长链非编码rna pralr用于诊断肿瘤紫杉醇化疗耐药的应用

Application of long-chain non-coding RNA PRALR in diagnosis of tumor paclitaxel chemotherapy resistance

文档序号：3393 发布日期：2021-09-17 浏览：35次中文

1. The DNA with the sequence shown in SEQ ID NO. 18 or SEQ ID NO. 19 or lncRNA molecules obtained by the transcription of the DNA or the lncRNA molecules are used as biomarkers to prepare a tumor chemotherapy drug-resistant diagnosis kit.

2. The use of claim 1, wherein the tumor is ovarian or lung cancer.

3. The application of the reagent for detecting the content of DNA with a sequence shown in SEQ ID NO. 18 or SEQ ID NO. 19 or lncRNA molecules obtained by transcription of the DNA or the lncRNA molecules in a sample in preparing a tumor chemotherapy drug-resistant diagnostic kit.

4. The use of claim 1, wherein the tumor is ovarian or lung cancer.

5. The use according to claim 1, wherein the sample is blood, serum, plasma, urine, tumor tissue or exosomes thereof.

6. A kit for diagnosing tumor chemotherapy resistance is characterized by comprising DNA with a sequence shown in SEQ ID NO. 18 or SEQ ID NO. 19 in a detected sample or lncRNA molecules obtained by transcription of the DNA.

7. An lncRNA molecule transcribed from the DNA having the sequence shown in SEQ ID NO. 19.

8. Transcribing the DNA from the incrna molecule of claim 7.

Background

Ovarian cancer is one of the common malignant tumors of female reproductive organs, and the mortality rate of ovarian cancer is the first of all gynecological malignant tumors. At present, Paclitaxel (PTX) chemotherapy is a first-line treatment scheme for clinically treating advanced ovarian cancer, but the recurrence of ovarian cancer caused by chemotherapy resistance is still a problem which needs to be solved urgently in clinic.

lncRNA, long-chain non-coding RNA, is a generic name of RNA molecules with length over 200nt and basically without coding protein function, and is widely involved in physiological and pathological processes of organisms, including tumor development and chemotherapy resistance.

The UCSC database contains an incrna (TCONS _00013523) sequence, but only a partial sequence. The applicant discovers and names PRALR (primary ribonucleic acid) lncRNA molecules from an ovarian cancer taxol resistant cell line OV3R-PTX by using 5 '-RACE and 3' -RACE technologies from the earlier stage of the sequence TCONS _00013523, and further proves that the PRALR is novel ovarian cancer medicine resistance related lncRNA, the proliferation, migration and invasion capacities of the ovarian cancer taxol resistant cells are remarkably reduced after being knocked down, the PRALR can be used as a molecular target for reversing the ovarian cancer taxol resistance, and an inhibitor of the PRALR can be used as an effective medicine for treating the taxol resistant ovarian cancer. For this part of the study, the applicant filed three patent applications of CN110123828A (published japanese 2019.08.16), CN110129318A (published japanese 2019.08.16) and CN110129319A (published japanese 2019.08.16) in 2018. However, the lncRNA has not yet been studied enough in the tumor field, and has not been reported.

It is known that due to the presence of alternative splicing, multiple transcripts can be present in a gene, encoding different lncRNA molecules, exerting different biological effects. Therefore, the research of other transcripts of the PRALR gene is very necessary, which is of great significance for further exploring the relationship between PRALR and the occurrence and development of drug-resistant ovarian cancer and the molecular action mechanism, and is helpful for developing clinical treatment drugs and diagnostic kits.

Disclosure of Invention

The invention aims to provide a novel transcript of a paclitaxel drug resistance related long-chain non-coding RNA and application thereof aiming at the defects in the prior art.

In a first aspect, the invention provides an application of DNA with a sequence shown in SEQ ID NO. 18 or SEQ ID NO. 19 or lncRNA molecules obtained by transcription of the DNA or the lncRNA molecules as biomarkers in preparation of a tumor chemotherapy drug resistance diagnostic kit.

As a preferred example, the tumor is ovarian cancer or lung cancer.

In a second aspect, the invention provides an application of a reagent for detecting the content of DNA with a sequence shown in SEQ ID NO. 18 or SEQ ID NO. 19 or lncRNA molecules obtained by transcription of the DNA or the lncRNA molecules in a sample in preparation of a tumor chemotherapy drug-resistant diagnostic kit.

As a preferred example, the tumor is ovarian cancer or lung cancer.

As another preferable example, the sample is blood, serum, plasma, urine, tumor tissue or exosomes thereof.

In a third aspect, the invention provides a kit for diagnosing tumor chemotherapy resistance, which is characterized by comprising DNA with a sequence shown in SEQ ID NO. 18 or SEQ ID NO. 19 in a detected sample or lncRNA molecules obtained by transcription of the DNA.

In a fourth aspect, the present invention provides a lncRNA molecule, which is characterized in that it is transcribed from a DNA having the sequence shown in SEQ ID NO. 19.

In a fifth aspect, the invention provides DNA transcribed to give a lncRNA molecule as described above.

The invention has the advantages that:

the invention identifies a new transcript full-length sequence of lncRNA (TCONS _00013523) in ovarian cancer cells with paclitaxel resistance, and the sequence is named PRALR-alpha. By knocking out and over-expressing PRALR-alpha, the sensitivity of ovarian cancer cells to PTX is found to be increased or reduced, which indicates that PRALR-alpha is closely related to the paclitaxel resistance of the ovarian cancer cells. The lncRNA is found to be related to drug resistance of various tumors by qPCR, and the lncRNA is detected to have significant difference in PTX sensitive and drug resistant cells in ovarian cancer and lung cancer PTX drug resistant cell supernatant exosomes, so that the lncRNA can be used as a biomarker for diagnosing tumor chemotherapy resistance, for example, the lncRNA is detected by separating exosomes from clinical samples (blood, serum, plasma, urine, tumor tissues and the like) and is used for monitoring the chemotherapy resistance.

Drawings

FIG. 1: pPRALR- α -Bleo plasmid map.

FIG. 2: A. efficiency validation of knockout and overexpression of PRLAR-alpha cell lines; B. determination of IC of cells on PTX in overexpressing and knocking-out PRLAR-alpha cell lines₅₀The value is obtained.

FIG. 3: qPCR detection results for PRALR-alpha in PTX sensitive and resistant tumor cells. A. qPCR detection results of PRALR-alpha in PTX sensitive and drug resistant cells derived from lung cancer cell A549; B. qPCR assay results for PRALR-alpha in PTX sensitive and resistant cells derived from ovarian cancer cells OVCAR-3; C. qPCR assay of PRALR-alpha in PTX sensitive and resistant cells derived from ovarian cancer cells SK-OV-3 (. about.P < 0.01).

FIG. 4: qPCR assay of PRALR-alpha in exosomes secreted by PTX-sensitive and drug-resistant cells derived from OVCAR-3 in cultured ovarian cancer cells (.: P < 0.05).

Detailed Description

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures, for which specific conditions are not noted in the following examples, are generally performed according to conventional conditions such as those described in J. SammBruk et al, molecular cloning protocols, third edition, scientific Press, 2002, or according to the manufacturer's recommendations.

Example 1

1 Material

RNAiso Plus total RNA extraction reagent (Takara 9109);

RNA reverse transcription kit (ROCHE 04897030001);

SYBgreen method qPCR kit (ROCHE 04913914001);

the high fidelity enzyme PrimeSTAR Max DNA Polymerase (Takara R045A);

RACE 5’/3’Kit(TAKARA 634858)。

2 method

2.1 identification of the full Length sequence of the novel transcript of TCONS-00013523

2.1.15 'RACE and 3' RACE amplification primer design

Human lncRNA TCONS _00013523 sequences were downloaded from the UCSC database and nested PCR primers were designed for 5 'RACE and 3' RACE amplification, respectively. The amplification primers were synthesized by Cincisco Biotechnology, Inc., Suzhou, and the sequences of the primers are shown in Table 1.

TABLE 15 primer pair sequences for ` RACE and 3 ` RACE amplifications

2.1.25 'RACE and 3' RACE amplification and sequencing

See alsoRACE 5 '/3' Kit (TAKARA 634858) for amplification as briefly described below: firstly, fresh RNA is extracted from an ovarian cancer taxol resistant cell line OV3R-PTX by using an RNAioso Plus reagent, and then cDNA used for 5 'RACE and 3' RACE amplification is subjected to reverse transcription by using a reverse transcription primer in the kit. Next, 5 'RACE and 3' RACE full-length sequences were amplified in a high fidelity enzyme system using outer and inner primers and UPM primers. And finally, inserting the RACE amplified fragment into a linear pRACE vector carried by the kit by adopting an In-Fusion Cloning method In the kit, then selecting 8-10 clones for sequencing identification, finally determining the sequences of 5 'RACE and 3' RACE, and splicing the full-length sequence of the new transcript PRALR-alpha of TCONS-00013523.

2.2 construction of PRALR-alpha Stable overexpression cell line

2.2.1 overexpression plasmid primer design

Overexpression plasmid primers were designed based on the vector sequence and the full-length sequence of PRALR- α transcript identified by RACE experiments, see Table 2.

TABLE 2 primer set sequences constructed from overexpression plasmids

Note: HindIII and XbaI cleavage sites are underlined.

2.2.2 construction of an overexpression cell line

1) Adopting high-assurance enzyme to amplify PRALR-alpha cDNA full-length sequence from OV 3R-PTX;

2) the backbone plasmid pcDNA3.1(+)/zeo (Invitrogen V86020) was linearized with HindIII and XbaI;

3) connecting a PRALR-alpha full-length PCR product with a linearized plasmid by using a seamless cloning kit, and transforming the product into a DH5 alpha competent cell;

4) the plasmid extraction kit is adopted to extract pPRALR-Bleo plasmid, and the plasmid is frozen and stored at-80 ℃ for later use. The plasmid map is shown in FIG. 1;

5) OV3R-PTX cells were transfected with the control plasmids pcDNA3.1 and pPRALR-Ble.o plasmids, and after 48 hours, 100. mu.g/ml bleomycin was added for cell selection, and finally the stably expressing cells were named OV3R-PTX + Vector and OV3R-PTX + PRALR- α -OE, respectively.

2.3 construction of CRISPR-Cas9 System knockout PRALR-alpha cell line

2.3.1 Single Strand guid RNA sequence design

Designing a recognition sequence site of a SpaCas9 protein for knocking out PRALR-alpha according to a PRALR-alpha full-length sequence:

recognition sequence 1: TTCTTCAAGCATAATTGCCTGGG(SEQ ID NO:8)；

Recognition sequence 2: GTAAAGCGTTTAATAAGGCCTGG(SEQ ID NO:9)。

2.3.2 construction of knockout PRALR-alpha cell lines

1) The primer sequences for synthesizing and constructing the knockout plasmid are as follows:

SgRNA1F：CACCGTTCTTCAAGCATAATTGCCT(SEQ ID NO:10)；

SgRNA1R：AAACAGGCAATTATGCTTGAAGAAC(SEQ ID NO:11)；

SgRNA2F：CACCGTAAAGCGTTTAATAAGGCC(SEQ ID NO:12)；

SgRNA2R：AAACGGCCTTATTAAACGCTTTAC(SEQ ID NO:13)。

2) primer phosphorylation and annealing

The synthetic primers were diluted to 100. mu.M with deionized water, and then prepared in a reaction system of 10. mu.l as required in the T4 Polynucleotide Kinase specification, followed by phosphorylation and annealing in a PCR instrument under the following reaction conditions:

37℃,30min；

95℃,5min；

the temperature of the PCR is reduced to 42 ℃ in a gradient way for 53 cycles, and the temperature of each cycle is reduced by 1 ℃ for 1 min;

the PCR gradient was cooled to 24 ℃ for 9 cycles, each cycle decreasing by 2 ℃ for 1 min.

Placed on ice or stored in a-20 ℃ freezer for later use.

3) Guide RNA cloning vector plasmid PX459(Addgene cat No.: 62988) BbsI of the PX459 vector is subjected to enzyme digestion by BsaI, the vector is recovered by tapping, and the concentration of the vector is determined.

4) And (3) connecting the annealing primer with the cut PX459 at 16 ℃ for more than 2h by adopting T4 ligase, and transforming and identifying the positive clone.

5) Extracting positive clone plasmid by using a plasmid extraction kit, and freezing and storing at-80 ℃ for later use.

6) Knockout plasmids were transiently transfected into OV3R-PTX cells for 72h before selection by addition of puromycin.

7) After the clones were formed, the single clones were counted by trypsinization and inoculated into 96-well plates by gradient dilution.

8) Selecting monoclonal cells, performing amplification culture, identifying the knockout gene, and finally constructing a cell line which stably knocks out PRALR-alpha and is named as OV3R-PTX^PRALR-/-。

2.4 half Inhibitory Concentration (IC) of overexpressing and knocking out PRALR-alpha cells against paclitaxel chemotherapeutic drugs₅₀) Measurement experiment

1) The day before dosing, OV3R-PTX + Vector and OV3R-PTX + PRALR-alpha-OE or OV3R-PTX and OV3R-PTX were administered^PRALR-α-/-Cells were counted for digestion and plated into 96-well plates at 10000 cells/well.

2) After the cells are cultured for 24h, a drug concentration gradient of the PTX is prepared in a gradient dilution mode, and 3 cell multiple holes are arranged for each drug adding concentration. OV3R-PTX + Vector and OV3R-PTX + PRALR- α -OE test group PTX was used at concentrations of 10 μ M, 5 μ M, 4 μ M, 2 μ M, 1 μ M, 0.5 μ M, 0.1 μ M, 0.05 μ M, 0.01 μ M, 0 μ M. OV3R-PTX and OV3R-PTX^PRALR-α-/-The experimental group used PTX concentrations of 5. mu.M, 4. mu.M, 2. mu.M, 1. mu.M, 0.5. mu.M, 0.1. mu.M, 0.05. mu.M, 0.01. mu.m, 0.005. mu.M, 0. mu.M.

3) After 48 hours of treatment with the PTX drug, 10. mu.l of CCK8 solution was added to each well, and after 2 hours of reaction, the OD value of absorbance was measured at a wavelength of 450 nm.

4) Drug inhibition and PTX concentration curves are drawn according to OD values of different concentrations, and IC50 values of each experimental group are calculated.

2.5 detection of PRALR-alpha in PTX sensitive and resistant cells Using the qPCR method

The PTX sensitive and resistant cells used, the PTX resistant properties were as follows:

note: OVCAR-3 and SK-OV-3 are ovarian cancer cells; a549 is lung cancer cell.

RNA in tumor cells is respectively cracked by using an RNAioso Plus total RNA extraction reagent according to the kit instruction operation, and then 500ng of total RNA is subjected to reverse transcription into cDNA by using an RNA reverse transcription kit. qPCR half-analysis was performed using primers designed to identify the full-length sequence of PRALR- α, using GAPDH as a quantitative control. The primer sequences are as follows:

PRALR-α-F：ATGCTCATCAATGACAGATCG(SEQ ID NO:14)；

PRALR-α-R：AGAGCCAAAGGGACTGAGAG(SEQ ID NO:15)；

GAPDH-F：GCACCGTCAAGGCTGAGAAC(SEQ ID NO:16)；

GAPDH-R：TGGTGAAGACGCCAGTGGA(SEQ ID NO:17)。

2.6 exosome isolation, detection of PRALR-alpha expression by qPCR method

Firstly, 15ml of cell supernatant external liquid of drug-resistant or sensitive cells is collected, a 100kDa ultrafiltration tube is adopted for concentrating to 1-2ml, then subsequent exosome analysis is carried out according to the requirements of an exosome separation kit (Qiagen 76064) instruction, and finally exosome is dissolved in 400 mu L of bufferXE. 200 μ L of PRALR- α expression was semi-quantitatively analyzed according to the method of 2.5.

3 results

3.1 identification of the full Length sequence of the New transcript of IncPRALR

The full-length sequence of the PRALR gene was amplified using 5 'RACE and 3' RACE (SEQ ID NO: 18). Wherein, the sequence for obtaining PRALR-alpha molecule by transcription is shown as SEQ ID NO. 19.

3.2 construction of PRALR-alpha Stable overexpression cell line

The cell OV3R-PTX + PRALR-alpha-OE of stable over-expression PRALR-alpha is constructed, and the sequence of the PRALR-alpha gene fragment inserted into the vector is shown as SEQ ID NO: 20.

3.3 construction of PRALR-alpha knockout cell line

Cell line OV3R-PTX for stably knocking out PRALR-alpha is constructed based on CRISPR-Cas9 system^PRALR-α-/-The identified sequence is shown as SEQ ID NO. 21.

3.4 cellular knockdown and overexpression of PRALR-alpha

The PRALR-alpha knockout cell line is detected by a PCR method, and the knockout efficiency is found to reach 100% (A in figure 2), which is obviously higher than that of the knockout cell line constructed by other sgRNAs in the research process. In the stably over-expressed PRALR-alpha cell line, the over-expression of PRALR-alpha is found to be improved by 21 times (C in figure 2) compared with the empty vector group, and is obviously higher than that of other over-expressed cell lines constructed in the research process.

3.5CCK-8 cell viability test results

The half inhibitory concentrations of both over-expressing PRALR-alpha and knockout PRALR-alpha cells against paclitaxel chemotherapeutic drugs are shown in FIG. 2, 6.323. mu.M and 0.292. mu.M, respectively. After the PRALR-alpha is knocked out by the ovarian cancer drug-resistant cells, the sensitivity of the cells to paclitaxel chemotherapy is increased (B in figure 2); following overexpression of PRALR- α by ovarian cancer-resistant cells, the cells were increasingly resistant to paclitaxel chemotherapy (FIG. 2, D).

3.6 qPCR detection results for PRALR-alpha in PTX sensitive and drug resistant tumor cells

As shown in FIG. 3, the results show that PRALR-alpha is highly expressed in ovarian cancer and lung cancer PTX resistant cells.

3.7 qPCR detection results for PRALR-alpha in exosomes isolated from PTX sensitive and drug-resistant tumor cell supernatants

The results, see figure 4, indicate that it was found to be closely related to PTX resistance in exosomes isolated from cell supernatants, with high expression.

The above description is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, several modifications and additions can be made without departing from the method of the present invention, and these modifications and additions should also be regarded as the protection scope of the present invention.

SEQUENCE LISTING

<110> Jinshan Hospital affiliated to Fudan university

Application of <120> long-chain non-coding RNA PRALR in diagnosis of tumor paclitaxel chemotherapy resistance

<130> /

<160> 21

<170> PatentIn version 3.3

<210> 1

<211> 40

<212> DNA

<213> Artificial sequence

<400> 1

gattacgcca agcttgaact accattggac tcagcaatcc 40

<210> 2

<211> 41

<212> DNA

<213> Artificial sequence

<400> 2

gattacgcca agcttgtcac tctactataa acacacacgc a 41

<210> 3

<211> 41

<212> DNA

<213> Artificial sequence

<400> 3

gattacgcca agcttgggtc agttggcagg tgctgtagtc c 41

<210> 4

<211> 42

<212> DNA

<213> Artificial sequence

<400> 4

gattacgcca agcttccgat ctgtcattga tgagcattta gg 42

<210> 5

<211> 41

<212> DNA

<213> Artificial sequence

<400> 5

ctaatacgac tcactatagg gcaagcagtg gtatcaacgc a 41

<210> 6

<211> 41

<212> DNA

<213> Artificial sequence

<400> 6

ctagcgttta aacttaagct tgtctgagct gtgcctggac c 41

<210> 7

<211> 54

<212> DNA

<213> Artificial sequence

<400> 7

ggtttaaacg ggccctctag acatgtatta aatatgcatt aatttattta aacc 54

<210> 8

<211> 23

<212> DNA

<213> Artificial sequence

<400> 8

ttcttcaagc ataattgcct ggg 23

<210> 9

<211> 23

<212> DNA

<213> Artificial sequence

<400> 9

gtaaagcgtt taataaggcc tgg 23

<210> 10

<211> 25

<212> DNA

<213> Artificial sequence

<400> 10

caccgttctt caagcataat tgcct 25

<210> 11

<211> 25

<212> DNA

<213> Artificial sequence

<400> 11

aaacaggcaa ttatgcttga agaac 25

<210> 12

<211> 24

<212> DNA

<213> Artificial sequence

<400> 12

caccgtaaag cgtttaataa ggcc 24

<210> 13

<211> 24

<212> DNA

<213> Artificial sequence

<400> 13

aaacggcctt attaaacgct ttac 24

<210> 14

<211> 21

<212> DNA

<213> Artificial sequence

<400> 14

atgctcatca atgacagatc g 21

<210> 15

<211> 20

<212> DNA

<213> Artificial sequence

<400> 15

agagccaaag ggactgagag 20

<210> 16

<211> 20

<212> DNA

<213> Artificial sequence

<400> 16

gcaccgtcaa ggctgagaac 20

<210> 17

<211> 19

<212> DNA

<213> Artificial sequence

<400> 17

tggtgaagac gccagtgga 19

<210> 18

<211> 1093

<212> DNA

<213> Homo sapiens

<400> 18

ggaaaccccc atgagactac aggtgtgaag caagatagaa gcatcagtgc aaaagagatt 60

ctcttactga gataccttgg aacatggttt gaataatatt gctctaactt ctttcatgtc 120

aggaagctct gagatacttc cttttcttac ttaataagaa tagaccttgg aggtctggac 180

ctggacatga acgtacactt ttctaaagaa gatatacaca tggccaacaa gcatgtgaaa 240

aaaagctcaa tatcactgat cattagagaa atgcaaatga aaatcacaat gagagaccat 300

ctcacaccag tcagaatggc tattattaaa aactcaaaaa ataacagatg ctggcgaggt 360

tgcagagaaa agggaacact tatacactgt tggtgggagt gtaaattagt tcaactattg 420

tgtaaagcaa tatgtcaatt cctcaaagag ctaaaaaaga actaccattg gactcagcaa 480

tcccattact gggtatatac tcagaggaat ataagtcact ctactataaa cacacacgca 540

tgcaaatttt cattgtagca ctatttacaa tagcaaagac atggaatcaa cctaaatgct 600

catcaatgac agatcggata aagaaaatat gcatcttcaa cctttctgga ctacagcacc 660

tgccaactga cccccacatc atggctccaa cgctggcttc atcacatatc ttctctctca 720

gtccctttgg ctctcagggt gcaatagctt aacaaaattg ctgatctagg tgcctcagca 780

ttgtttcttt gtcatagtct ctgtattatc ttattttgag ccattctttt cctgcaaaga 840

tcctaactga atgagataac tacttcataa gctatttgta aggtttaaat aaattaatgc 900

atatttaata catggtctga gctgtgcctg gaccagtttg gggaagttgt cggggccccg 960

cgtcgcccag atgtgtgacc tcattgagcc gcagccggcc gagaagatcg gcaagatgaa 1020

gaagttgcgg agaactttgt cggagagttt cagtcgcatt gctttgaaga aagatgacac 1080

cacctttgat gag 1093

<210> 19

<211> 1108

<212> DNA

<213> Artificial sequence

<400> 19

gtctgagctg tgcctggacc agtttgggga agttgtcggg gccccgcgtc gcccagatgt 60

gtgacctcat tgagccgcag ccggccgaga agatcggcaa gatgaagaag ttgcggagaa 120

ctttgtcgga gagtttcagt cgcattgctt tgaagaaaga tgacaccacc tttgatgagg 180

gaaaccccca tgagactaca ggtgtgaagc aagatagaag catcagtgca aaagagattc 240

tcttactgag ataccttgga acatggtttg aataatattg ctctaacttc tttcatgtca 300

ggaagctctg agatacttcc ttttcttact taataagaat agaccttgga ggtctggacc 360

tggacatgaa cgtacacttt tctaaagaag atatacacat ggccaacaag catgtgaaaa 420

aaagctcaat atcactgatc attagagaaa tgcaaatgaa aatcacaatg agagaccatc 480

tcacaccagt cagaatggct attattaaaa actcaaaaaa taacagatgc tggcgaggtt 540

gcagagaaaa gggaacactt atacactgtt ggtgggagtg taaattagtt caactattgt 600

gtaaagcaat atgtcaattc ctcaaagagc taaaaaagaa ctaccattgg actcagcaat 660

cccattactg ggtatatact cagaggaata taagtcactc tactataaac acacacgcat 720

gcaaattttc attgtagcac tatttacaat agcaaagaca tggaatcaac ctaaatgctc 780

atcaatgaca gatcggataa agaaaatatg catcttcaac ctttctggac tacagcacct 840

gccaactgac ccccacatca tggctccaac gctggcttca tcacatatct tctctctcag 900

tccctttggc tctcagggtg caatagctta acaaaattgc tgatctaggt gcctcagcat 960

tgtttctttg tcatagtctc tgtattatct tattttgagc cattcttttc ctgcaaagat 1020

cctaactgaa tgagataact acttcataag ctatttgtaa ggtttaaata aattaatgca 1080

tatttaatac atgaaaaaaa aaaaaaaa 1108

<210> 20

<211> 1093

<212> DNA

<213> Artificial sequence

<400> 20