Cultivated silkworm microsporidian milRNAs and application thereof
1. Silkworm microsporidian milRNAs are characterized in that: the precursor sequence of the milRNAs is any one of SEQ ID NO.2, SEQ ID NO.6, SEQ ID NO.8, SEQ ID NO.14, SEQ ID NO.18, SEQ ID NO.20 and SEQ ID NO. 22.
2. The cultivated silkworm microsporidian milRNAs as set forth in claim 1, wherein: the mature body sequences of the milRNAs are any one of SEQ ID No.1, SEQ ID No.5, SEQ ID No.7, SEQ ID No.13, SEQ ID No.17, SEQ ID No.19 and SEQ ID No. 21.
3. Use of the inhibitors of nosema bombycis milRNAs of claim 1 or 2 for the preparation of a medicament for inhibiting the proliferation of nosema bombycis; the method is characterized in that: the precursor sequences of the milRNAs are shown as SEQ ID No.8, SEQ ID No.14, SEQ ID No.18 or SEQ ID No. 22.
4. Use according to claim 3, characterized in that: the inhibitor of the milRNAs controls microsporidian proliferation by regulating BmPEX16 target genes, and the sequence of the BmPEX16 target genes is shown as SEQ ID No. 53.
5. Use according to claim 3, characterized in that: the inhibitor is milRNA-8 inhibitor.
6. Use of a reagent for overexpressing the cultivated silkworm microsporidian milRNAs of claim 1 or 2 in inhibiting expression of a target gene BmPEX 16.
7. Application of a reagent for over-expressing BmPEX16 target gene in preparing a medicament for inhibiting microsporidian proliferation.
8. Use according to claim 7, characterized in that: the reagent for over-expressing the BmPEX16 target gene is an expression vector for over-expressing the BmPEX16 target gene.
9. Application of a reagent for inhibiting or knocking out BmPEX16 target gene in preparing a medicament for promoting microsporidian proliferation.
10. Use according to claim 9, characterized in that: the reagent for inhibiting or knocking out the BmPEX16 target gene is a carrier ssgRNA, and the knocking-out sequence of the ssgRNA is a complementary pairing sequence of SEQ ID No.54 and SEQ ID No. 55.
Background
mirnas are the most well studied class of endogenous non-coding small RNAs, approximately 22nt in length, that are highly conserved evolutionarily. To date, about 3 million miRNAs have been found in animals, plants, and viruses. miRNA can effectively regulate and control target genes through the action mechanism of miRNA, is a key regulator of a plurality of vital activities such as cell growth, differentiation and apoptosis, and is closely related to the pathogenesis of various diseases. However, many important miRNAs are still unknown, and deep research on expression characteristics and mechanisms of miRNAs is urgently needed, so that the research on miRNAs not only helps to comprehensively understand life processes such as cell propagation, differentiation, apoptosis and metabolism, but also has important significance in certain diseases which are difficult to overcome.
With intensive research on the mechanism of miRNA in animals and plants by scientists, in 2010, Lee et al firstly identified a small RNA (microRNA-like) with similar common characteristics with animal and plant miRNA in Neurospora crassa. The milRNA is used as a non-coding single-stranded RNA, has the length of about 19-25 bases, is mainly involved in stress response, morphological control and various physiological processes of fungi, and can not only induce some gene silencing of a host, but also inhibit the immune response of the host. According to the current research, the mil RNAs have important significance in the aspects of growth, development, reproduction, toxicity regulation and the like of fungi.
Microsporidia is a typical obligate intracellular parasitic fungal pathogenic microorganism. Due to its unique mode of infestation, microsporidian is considered the most successful parasite in nature. The microsporidian has wide host range, not only is a common pathogen of economic insects (silkworm, bee), fish and the like, but also can infect immunodeficiency human. Initially, regulatory studies on microsporidia focused primarily on the protein level. In recent years, with the intensive research on the genetics and transcriptomics of microsporidian, the research on microsporidian is gradually expanding to the nucleic acid level. However, the study of the milRNAs of nosema bombycis is relatively weak at present. A large number of non-coding RNAs have been identified in model organisms such as humans, mice and Drosophila, but fungal non-coding RNAs have been studied relatively late. It is found that nosema apis cerana can regulate and control virulence factors such as cell apoptosis inhibiting factors, polar tube proteins and spore wall proteins and infection factors such as hexokinase, ABC transport proteins and ATP/ADP translocase by regulating the expression level of milRNA, maintain high expression of related virulence factors, adapt to host cells and promote self proliferation and infection, and can regulate expression of upstream and downstream genes in cis through lncRNA or adsorb the milRNA as ceRNA to influence expression of target genes, thereby participating in regulating and controlling substance and energy metabolism of nosema apis cerana. In addition, research shows that the non-coding RNA of microsporidian may participate in the proliferation, apoptosis and immune process of host cell and play an important role in the interaction process of pathogen and host, but the regulation mechanism of the non-coding RNA of microsporidian is not clear.
Disclosure of Invention
In view of the above, one of the objectives of the present invention is to provide cultivated silkworm microsporidian milRNAs; the second purpose of the invention is to provide the application of the inhibitor of the nosema bombycis milRNAs in the preparation of the inhibitor for inhibiting the propagation of the nosema bombycis; the third purpose of the invention is to provide the application of the reagent for over-expressing the silkworm microsporidian milRNAs in inhibiting the expression of a target gene BmPEX 16; the fourth purpose of the invention is to provide the application of the reagent for over-expressing the BmPEX16 target gene in the preparation of the drugs for inhibiting the proliferation of microsporidian; the fifth purpose of the invention is to provide the application of the reagent for inhibiting or knocking out the BmPEX16 target gene in the preparation of the medicine for promoting the proliferation of microsporidian.
In order to achieve the purpose, the invention provides the following technical scheme:
1. silkworm microsporidian milRNAs have precursor sequences as any one of SEQ ID NO.2, SEQ ID NO.6, SEQ ID NO.8, SEQ ID NO.14, SEQ ID NO.18, SEQ ID NO.20 and SEQ ID NO. 22.
Preferably, the sequences of mature bodies of the milRNAs are any one of SEQ ID No.1, SEQ ID No.5, SEQ ID No.7, SEQ ID No.13, SEQ ID No.17, SEQ ID No.19 and SEQ ID No. 21.
2. The inhibitor of the silkworm microsporidian milRNAs is applied to the preparation of the inhibitor for inhibiting the proliferation of the microsporidian; the precursor sequences of the milRNAs are shown as SEQ ID No.8, SEQ ID No.14, SEQ ID No.18 or SEQ ID No. 22.
Preferably, the inhibitor of the milRNAs controls the proliferation of microsporidian by regulating BmPEX16 target gene, and the sequence of the BmPEX16 target gene is shown as SEQ ID No. 23.
Preferably, the inhibitor is milRNA-8 inhibitor.
3. The application of the reagent for over-expressing the silkworm microsporidian milRNAs in inhibiting the expression of a target gene BmPEX 16.
4. Application of a reagent for over-expressing BmPEX16 target gene in preparing a medicament for inhibiting microsporidian proliferation.
Preferably, the reagent for over-expressing the BmPEX16 target gene is an expression vector for over-expressing the BmPEX16 target gene.
5. Application of a reagent for inhibiting or knocking out BmPEX16 target gene in preparing a medicament for promoting microsporidian proliferation.
Preferably, the reagent for inhibiting or knocking out the BmPEX16 target gene is a carrier ssgRNA, and the knocking-out sequence of the ssgRNA is a complementary pairing sequence of SEQ ID No.54 and SEQ ID No. 55.
The invention has the beneficial effects that: the invention provides silkworm microsporidian milRNAs, and researches show that milRNA-4, milRNA-8, milRNA-10 and milRNA-12 have a promoting effect on the proliferation of microsporidian, and milRNA-1, milRNA-3 and milRNA-11 have an inhibiting effect on the proliferation of microsporidian, wherein the promoting effect of milRNA-8 on the proliferation of microsporidian is most obvious, so that the silkworm microsporidian milRNAs can be used for regulating and controlling the proliferation of microsporidian. The research also finds that the target gene of the action of the milRNAs is BmPEX16, the copy number of the overexpressed nosema bombycis and the protein expression quantity of NbPTP2 are both reduced, and shows that after the BmPEX16 is overexpressed, the proliferation of the nosema bombycis is inhibited; after BmPEX16 is knocked out, the proliferation of the nosema bombycis is promoted, so that the proliferation of the nosema bombycis can be regulated and controlled by regulating the expression of BmPEX16 gene, and a reference is provided for analyzing the infection mechanism and disease prevention and control of the nosema bombycis.
Drawings
In order to make the object, technical scheme and beneficial effect of the invention more clear, the invention provides the following drawings for explanation:
FIG. 1 shows the analysis of the proliferation characteristics of nosema bombycis by immunofluorescence and qPCR (A: analysis of the proliferation characteristics of nosema bombycis by immunofluorescence and B: analysis of the proliferation characteristics of nosema bombycis by qPCR).
FIG. 2 shows the prediction of the secondary structure of the milRNA of nosema bombycis.
FIG. 3 is the analysis of expression level of silkworm microsporidian milRNAs.
FIG. 4 shows puro-OpIE2prmConstruction of the mCherry-U6-mil RNA overexpression vector (A: puro-OpIE2prm-mCherry-U6-mil RNA construction scheme; B: puro-OpIE2 prm-mChery-U6-mil RNA sequencing result).
FIG. 5 shows the effect of the milRNAs over-expression vector on the proliferation of nosema bombycis.
FIG. 6 shows the detection of fluorescent in situ hybridization of milRNA-8.
FIG. 7 shows the effect of milRNA-8inhibitor on the proliferation of nosema bombycis.
FIG. 8 shows the screening of the target gene for milRNA-8.
FIG. 9 shows the binding of milRNA-8 to BmPEX16 (A: RNA 22 prediction; B: RNAhybrid prediction; C: luciferase activity assay).
FIG. 10 shows the analysis of the change in the expression level of BmPEX16 by overexpression and interference of milRNA-8 (A: the analysis of the change in the expression level of BmPEX16 by overexpression of milRNA-8; B: the analysis of the change in the expression level of BmPEX16 by milRNA-8 inhibitor).
FIG. 11 shows the effect of overexpression of BmPEX16 on the proliferation of nosema bombycis (A: construction of BmPEX16 overexpression vector; B: qRT-PCR detection of BmPEX16 expression level after overexpression).
FIG. 12 shows the effect of Cas13a knockout of BmPEX16 on microparticle proliferation (A: construction of BmPEX16 knockout vector; B: detection of BmPEX16 knockout vector for Cas13 a; C: effect of Cas13a knockout of BmPEX16 on microparticle proliferation; D: change of NbPTP2 protein expression after BmPEX16 knockout for Cas13 a).
Detailed Description
Hereinafter, preferred embodiments of the present invention will be described in detail with reference to the accompanying drawings. The test methods in the examples, in which the specific conditions are not specified, are generally carried out according to the conventional conditions or according to the conditions recommended by the reagent manufacturers. It should be noted that the embodiments described in the present specification are only for the purpose of facilitating understanding of the present invention, and they are not intended to limit the present invention, i.e., the present invention may have other embodiments besides the embodiments described in the specification. Therefore, any technical solutions formed by equivalent substitution or equivalent transformation are within the protection scope of the present invention.
Example 1 prediction and analysis of cultivated silkworm microsporidian milRNAs
The proliferation characteristics of the nosema bombycis are analyzed through immunofluorescence and qPCR experiments, and the life history of the nosema bombycis is observed through the immunofluorescence, so that when the nosema bombycis is infected for 24 hours, a small number of spores inject sporogen into host cytoplasm through popping polar fibers, and a small amount of sporogen can be found in the host cells; at 48h of infection, the sporogen of the spore becomes large, and develops into schizonts through binary division or multi-division, so that the phenomenon of sporogen aggregation and amplification can be found in host cells; after 72h of infection, the sporozoites formed by the merozoites combining into one form sporocyte in a binary splitting mode, and at the moment, sporogenous substances can also be observed in the host cells; when the silkworm microsporidian is infected for 96 hours, the silkworm microsporidian completes the amplification of one life cycle and starts to enter a second proliferation cycle, and a large amount of sporogen can be observed in host cells. A specific quantitative primer is designed for the silkworm microsporidian NbSsuRNA, NbssuRNA-F: 5'-gtccctgttctttgtac-3' (SEQ ID No. 23); nbssu RNA-R: 5'-atcctgctaatggttct-3' (SEQ ID No. 24). The qPCR results also show that the spores are greatly amplified at the schizogenesis proliferation stage of 48h, and the results are shown in FIG. 1. In conclusion, when the nosema bombycis infects the host for 48h in the fission and proliferation stage, the complete spore wall is not formed yet, and the nosema bombycis milRNAs are the most abundant stage. Therefore, this period was chosen for high throughput sequencing of nosema bombycis.
In order to predict silkworm microsporidian milRNAs, Illumina-Solexa high-throughput deep sequencing is carried out on two cell samples of a silkworm microsporidian infected group (Nb) and an uninfected group (Control).
To analyze the genomic distribution of sRNAs in both sets of samples, the two sets of length-screened sRNAs were aligned to the microsporidian genome. The results indicated that the genomic sRNAs sequence reads matched in Nb and Control groups were 435,586 and 84,423, respectively. However, since the studies on the fungi miRNA are relatively few at present, and no relevant data of the microsporidian bombyx miRNA is found in the database, the potential milRNAs of the microsporidian bombyx are predicted by searching the secondary structure, energy and other characteristics of the miRNA, and a total of 11 new microsporidian milRNAs are predicted, and the results are shown in fig. 2. The specific sequence is as follows:
milRNA-1：
mature milRNA：uaagacguccggugcauucg(SEQ ID No.1)；
precursor milRNA：uaagacguccggugcauucguuguugcgaugcaccgguguucgaau(SEQ ID No.2)；
milRNA-2：
mature milRNA：uauuauuguaguuagaagacgagcc(SEQ ID No.3)；
precursor milRNA：uauuguauucguucucacgagguauuuagugucgcccuaaauauuauuguaguuagaagacgagcc(SEQ ID No.4)；
milRNA-3：
mature milRNA：uaaagauuuucauagagcgguuga(SEQ ID No.5)；
precursor milRNA：ucuacgcuuuuucgaaaucuuugauguuuuuaauccgggguuaaagauuuucauagagcgguuga(SEQ ID No.6)；
milRNA-4：
mature milRNA：uuuagcgucguaaagugcuggacga(SEQ ID No.7)；
precursor milRNA：ucugugcuuucggacgugagagggagaauuauccucugcuacaguuuagcgucguaaagugcuggacga(SEQ ID No.8)；
milRNA-5：
mature milRNA：ucggcguugugguuuacguucaca(SEQ ID No.9)；
precursor milRNA：uugacgucagccacaaugucgacucgagagucauucaauauuuuguuuccauccuugucaaccaucggcguugugguuguucaca(SEQ ID No.10)；
milRNA-6：
mature milRNA：uauuuagaucaaagguuugaagcuu(SEQ ID No.11)；
precursor milRNA：uucuuguugcaagccggaugcuccaauugucauuaaauccaaauauauuuagaucaaagguuugaagcuu(SEQ ID No.12)；
milRNA-8：
mature milRNA：uacauguauugcaaucguaggaca(SEQ ID No.13)；
precursor milRNA：acauguauugcaaucguaggacagguguuaaugugcaaaauucauacuacuaguuuuacgaacucaaaacaaaguggc(SEQ ID No.14)；
milRNA-9：
mature milRNA：uuccgaaaucgucugcuuguagauu(SEQ ID No.15)；
precursor milRNA：uuuacaagcggauaaugggaaggaauuccgaaaucgucugcuuguagauu(SEQ ID No.16)；
milRNA-10：
mature milRNA：ugacaugcuguuaaaccugacauc(SEQ ID No.17)；
precursor milRNA：ugccggaauuacagcaguaucuuuuugcgguacacuaguugguaccacauuugacaugcuguuaaaccugacauc(SEQ ID No.18)；
milRNA-11：
mature milRNA：uuuccgauauuuugggcguaaacc(SEQ ID No.19)；
precursor milRNA：uuuccgauauuuugggcguaaaccguaguauuaugagggacaaaaaauuguaacuaugauuuacuuaaagauguucaaaaauuggaucuu(SEQ ID No.20)；
milRNA-12：
mature milRNA：ucuuugcuguaauguuucuggcaa(SEQ ID No.21)；
precursor milRNA：gccagaaacgagcacaaggauuuaagauuccuaaggaacgucuuacaguacaucuuugcuguaauguuucuggcaa(SEQ ID No.22)
in order to identify the milRNAs predicted by high-throughput sequencing, total miRNAs of 48h cell samples infected with the nosema bombycis and total miRNAs of cell samples not infected with the nosema bombycis are respectively extracted, and the predicted nosema bombycis are subjected to stem-loop RT-qPCRDetecting the expression condition of the amirnas, and adopting 2－△△CTThe method performs data analysis on the relative change of the expression amount. Specific quantitative primers are designed for 11 miRNAs respectively.
General formula R: 5'-ctcaactggtgtcgtgga-3' (SEQ ID No. 25);
milRNA-1-F：5’-acactccagctgggtaagacgtccgg-3’(SEQ ID No.26)；
milRNA-2-F：5’-acactccagctgggtattattgtagttagaa-3’(SEQ ID No.27)；
milRNA-3-F：5’-acactccagctgggtaaagattttcataga-3’(SEQ ID No.28)；
milRNA-4-F：5’-acactccagctgggtttagcgtcgtaaagtg-3’(SEQ ID No.29)；
milRNA-5-F：5’-acactccagctgggtcggcgttgtggttta-3’(SEQ ID No.30)；
milRNA-6-F：5’-acactccagctgggtatttagatcaaaggtt-3’(SEQ ID No.31)；
milRNA-8-F：5’-acactccagctgggtacatgtattgcaatc-3’(SEQ ID No.32)；
milRNA-9-F：5’-acactccagctgggttccgaaatcgtctgct-3’(SEQ ID No.33)；
milRNA-10-F：5’-acactccagctgggtgacatgctgttaaa-3’(SEQ ID No.34)；
milRNA-11-F：5’-acactccagctgggtttccgatattttggg-3’(SEQ ID No.35)；
milRNA-12-F：5’-acactccagctgggtctttgctgtaatgtt-3’(SEQ ID No.36)。
the result shows that compared with the expression quantity of the milRNAs predicted by high-throughput sequencing, in the expression level of 11 milRNAs verified by a stem-loop qRT-PCR experiment, the expression quantity of 10 milRNAs is consistent with the expression trend of the 10 milRNAs, and the 10 milRNAs are only specifically and highly expressed in host cells after silkworm microsporidian infection, and the result is shown in FIG. 3.
Example 2 identification and functional analysis of Microsporidium bombycis milRNA-8
To investigate the effect of the mil RNAs on the proliferation of nosema bombycis, this example inserted 10 target bands containing the mil RNAs into puro-OpIE2, respectivelyprm-mCherry-PIn the A vector, the recombinant plasmid puro-OpIE2 was obtained by using the restriction enzyme Asc1prmAnd the sequence of mCherry-U6-mil RNA (FIG. 4) shows that 7 overexpression vectors are successfully constructed and all the overexpression vectors can be normally expressed by the observation of a fluorescence microscope, and the result is shown in FIG. 4.
After 7 overexpression vectors are successfully constructed, BmE-SWU1 cells are transfected on the cell level, after the overexpression vectors are stably expressed for 48h, nosema bombycis is added, when the nosema bombycis infects host cells for 48h, the nosema bombycis is in the schizogenesis multiplication stage, the cell samples at the moment are extracted to form genomes, and qPCR detection is carried out. The results show that, of the 7 overexpression vectors, the mil RNA-4, the mil RNA-8, the mil RNA-10 and the mil RNA-12 have the promotion effect on the proliferation of the microsporidian, and the mil RNA-1, the mil RNA-3 and the mil RNA-11 have the inhibition effect on the proliferation of the microsporidian, wherein the promotion effect of the mil RNA-8 on the proliferation of the microsporidian is most obvious. Thus, it is presumed that the mil RNA-8 may play an important role in the growth of nosema bombycis per se, and the result of selecting the mil RNA-8 as a subject of further investigation is shown in FIG. 5.
In order to analyze the expression characteristics of the milRNA-8, a time sequence expression spectrum of the milRNA-8 is analyzed by using stem-loop RT-qPCR, and the expression level of the milRNA-8 is found to be in an ascending trend 24 hours after the milRNA-8 is infected with nosema bombycis; compared with qRT-PCR, the fluorescent in-situ hybridization technology can more intuitively show the expression level of the milRNA, a specific fluorescent probe is designed according to the nucleic acid sequence of the milRNA-8, and the FISH experiment detection of the milRNA is carried out on the cell sample infected by 48 hours of nosema bombycis and in the schizoproliferation stage. The experimental results show that the expression of milRNA-8 exists in both the silkworm microsporidian sporogen and the host cytoplasm, and the results are shown in FIG. 6.
In order to further explore the influence of the milRNA-8 of the nosema bombycis on the proliferation of the nosema bombycis, the milRNA-8inhibitor of the nosema bombycis is artificially designed, after the horizontal transfection of cells is carried out for 24 hours, the nosema bombycis is added, when host cells infect the nosema bombycis for 48 hours, the genome of a cell sample is extracted, and the proliferation condition of the nosema bombycis is explored by utilizing qPCR. The experimental result shows that the milRNA-8inhibitor has an inhibiting effect on the proliferation of microsporidian, and the result is shown in FIG. 7.
Example 3 screening and identification of the target Gene of Microsporidium bombycis milRNA-8
In order to identify the target gene of the cultivated silkworm microsporidian milRNA-8, the preliminary prediction is carried out by using target gene prediction software MiRanda, and the MiRanda threshold is set to be score ≧ 140. The result shows that 569 candidate target genes are predicted in the host by the milRNA-8, 64 candidate target genes with the expression quantity difference multiple more than or equal to 2 in the Control group and the Nb group are selected, and the genes are subjected to KEGG function enrichment analysis, so that 8 candidate target genes are enriched into metabolism, neuroactive receptors, ligand channels and peroxisome channels. Corresponding quantitative primers are designed for 8 candidate target genes, and the sequences are respectively as follows: BGIBMGA 002029-F: 5'-aagtatactgaaggccgagatg-3' (SEQ ID No. 37);
BGIBMGA002029-R：5’-tccatcaacacgtctcataaca(SEQ ID No.38)；
BGIBMGA009927-F：5’-ctctgcgaagagttcaacaatc(SEQ ID No.39)；
BGIBMGA009927-R：5’-gaacgaactcaggacaggaa(SEQ ID No.40)；
BGIBMGA010023-F：5’-ccaacttccatatcctgtctgt(SEQ ID No.41)；
BGIBMGA010023-R：5’-tcatttcgtatgtcagaaccga(SEQ ID No.42)；
BGIBMGA001569-F：5’-aatggagcaagaggaagaagaa(SEQ ID No.43)；
BGIBMGA001569-R：5’-tcatccaaaggccatgtatctt(SEQ ID No.44)；
BGIBMGA001570-F：5’-cgttagaggtgaggatgtctac(SEQ ID No.45)；
BGIBMGA001570-R：5’-tttcttgtcctgtctcgagtac(SEQ ID No.46)；
BGIBMGA000724-F：5’-gttacggaaattgtttggagct(SEQ ID No.47)；
BGIBMGA000724-R：5’-gttaaccaatcttttgccacct(SEQ ID No.48)；
BGIBMGA000938-F：agaggcgagttgtgtttataca(SEQ ID No.49)；
BGIBMGA000938-R：cttctgcaggaagtacttctga(SEQ ID No.50)；
BGIBMGA012192-F：attcgtgagacaaaagaaaccg(SEQ ID No.51)；
BGIBMGA012192-R：acctttaacatttcctggtcct(SEQ ID No.52)。
furthermore, in order to analyze the expression levels of 8 candidate target genes, milRNA-8 was overexpressed at the cellular level, and the expression level of BmPEX16 (accession number: BGIBMGA002029) was found to be significantly reduced. Based on the function and expression level of the candidate target gene, gene BmPEX16(SEQ ID No.53) involved in peroxisome biogenesis was selected as a subject for subsequent studies, and the results are shown in FIG. 8.
To explore the binding effect of milRNA-8 to BmPEX16, in addition to miRanda target gene prediction, multiple target gene prediction software was selected for analysis. The result shows that the milRNA-8 can be combined with the BmPEX 163' UTR region through base complementary pairing. To further verify the binding effect of milRNA-8 to BmPEX16, after adding nosema bombycis at the cellular level for 48h, the over-expression vector of milRNA-8, milRNA-8inhibitor (atgtacaacgttagcatcgt) and pGL3.0-IE1-luc-PEX16 were transfected respectively, and after further culturing for 48h, the cell samples were subjected to dual luciferase reporter gene detection (Dong, ZQ., Hu, ZG., Li, HQ.et al.construction and characterization of a synthetic Baculovir-indole 39K promoter. J Biol Eng 12,30(2018). hthttps:// doi.org/10.1186/s 13036-018. 0121-8). The result shows that BmPEX16 is regulated by the milRNA-8 after the milRNA-8 is over-expressed, and the activity of the dual luciferase is reduced when compared with the control group; after the addition of the milRNA-8inhibitor, the BmPEX16 is hardly inhibited by the milRNA-8, and the activity of the dual-luciferase is increased at the moment, which shows that the BmPEX16 is determined as the target gene of the milRNA-8 and is regulated by the milRNA-8, and the result is shown in FIG. 9.
The above results indicate that the expression level of the target gene BmPEX16 is significantly inhibited after the over-expression of milRNA-8. To further explore the regulation effect of the milRNA-8 on BmPEX16, when microsporidian infects a host for 48 hours, artificially synthesized milRNA-8inhibitor is transfected at the cellular level, and a cell sample is collected after 48 hours. After total RNA of the cell sample is extracted and is reversely transcribed into cDNA, the expression level of BmPEX16 is detected by qRT-PCR, and the expression level of the target gene is found to be up-regulated, and the result is shown in FIG. 10. In conclusion, the target gene BmPEX16 is regulated by the milRNA-8.
Example 4 Effect of BmPEX16 on the proliferation of Nosema bombycis
To analyze the effect of BmPEX16 on microsporidian proliferation, an overexpression vector pIZ-OpIE2-BmPEX16-pA of BmPEX16 was constructed (Dong, ZQ., Hu, ZG., Li, HQ.et al. construction and characterization of a synthetic Baculovir-indelible 39K promoter. J Biol Eng 12,30(2018). https:// doi.org/10.1186/s 13036-018-0121-8). The overexpression vectors were transfected at the cellular level and cell samples were harvested after 48 h. After total RNA of a cell sample is extracted and is reversely transcribed into cDNA, the expression level of the total RNA is detected by using BmPEX16 specific quantitative primers, and the expression level of BmPEX16 is increased compared with a control group. After the BmPEX16 overexpression vector is successfully constructed, the overexpression vector is transfected for 48h on the cell level, nosema bombycis is added, and the cell sample is collected after continuous culture for 48 h. Genome and protein samples of cell samples were extracted respectively, and the copy number of microsporidia and the change of nosema bombycis polar tube protein (NbPTP2) were detected by qPCR and Western blotting, and the results are shown in FIG. 11. The result shows that after the target gene BmPEX16 is over-expressed, the copy number of the nosema bombycis and the protein expression quantity of NbPTP2 are both down-regulated, and the result shows that after the BmPEX16 is over-expressed, the proliferation of the nosema bombycis is inhibited.
On the basis of verifying that the knockout vector Cas13a has a knockout effect on the exogenous gene egfp, a corresponding knockout vector ssgRNA is designed for the target gene BmPEX16 according to the editing characteristics of Cas13 a. The knockout sequence of ssgRNA is: ssgRNA-F: 5'-aaac cgcagtgtacacttcttgcaacgacaat-3' (SEQ ID No.54), ssgRNA-R: 5'-aaaa attgtcgttgcaagaagtgtacactgcg-3' (SEQ ID No. 55). At the cellular level, ssgRNA was co-transfected with pSL1180-IE1-Cas13a-SV40(Dong ZQ, Chen TT, Zhang J, et al. expression of a high effective virus-induced CRIS PR/Cas9 system in induced cells, antibody Research, Volume 130,50-57, (2016). https:// doi.org/10.1016/j.anti virus.2016.03.009) to extract the corresponding total cellular RNA, which was reverse transcribed into cDNA and then detected using BmPEX16 specific quantitative primers, it was found that the expression of BmPEX16 was reduced by CRISPR/Cas13 a. In order to further confirm the influence of knocking out BmPEX16 on microsporidian proliferation, Cas13a and ssgRNA are co-transformed for 48h, microsporidian is added, cell samples are collected after 48h of re-culture, and qPCR and Western blotting are respectively used for detecting the copy number of microsporidian and the change of the microsporidian NbPTP2 of silkworm. The result shows that both the copy number of the nosema bombycis and the protein expression amount of NbPTP2 are up-regulated on the basis of the knockout of Cas13a on the target gene BmPEX16, which shows that the nosema bombycis is promoted to proliferate after BmPEX16 is knocked out, and the result is shown in FIG. 12.
The above-mentioned embodiments are merely preferred embodiments for fully illustrating the present invention, and the scope of the present invention is not limited thereto. The equivalent substitution or change made by the technical personnel in the technical field on the basis of the invention is all within the protection scope of the invention. The protection scope of the invention is subject to the claims.
Sequence listing
<110> university of southwest
<120> cultivated silkworm microsporidian milRNAs and application thereof
<160> 55
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> RNA
<213> Bombyx mori microsporidian (Nosema bombycis)
<400> 1
uaagacgucc ggugcauucg 20
<210> 2
<211> 46
<212> RNA
<213> Bombyx mori microsporidian (Nosema bombycis)
<400> 2
uaagacgucc ggugcauucg uuguugcgau gcaccggugu ucgaau 46
<210> 3
<211> 25
<212> RNA
<213> Bombyx mori microsporidian (Nosema bombycis)
<400> 3
uauuauugua guuagaagac gagcc 25
<210> 4
<211> 66
<212> RNA
<213> Bombyx mori microsporidian (Nosema bombycis)
<400> 4
uauuguauuc guucucacga gguauuuagu gucgcccuaa auauuauugu aguuagaaga 60
cgagcc 66
<210> 5
<211> 24
<212> RNA
<213> Bombyx mori microsporidian (Nosema bombycis)
<400> 5
uaaagauuuu cauagagcgg uuga 24
<210> 6
<211> 65
<212> RNA
<213> Bombyx mori microsporidian (Nosema bombycis)
<400> 6
ucuacgcuuu uucgaaaucu uugauguuuu uaauccgggg uuaaagauuu ucauagagcg 60
guuga 65
<210> 7
<211> 25
<212> RNA
<213> Bombyx mori microsporidian (Nosema bombycis)
<400> 7
uuuagcgucg uaaagugcug gacga 25
<210> 8
<211> 69
<212> RNA
<213> Bombyx mori microsporidian (Nosema bombycis)
<400> 8
ucugugcuuu cggacgugag agggagaauu auccucugcu acaguuuagc gucguaaagu 60
gcuggacga 69
<210> 9
<211> 24
<212> RNA
<213> Bombyx mori microsporidian (Nosema bombycis)
<400> 9
ucggcguugu gguuuacguu caca 24
<210> 10
<211> 85
<212> RNA
<213> Bombyx mori microsporidian (Nosema bombycis)
<400> 10
uugacgucag ccacaauguc gacucgagag ucauucaaua uuuuguuucc auccuuguca 60
accaucggcg uugugguugu ucaca 85
<210> 11
<211> 25
<212> RNA
<213> Bombyx mori microsporidian (Nosema bombycis)
<400> 11
uauuuagauc aaagguuuga agcuu 25
<210> 12
<211> 70
<212> RNA
<213> Bombyx mori microsporidian (Nosema bombycis)
<400> 12
uucuuguugc aagccggaug cuccaauugu cauuaaaucc aaauauauuu agaucaaagg 60
uuugaagcuu 70
<210> 13
<211> 24
<212> RNA
<213> Bombyx mori microsporidian (Nosema bombycis)
<400> 13
uacauguauu gcaaucguag gaca 24
<210> 14
<211> 78
<212> RNA
<213> Bombyx mori microsporidian (Nosema bombycis)
<400> 14
acauguauug caaucguagg acagguguua augugcaaaa uucauacuac uaguuuuacg 60
aacucaaaac aaaguggc 78
<210> 15
<211> 25
<212> RNA
<213> Bombyx mori microsporidian (Nosema bombycis)
<400> 15
uuccgaaauc gucugcuugu agauu 25
<210> 16
<211> 50
<212> RNA
<213> Bombyx mori microsporidian (Nosema bombycis)
<400> 16
uuuacaagcg gauaauggga aggaauuccg aaaucgucug cuuguagauu 50
<210> 17
<211> 24
<212> RNA
<213> Bombyx mori microsporidian (Nosema bombycis)
<400> 17
ugacaugcug uuaaaccuga cauc 24
<210> 18
<211> 75
<212> RNA
<213> Bombyx mori microsporidian (Nosema bombycis)
<400> 18
ugccggaauu acagcaguau cuuuuugcgg uacacuaguu gguaccacau uugacaugcu 60
guuaaaccug acauc 75
<210> 19
<211> 24
<212> RNA
<213> Bombyx mori microsporidian (Nosema bombycis)
<400> 19
uuuccgauau uuugggcgua aacc 24
<210> 20
<211> 90
<212> RNA
<213> Bombyx mori microsporidian (Nosema bombycis)
<400> 20
uuuccgauau uuugggcgua aaccguagua uuaugaggga caaaaaauug uaacuaugau 60
uuacuuaaag auguucaaaa auuggaucuu 90
<210> 21
<211> 24
<212> RNA
<213> Bombyx mori microsporidian (Nosema bombycis)
<400> 21
ucuuugcugu aauguuucug gcaa 24
<210> 22
<211> 76
<212> RNA
<213> Bombyx mori microsporidian (Nosema bombycis)
<400> 22
gccagaaacg agcacaagga uuuaagauuc cuaaggaacg ucuuacagua caucuuugcu 60
guaauguuuc uggcaa 76
<210> 23
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
gtccctgttc tttgtac 17
<210> 24
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 24
atcctgctaa tggttct 17
<210> 25
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 25
ctcaactggt gtcgtgga 18
<210> 26
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 26
acactccagc tgggtaagac gtccgg 26
<210> 27
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 27
acactccagc tgggtattat tgtagttaga a 31
<210> 28
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 28
acactccagc tgggtaaaga ttttcataga 30
<210> 29
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 29
acactccagc tgggtttagc gtcgtaaagt g 31
<210> 30
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 30
acactccagc tgggtcggcg ttgtggttta 30
<210> 31
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 31
acactccagc tgggtattta gatcaaaggt t 31
<210> 32
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 32
acactccagc tgggtacatg tattgcaatc 30
<210> 33
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 33
acactccagc tgggttccga aatcgtctgc t 31
<210> 34
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 34
acactccagc tgggtgacat gctgttaaa 29
<210> 35
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 35
acactccagc tgggtttccg atattttggg 30
<210> 36
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 36
acactccagc tgggtctttg ctgtaatgtt 30
<210> 37
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 37
aagtatactg aaggccgaga tg 22
<210> 38
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 38
tccatcaaca cgtctcataa ca 22
<210> 39
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 39
ctctgcgaag agttcaacaa tc 22
<210> 40
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 40
gaacgaactc aggacaggaa 20
<210> 41
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 41
ccaacttcca tatcctgtct gt 22
<210> 42
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 42
tcatttcgta tgtcagaacc ga 22
<210> 43
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 43
aatggagcaa gaggaagaag aa 22
<210> 44
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 44
tcatccaaag gccatgtatc tt 22
<210> 45
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 45
cgttagaggt gaggatgtct ac 22
<210> 46
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 46
tttcttgtcc tgtctcgagt ac 22
<210> 47
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 47
gttacggaaa ttgtttggag ct 22
<210> 48
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 48
gttaaccaat cttttgccac ct 22
<210> 49
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 49
agaggcgagt tgtgtttata ca 22
<210> 50
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 50
cttctgcagg aagtacttct ga 22
<210> 51
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 51
attcgtgaga caaaagaaac cg 22
<210> 52
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 52
acctttaaca tttcctggtc ct 22
<210> 53
<211> 813
<212> DNA
<213> silkworm (Bombyx mori L.)
<400> 53
atgagtagca aattgtcgtt gcaagaagtg tacactgcgt acaagcgatg ggtgatcagc 60
aatccgagcg tggtgacaga cgtcgagacc gttgctacat ggacgtcgta tttcgtggcc 120
gaactcattg ccaaagacag atggggacaa cgaggcaagt ggaccgttgc aactttattg 180
cagctcttca aagcatcgtc cggattaatt cttctgtatc gattcaaaga acttcccata 240
tcacaccccc ctgttgcttt cttacaaaga aagaagtata ctgaaggccg agatgttgaa 300
gagcatgaga attcattttt taagcttcgc aggtctggcc gtgttatgag acgtgttgat 360
ggagcacctc caattgcttt tcgagattgg acgccagtga aaataaaaga tgatagacct 420
gtgcctggca ttgaggttaa ggacttattg tatgctgagt cattacatgt tttgaagcca 480
ttacttcatc ttgctgcaat gaggttcttt ggaaataaag cctggaagca gtggtttgtg 540
gctctcagta ttgatattgc cagtctcaaa gtatacaata ggtatatgaa agagttatca 600
tatgaacaaa ggctggaaat aagtcgaaga aaattaggct tagtcctata tttattacgc 660
agtcctatgt acaataaata ttctaacact gtaatagaaa atgttcttaa ttctgcttca 720
aagaaaatac ctatgatgtc attgatctgt ggcccaataa tccaatactt aaatcactgg 780
caagacattt acttctatat gtgggcatca taa 813
<210> 54
<211> 32
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 54
aaaccgcagt gtacacttct tgcaacgaca at 32
<210> 55
<211> 32
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 55
aaaaattgtc gttgcaagaa gtgtacactg cg 32
