, wherein the detection primers and probes were the same as those in example 4, and the detection combination was C1D 2.
The results are shown in table 15, the combined detection of NeuroG1 and SDC2 gene methylation showed a CRC sensitivity of up to 90%, an AA sensitivity of 81.8%, specificity for NAA and healthy persons of 88.9% and 93.8%, respectively, and a total specificity of 90.9%.
TABLE 15 urine sample test results
Example 8 detection Effect of different primer pairs in amplification target region
Sample type: 30 tissue samples with clinical diagnosis results, 10 of the three tissues CRC, AA and NAA.
The test method comprises the following steps: the kit provided in example 2 was used to perform the detection using the method provided in example 4, wherein the detection primers and probes are shown in Table 16 below.
The detection results of the different primers of the selected gene detection region are similar and the effect difference is not large (Table 17).
TABLE 16
Remarking: in the name of the oligonucleotide, F refers to Forward primer, i.e., upstream primer; r refers to Reverse primer, namely downstream primer; p refers to Probe, i.e., a Probe.
TABLE 17
Example 9 evaluation of Capture Effect of different Capture probes in amplified target region
Sample type: 10 stool samples of CRC patients with clinical diagnosis results.
The test method comprises the following steps: the kit provided in example 2 was used to perform the assay using the method provided in example 4, wherein the capture probes are shown in table 18 below.
The results are shown in Table 19, which shows that the capture probes of C1-C1 and D2-1 are effective, and the Ct values are advanced by 1-2.
Watch 18
Watch 19
Numbering
C1-c1
C1-c2
C1-c3
C1-c4
D2-c1
D2-c2
D2-c3
D2-c4
CRC01
31.59
31.43
33.39
34.32
31.32
32.84
33.64
33.65
CRC02
38.18
39.17
40.98
39.12
34.11
35.88
35.96
36.97
CRC03
Does not amplify
Does not amplify
Does not amplify
Does not amplify
34.88
35.82
36.34
35.69
CRC04
Does not amplify
Does not amplify
Does not amplify
Does not amplify
31.59
33.58
32.23
32.21
CRC05
32.29
33.82
34.72
33.83
26.03
28.38
28.47
28.69
CRC06
38.65
40.38
40.12
40.96
32.05
34.14
34.97
34.07
CRC07
34.74
36.81
35.84
36.21
27.87
29.30
28.27
28.08
CRC08
Does not amplify
Does not amplify
Does not amplify
Does not amplify
31.91
32.47
33.30
33.30
CRC09
35.32
36.85
37.08
36.47
30.01
32.95
31.85
32.99
CRC10
Does not amplify
Does not amplify
Does not amplify
Does not amplify
29.27
30.36
31.24
30.78
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be construed as the protection scope of the present invention.
Sequence listing
<110> Jiangsu is the real biological medicine technology corporation
Suzhou premide medical laboratory Co.,Ltd.
<120> a kit for detecting cancer and/or precancerous lesions
<130> GAI20CN7603
<160> 104
<170> SIPOSequenceListing 1.0
<210> 1
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> primer
<400> 1
ggaggaggaa gcgagcg 17
<210> 2
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> primer
<400> 2
caaaataccg caacgattac g 21
<210> 3
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> primer
<400> 3
tcgtgtagcg ttcgggt 17
<210> 4
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> primer
<400> 4
cactccgaat taaaaaaaaa acg 23
<210> 5
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> primer
<400> 5
gtgatggagg aggtttagta agtt 24
<210> 6
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> primer
<400> 6
ccaataaaac ctactcctcc cttaa 25
<210> 7
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Capture Probe
<400> 7
ttgcggctca ggctcgggga ctcgggctc 29
<210> 8
<211> 46
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Capture Probe
<400> 8
actccgggtt gggggagggg cgatggcggc ctcccgcgag cataaa 46
<210> 9
<211> 41
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Capture Probe
<400> 9
ggttcacagt ccagaagact tgctgagcct cctccatcac c 41
<210> 10
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> detection Probe
<400> 10
caaactcgaa aactcgaact cgaaa 25
<210> 11
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> detection Probe
<400> 11
acgacctccc gcgaacata 19
<210> 12
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> detection Probe
<400> 12
accaccaccc aacacacaat aacaaacaca 30
<210> 13
<211> 363
<212> DNA
<213> Intelligent (Homo sapiens)
<220>
<223> NeuroG1DNA plus strand sequence
<400> 13
acacgactgg cctcaggacc ccttaagtac ccggcgcaac aatgggcgcc cccctccctt 60
gccacctccg cccccgcggc agcccgggtg aatggagcga ggcggcaggt catccccgtg 120
cagcgcccgg gtatttgcat aatttatgct cgcgggaggc cgccatcgcc cctcccccaa 180
cccggagtgt gcccgtaatt accgccggcc aatcggcggc gtcgcgcggc cccgggagtc 240
ggctcgggct aagctggcca gggcgtctcc aggcagtgaa acagaggcgg ggtcggcggg 300
cgattagcgg ccgaggcacg ctcctcttgg ggcgggctgg gcgcccctcg ctggggtggg 360
acg 363
<210> 14
<211> 328
<212> DNA
<213> Intelligent (Homo sapiens)
<220>
<223> NeuroG1 plus strand methylated sequence
<400> 14
ttcggcgtaa taatgggcgt tttttttttt tgttattttc gttttcgcgg tagttcgggt 60
gaatggagcg aggcggtagg ttattttcgt gtagcgttcg ggtatttgta taatttatgt 120
tcgcgggagg tcgttatcgt ttttttttta attcggagtg tgttcgtaat tatcgtcggt 180
taatcggcgg cgtcgcgcgg tttcgggagt cggttcgggt taagttggtt agggcgtttt 240
taggtagtga aatagaggcg gggtcggcgg gcgattagcg gtcgaggtac gttttttttg 300
gggcgggttg ggcgtttttc gttggggt 328
<210> 15
<211> 363
<212> DNA
<213> Intelligent (Homo sapiens)
<220>
<223> NeuroG1DNA reverse strand sequence
<400> 15
cgtcccaccc cagcgagggg cgcccagccc gccccaagag gagcgtgcct cggccgctaa 60
tcgcccgccg accccgcctc tgtttcactg cctggagacg ccctggccag cttagcccga 120
gccgactccc ggggccgcgc gacgccgccg attggccggc ggtaattacg ggcacactcc 180
gggttggggg aggggcgatg gcggcctccc gcgagcataa attatgcaaa tacccgggcg 240
ctgcacgggg atgacctgcc gcctcgctcc attcacccgg gctgccgcgg gggcggaggt 300
ggcaagggag gggggcgccc attgttgcgc cgggtactta aggggtcctg aggccagtcg 360
tgt 363
<210> 16
<211> 363
<212> DNA
<213> Intelligent (Homo sapiens)
<220>
<223> neurog1 reverse strand methylation sequence
<400> 16
cgttttattt tagcgagggg cgtttagttc gttttaagag gagcgtgttt cggtcgttaa 60
tcgttcgtcg atttcgtttt tgttttattg tttggagacg ttttggttag tttagttcga 120
gtcgattttc ggggtcgcgc gacgtcgtcg attggtcggc ggtaattacg ggtatatttc 180
gggttggggg aggggcgatg gcggtttttc gcgagtataa attatgtaaa tattcgggcg 240
ttgtacgggg atgatttgtc gtttcgtttt atttattcgg gttgtcgcgg gggcggaggt 300
ggtaagggag gggggcgttt attgttgcgt cgggtattta aggggttttg aggttagtcg 360
tgt 363
<210> 17
<211> 437
<212> DNA
<213> Intelligent (Homo sapiens)
<220>
<223> sdc2 dna sequence
<400> 17
accagaaact gaacctcggc acgggaaagg agtccgcgga ggagcaaaac cacagcagag 60
caagaagagc ttcagagagc agccttcccg gagcaccaac tccgtgtcgg gagtgcagaa 120
accaacaagt gagagggcgc cgcgttcccg gggcgcagct gcgggcggcg ggagcaggcg 180
caggaggagg aagcgagcgc ccccgagccc cgagcccgag tccccgagcc tgagccgcaa 240
tcgctgcggt actctgctcc ggattcgtgt gcgcgggctg cgccgagcgc tgggcaggag 300
gcttcgtttt gccctggttg caagcagcgg ctgggagcag ccggtccctg gggaatatgc 360
ggcgcgcgtg gatcctgctc accttgggct tggtggcctg cgtgtcggcg gagtcgagag 420
cagagctgac atctgat 437
<210> 18
<211> 437
<212> DNA
<213> Intelligent (Homo sapiens)
<220>
<223> scdc 2 methylation sequence
<400> 18
attagaaatt gaatttcggt acgggaaagg agttcgcgga ggagtaaaat tatagtagag 60
taagaagagt tttagagagt agttttttcg gagtattaat ttcgtgtcgg gagtgtagaa 120
attaataagt gagagggcgt cgcgttttcg gggcgtagtt gcgggcggcg ggagtaggcg 180
taggaggagg aagcgagcgt tttcgagttt cgagttcgag ttttcgagtt tgagtcgtaa 240
tcgttgcggt attttgtttc ggattcgtgt gcgcgggttg cgtcgagcgt tgggtaggag 300
gtttcgtttt gttttggttg taagtagcgg ttgggagtag tcggtttttg gggaatatgc 360
ggcgcgcgtg gattttgttt attttgggtt tggtggtttg cgtgtcggcg gagtcgagag 420
tagagttgat atttgat 437
<210> 19
<211> 88
<212> DNA
<213> Intelligent (Homo sapiens)
<220>
<223> NeuroG1DNA sequence fragment
<400> 19
cgtgcagcgc ccgggtattt gcataattta tgctcgcggg aggccgccat cgcccctccc 60
ccaacccgga gtgtgcccgt aattaccg 88
<210> 20
<211> 70
<212> DNA
<213> Intelligent (Homo sapiens)
<220>
<223> SDC2 DNA sequence fragment
<400> 20
gaggaagcga gcgcccccga gccccgagcc cgagtccccg agcctgagcc gcaatcgctg 60
cggtactctg 70
<210> 21
<211> 369
<212> DNA
<213> Intelligent (Homo sapiens)
<220>
<223> NeuroG1-I DNA sequence
<400> 21
gtaggtgaag tcttcggagg cggctgggct actggggtca gagagcgggg aggcggcggc 60
ggcacctgag ccccaggact ccgcgtcgct ggcggggctt gggggaccgg gcaggcaggg 120
gacgcactgc ggcggcagga ggcgctcccg ggcaccgcct ccgggcagcc cttgatccgc 180
caggcgcagt gtctcggcca gagcccagat gtagttgtag gcgaagcgca gcgtctcgat 240
tttggtgagc ttggtgtcgt cggggaacga gggcagcacg ctgcgcagtg cgtccagggc 300
cgcgttcaag ttgtgcatgc ggttgcgctc gcgatcgttg gccttgacgc gccggctcct 360
gcgcagcga 369
<210> 22
<211> 351
<212> DNA
<213> Intelligent (Homo sapiens)
<220>
<223> neurog1-II dna sequence
<400> 22
ccggctcctg cgcagcgagt gcagcagcgc ctcggagcgg acccgcgtcc ggccgcggcg 60
ccgccgcctc tcctgctcgt cgtcctgtgc ccctggaacc tcagacgccc gggagatatt 120
gggcgcgccc ctgcgggccg gcgcgggcgg ccccgaagcg gaggctgcct gttggagtct 180
ggcacagtct tcctcgtcgg tgaggaagcc ggataggtca ctgccgctgc tgctggcgca 240
gtcgaggtcg gagatgcagg tctcaaggcg ggctggcatc gttgcgctgt gcaggaccga 300
cggacagata gaaaggcgct cagagcgctg cagcccggac tgagggcaga g 351
<210> 23
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Forward primer
<400> 23
agttttcgga ggcggttg 18
<210> 24
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> reverse primer
<400> 24
tcgctacgca aaaaccga 18
<210> 25
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Forward primer
<400> 25
tcggtttttg cgtagcga 18
<210> 26
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> reverse primer
<400> 26
caatccgaac tacaacgctc ta 22
<210> 27
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Forward primer
<400> 27
gagcgaggcg gtaggtta 18
<210> 28
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> reverse primer
<400> 28
tacctcgacc gctaatc 17
<210> 29
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Forward primer
<400> 29
ttagaaattg aatttcggta cgg 23
<210> 30
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> reverse primer
<400> 30
atcaaatatc aactctactc tcgactc 27
<210> 31
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Forward primer
<400> 31
gcggcggtat ttgagtttt 19
<210> 32
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> reverse primer
<400> 32
ctacccgatc ccccaaac 18
<210> 33
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> detection Probe
<400> 33
cgccaacgac gcgaaatc 18
<210> 34
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Forward primer
<400> 34
ggtatcgttt tcgggtagtt 20
<210> 35
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> reverse primer
<400> 35
gcttcgccta caactacatc t 21
<210> 36
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> detection Probe
<400> 36
cgaaacacta cgcctaacga at 22
<210> 37
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Forward primer
<400> 37
gtgtcgtcgg ggaacgag 18
<210> 38
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> reverse primer
<400> 38
gcatacacaa cttaaacgcg 20
<210> 39
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> detection Probe
<400> 39
aacgcactac gcaacgtac 19
<210> 40
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Forward primer
<400> 40
ttttggaatt ttagacgttc gg 22
<210> 41
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> reverse primer
<400> 41
aaacaacctc cgcttcgaa 19
<210> 42
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> detection Probe
<400> 42
cgcaaaaacg cgcccaat 18
<210> 43
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Forward primer
<400> 43
aagtcggata ggttattgtc gt 22
<210> 44
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> reverse primer
<400> 44
caacccgcct taaaacct 18
<210> 45
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> detection Probe
<400> 45
tccgacctcg actacgcca 19
<210> 46
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Forward primer
<400> 46
ttggtatcgt tgcgttgtgt a 21
<210> 47
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> reverse primer
<400> 47
tcaatccgaa ctacaacgct c 21
<210> 48
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> detection Probe
<400> 48
acgcctttct atctatccgt cgat 24
<210> 49
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Forward primer
<400> 49
taattcggag tgtgttcgta att 23
<210> 50
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> reverse primer
<400> 50
aaccgactcc cgaaacc 17
<210> 51
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> detection Probe
<400> 51
ccgccgatta accgacgat 19
<210> 52
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Forward primer
<400> 52
ttggttaggg cgtttttag 19
<210> 53
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> reverse primer
<400> 53
cctcgaccgc taatcgc 17
<210> 54
<211> 16
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> detection Probe
<400> 54
gccgaccccg cctcta 16
<210> 55
<211> 14
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Forward primer
<400> 55
cgcgttttcg gggc 14
<210> 56
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> reverse primer
<400> 56
gcttcctcct cctacgc 17
<210> 57
<211> 15
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> detection Probe
<400> 57
cgccgcccgc aacta 15
<210> 58
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Forward primer
<400> 58
tcggattcgt gtgcgcg 17
<210> 59
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> reverse primer
<400> 59
tacttacaac caaaacaaaa cg 22
<210> 60
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> detection Probe
<400> 60
acccaacgct cgacgca 17
<210> 61
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Forward primer
<400> 61
cgtgtagcgt tcgggtattt 20
<210> 62
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> reverse primer
<400> 62
aaccgacgat aattacgaac aca 23
<210> 63
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Forward primer
<400> 63
ttcgtgtagc gttcgggtat 20
<210> 64
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> reverse primer
<400> 64
cgataattac gaacacactc cgaat 25
<210> 65
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Forward primer
<400> 65
tcgtgtagcg ttcgggt 17
<210> 66
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> reverse primer
<400> 66
cgataattac gaacacactc cg 22
<210> 67
<211> 16
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Forward primer
<400> 67
cgtgtagcgt tcgggt 16
<210> 68
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> reverse primer
<400> 68
cgacgataat tacgaacaca ctc 23
<210> 69
<211> 16
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Forward primer
<400> 69
tcgtgtagcg ttcggg 16
<210> 70
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> reverse primer
<400> 70
cgattaaccg acgataatta cg 22
<210> 71
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> detection Probe
<400> 71
acgataacga cctcccgcga 20
<210> 72
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> detection Probe
<400> 72
tttatgttcg cgggaggtcg ttatcg 26
<210> 73
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> detection Probe
<400> 73
acgacctccc gcgaacata 19
<210> 74
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Forward primer
<400> 74
gaggaagcga gcgttttc 18
<210> 75
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> reverse primer
<400> 75
aaaataccgc aacgattacg a 21
<210> 76
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Forward primer
<400> 76
ggaagcgagc gttttcg 17
<210> 77
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> reverse primer
<400> 77
caaaataccg caacgattac g 21
<210> 78
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Forward primer
<400> 78
ggaagcgagc gttttcga 18
<210> 79
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> reverse primer
<400> 79
cgaaacaaaa taccgcaacg 20
<210> 80
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Forward primer
<400> 80
ggaggaggaa gcgagcg 17
<210> 81
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> reverse primer
<400> 81
gaatccgaaa caaaataccg c 21
<210> 82
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Forward primer
<400> 82
aagcgagcgt tttcgagt 18
<210> 83
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> reverse primer
<400> 83
aataccgcaa cgattacgac 20
<210> 84
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Forward primer
<400> 84
aagcgagcgt tttcgag 17
<210> 85
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> reverse primer
<400> 85
aaataccgca acgattacga c 21
<210> 86
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> detection Probe
<400> 86
caaactcgaa aactcgaact cgaaa 25
<210> 87
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> detection Probe
<400> 87
caaactcgaa aactcgaact cgaa 24
<210> 88
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> detection Probe
<400> 88
caaactcgaa aactcgaact cga 23
<210> 89
<211> 37
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Capture Probe
<400> 89
cactccgggt tgggggaggg gcgatggcgg cctcccg 37
<210> 90
<211> 33
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Capture Probe
<400> 90
gaggggcgat ggcggcctcc cgcgagcata aat 33
<210> 91
<211> 46
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Capture Probe
<400> 91
acgggcacac tccgggttgg gggaggggcg atggcggcct cccgcg 46
<210> 92
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Capture Probe
<400> 92
agtaccgcag cgattgcggc tcaggctcgg ggactcgggc tcg 43
<210> 93
<211> 36
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Capture Probe
<400> 93
ccgcagcgat tgcggctcag gctcggggac tcgggc 36
<210> 94
<211> 37
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Capture Probe
<400> 94
ccgccgcagt gcgtcccctg cctgcccggt cccccaa 37
<210> 95
<211> 46
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Capture Probe
<400> 95
agctcaccaa aatcgagacg ctgcgcttcg cctacaacta catctg 46
<210> 96
<211> 37
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Capture Probe
<400> 96
atcgcgagcg caaccgcatg cacaacttga acgcggc 37
<210> 97
<211> 48
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Capture Probe
<400> 97
gaagactgtg ccagactcca acaggcagcc tccgcttcgg ggccgccc 48
<210> 98
<211> 39
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Capture Probe
<400> 98
gtcctgcaca gcgcaacgat gccagcccgc cttgagacc 39
<210> 99
<211> 40
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Capture Probe
<400> 99
ctctgccctc agtccgggct gcagcgctct gagcgccttt 40
<210> 100
<211> 47
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 100
cgatggcggc ctcccgcgag cataaattat gcaaataccc gggcgct 47
<210> 101
<211> 48
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Capture Probe
<400> 101
gactcccggg gccgcgcgac gccgccgatt ggccggcggt aattacgg 48
<210> 102
<211> 34
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Capture Probe
<400> 102
ctcggggctc gggggcgctc gcttcctcct cctg 34
<210> 103
<211> 36
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Capture Probe
<400> 103
ccagccgctg cttgcaacca gggcaaaacg aagcct 36
<210> 104
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Capture Probe
<400> 104
ttgcggctca ggctcgggga ctcgggctc 29
- 上一篇：石墨接头机器人自动装卡簧、装栓机
- 下一篇：一种与肾细胞癌相关的环状RNA及其应用
