1. An sgRNA targeting a casc5 gene, wherein the sgRNA targeting a casc5 gene comprises a nucleic acid sequence shown as SEQ ID No. 1.

2. A casc5 gene editing system, wherein the casc5 gene editing system comprises the sgRNA of claim 1 targeting the casc5 gene;

preferably, the casc5 gene editing system further comprises Cas 9;

preferably, the Cas9 comprises Cas9 nuclease and/or Cas9 mRNA, preferably Cas9 mRNA.

3. A recombinant cell comprising a sgRNA targeting the casc5 gene of claim 1;

preferably, said recombinant cell comprises the casc5 gene editing system of claim 2;

preferably, the recombinant cell is a fertilized egg with a cas 5 gene knocked out from the genome thereof after being edited by the casc5 gene editing system of claim 2.

4. A method of constructing the recombinant cell of claim 3, comprising:

introducing the casc5 gene editing system of claim 2 into the cytoplasm of a fertilized egg to obtain the recombinant cell;

preferably, the introducing comprises microinjection.

5. A method for constructing an animal model with microcephaly is characterized by comprising the following steps:

introducing the casc5 gene editing system according to claim 2 into the cytoplasm of a fertilized egg to obtain a recombinant cell;

the recombinant cells develop into F0 generation individuals, and mate with wild type to obtain F1 generation heterozygotes;

selfing the F1 generation heterozygote to obtain an F2 generation homozygote which is the microcephaly animal model.

6. The method for constructing an animal model of microcephaly according to claim 5, wherein the preparation method of the casc5 gene editing system comprises:

in vitro transcription is carried out on the Cas9 gene to obtain the Cas9 mRNA;

mixing the Cas9 mRNA with the sgRNA targeting the casc5 gene of claim 1 to obtain the casc5 gene editing system.

7. The method for constructing an animal model of microcephaly according to claim 5 or 6, wherein the fertilized egg comprises fertilized egg of zebrafish.

8. The method for constructing an animal model of microcephaly according to any one of claims 5-7, wherein the individuals of the F0 generation, the heterozygotes of the F1 generation and the homozygotes of the F2 generation are identified by PCR amplification and sequencing;

preferably, the primer for PCR amplification comprises a nucleic acid sequence shown as SEQ ID No. 2-3.

9. The method for constructing an animal model of microcephaly according to any one of claims 5 to 8, wherein the method for constructing an animal model of microcephaly comprises the following steps:

(1) in vitro transcription of mRNA of the Cas9 gene, and mixing with sgRNA targeting the casc5 gene to obtain the casc5 gene editing system;

(2) collecting fertilized eggs of the zebra fish, and microinjecting the casc5 gene editing system into cytoplasm of the fertilized eggs of the zebra fish to obtain recombinant cells;

(3) culturing the recombinant cells, extracting DNA of tail fin tissues after the recombinant cells grow into zebra fish individuals, performing PCR amplification by using SEQ ID Nos. 2-3, performing sequencing identification on amplification products, and selecting the zebra fish individuals with casc5 gene deletion as F0 generations of zebra fish;

(4) hybridizing the zebra fish of the F0 generation with wild zebra fish to obtain zebra fish of a heterozygote of the F1 generation;

(5) selfing the F1 generation heterozygous zebra fish, performing PCR amplification by using SEQ ID No. 2-3, performing sequencing identification on an amplification product, and screening the F2 generation casc5 gene knockout homozygous zebra fish, namely the microcephaly animal model.

10. Use of any one or a combination of at least two of the sgRNA targeting the casc5 gene of claim 1, the casc5 gene editing system of claim 2, the recombinant cell of claim 3, the method for constructing the recombinant cell of claim 4, or the method for constructing the microcephalic animal model of any one of claims 5 to 9 in microcephalic drug screening.

Background

Microcephaly (microcephaly) is a neurodevelopmental disorder (neurodevelopmental disorder) which is usually manifested by a small head of a patient, and the conventional judgment standard is that the head circumference of a person is smaller than the average value of the head circumferences of normal persons with the same age and sex by more than three standard deviations.

Microcephaly is a rare defect of newborn, besides small head, infants with microcephaly are often accompanied by a series of other diseases including epilepsy, developmental retardation (such as language, sitting, standing, walking, etc.), intellectual impairment (such as poor learning and activity), poor mobility and balance, eating difficulty (such as swallowing difficulty), hearing impairment and visual impairment, and studies show that microcephaly newborn has symptoms of atrophy of cerebral cortex and subcortical tissue and diffuse calcification of cerebral tissue. The severity of the above-mentioned disease depends on the condition of the head deformity, can be mild or heavy and can last for life, and in some cases may even be life threatening.

Most microcephaly is caused by autosomal gene mutation, and a plurality of pathogenic genes including mcph1, wdr62, cdk5rap2 and casc5 are discovered at present. These genes can regulate the cell cycle of nerve cells, and although not required for mitosis, the proliferation rate of nerve cells is significantly slowed after loss of function. Japan scholars used gene therapy to transfer the Apc4 gene into mouse embryos with microcephaly and observed partial recovery of nerve cells, but far from clinical use (H Ito, H Shiwaku et al, In vitro gene therapy microorganism used by Pqbp 1-chemotherapy In neural stem promoter cells, Molecular Psychiatry (2015)20, 459-471).

At present, the research aiming at the occurrence mechanism of microcephaly is few, and the research related to the pathogenesis, such as how the cell cycle of nerve cells is slowed down, and which interactions occur among molecules, thereby causing the malformation of nerve cells and skull, is almost unknown. Therefore, how to provide an animal model for microcephaly, which can be applied to research related to microcephaly, has become a problem to be solved urgently.

Disclosure of Invention

Aiming at the defects and practical requirements of the prior art, the sgRNA of the targeted casc5 gene and the application thereof are provided, the sgRNA of the targeted casc5 gene has good specificity and low off-target rate, the specific knockout of the casc5 gene can be realized by matching with Cas9 mRNA, the mutation efficiency is high, the genotype can stably exist, and the application value is high.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect, the invention provides a sgRNA targeting a casc5 gene, wherein the sgRNA targeting a casc5 gene comprises a nucleic acid sequence shown as SEQ ID No. 1.

SEQ ID No.1：GGACCTCTTACATCACTATC。

In the invention, the sgRNA targets the No. 7 exon of the casc5 gene, so that the edited casc5 gene has frame shift mutation, and the protein loses the corresponding biological function, thereby realizing the knockout of the casc5 gene, and the corresponding genotype can stably exist.

In a second aspect, the present invention provides a casc5 gene editing system, wherein the casc5 gene editing system includes the sgRNA targeting the casc5 gene of the first aspect.

Preferably, the casc5 gene editing system further comprises Cas 9.

Preferably, the Cas9 comprises Cas9 nuclease and/or Cas9 mRNA, preferably Cas9 mRNA.

In the invention, the casc5 gene editing system only edits the casc5 gene, the off-target rate is low, and nonspecific gene editing can be avoided; cas9 mRNA is selected to be matched with sgRNA for use, so that the toxic effect on fertilized eggs is small, the survival rate of F0 individuals is increased, and the workload is reduced.

In a third aspect, the present invention provides a recombinant cell comprising the sgRNA targeting the casc5 gene of the first aspect.

Preferably, the recombinant cell comprises the casc5 gene editing system of the second aspect.

Preferably, the recombinant cell is a fertilized egg with a cas 5 gene knocked out from the genome thereof after being edited by the casc5 gene editing system described in the second aspect.

In the invention, by editing the casc5 gene of the fertilized egg, the obtained recombinant cell can transfer the mutant genotype to the progeny cell in a cell division way, thereby realizing the stability and the inheritability of the gene mutation, reducing the workload of screening and having wider application value.

In a fourth aspect, the present invention provides a method for constructing the recombinant cell of the third aspect, the method comprising:

introducing the casc5 gene editing system described in the second aspect into the cytoplasm of a fertilized egg to obtain the recombinant cell.

In the invention, the casc5 gene editing system is directly introduced into the cytoplasm of a fertilized egg, so that the gene editing efficiency is improved; selecting fertilized eggs to construct recombinant cells can reduce the probability of chimera occurrence, ensure that sense mutation can be transmitted to offspring and reduce the workload of later-stage screening.

Preferably, the introducing comprises microinjection.

In a fifth aspect, the present invention provides a method for constructing an animal model with microcephaly, including:

introducing the casc5 gene editing system described in the second aspect into the cytoplasm of a fertilized egg to obtain a recombinant cell;

the recombinant cells develop into F0 generation individuals, and mate with wild type to obtain F1 generation heterozygotes;

selfing the F1 generation heterozygote to obtain an F2 generation homozygote which is the microcephaly animal model.

In the invention, the construction method of the microcephaly animal model is simple to operate and high in success rate; after the homozygote is obtained by screening, the mutant genotype can be stably inherited only by carrying out continuous selfing on the homozygote without secondary screening, which is very convenient and creates convenient conditions for related researches.

Preferably, the preparation method of the casc5 gene editing system comprises the following steps:

in vitro transcription is carried out on the Cas9 gene to obtain the Cas9 mRNA;

mixing the Cas9 mRNA with the sgRNA targeting the casc5 gene of the first aspect to obtain the casc5 gene editing system.

Preferably, the fertilized egg comprises fertilized eggs of zebrafish.

Preferably, the individuals of the F0 generation, the heterozygotes of the F1 generation and the homozygotes of the F2 generation are identified by PCR amplification and sequencing.

Preferably, the primer for PCR amplification comprises a nucleic acid sequence shown as SEQ ID No. 2-3.

SEQ ID No.2：CAAGACGACAATTCTGGCGATAT；

SEQ ID No.3：CAGTTCTTCCTGTTCGGTTTGAG。

As a preferred technical scheme, the construction method of the microcephaly animal model comprises the following steps:

(1) in vitro transcription of mRNA of the Cas9 gene, and mixing with sgRNA targeting the casc5 gene to obtain the casc5 gene editing system;

(2) collecting fertilized eggs of the zebra fish, and microinjecting the casc5 gene editing system into cytoplasm of the fertilized eggs of the zebra fish to obtain recombinant cells;

(3) culturing the recombinant cells, extracting DNA of tail fin tissues after the recombinant cells grow into zebra fish individuals, performing PCR amplification by using SEQ ID Nos. 2-3, performing sequencing identification on amplification products, and selecting the zebra fish individuals with casc5 gene deletion as F0 generations of zebra fish;

(4) hybridizing the zebra fish of the F0 generation with wild zebra fish to obtain zebra fish of a heterozygote of the F1 generation;

(5) selfing the F1 generation heterozygous zebra fish, performing PCR amplification by using SEQ ID No. 2-3, performing sequencing identification on an amplification product, and screening the F2 generation casc5 gene knockout homozygous zebra fish, namely the microcephaly animal model.

In a sixth aspect, the present invention provides a use of any one or a combination of at least two of the sgRNA targeting the casc5 gene of the first aspect, the casc5 gene editing system of the second aspect, the recombinant cell of the third aspect, the method for constructing the recombinant cell of the fourth aspect, or the method for constructing the microcephalic disease animal model of the fifth aspect, in drug screening for microcephalic disease.

In the invention, the sgRNA and casc5 gene editing systems of the targeted casc5 gene have good specificity and low off-target rate; the recombinant cell and the construction method of the recombinant cell improve the efficiency of gene editing and reduce the workload of screening; the construction method of the microcephaly animal model is mature in technology and simple to operate, the mutated genotype can stably exist, the repeatability is strong, the method is suitable for being applied to relevant mechanism research and drug screening, and the application value is extremely wide.

Compared with the prior art, the invention has the following beneficial effects:

(1) the sgRNA targeting the casc5 gene and the casc5 gene editing system have good specificity and extremely low off-target rate, and the gene editing efficiency is high; the casc5 gene editing system is directly introduced into the cytoplasm of a fertilized egg, and the constructed recombinant cell can transfer the mutant genotype to a progeny cell in a cell division manner, so that the stability and the heritability of gene mutation are realized, and the workload of screening is reduced;

(2) according to the invention, a microcephaly animal model is established by knocking out the casc5 gene, the technology is mature, the operation is simple, the success rate is high, and good repeatability is achieved; the constructed homozygous zebra fish with the knockout casc5 gene generates a-3 bp and a +11bp frameshift mutation, compared with wild zebra fish embryos, the zebra fish with the knockout homozygous mutation has obvious developmental retardation and small head phenotype in 48hpf (hop transfer), dies after 4dpf (day transfer), and basically accords with the phenotype of microcephaly caused by the mutation of the casc5 gene of human beings, and the in-situ hybridization result shows that the expression of the casc5 gene cannot be detected in the mutant homozygous zebra fish embryos, thereby providing powerful tools and new ideas for the research of the pathogenic mechanism of the microcephaly and the screening of related medicines.

Drawings

FIG. 1 shows the sequencing results of wild-type zebrafish, F1 generation heterozygous zebrafish and F2 generation mutant homozygous zebrafish in example 4 of the present invention;

FIG. 2A is a photograph of a wild-type zebrafish 24hpf embryo in example 5 of the present invention;

FIG. 2B is a photograph of a casc5 homozygous mutant zebrafish 24hpf embryo in example 5 of the present invention;

FIG. 2C is a photograph of a wild-type zebrafish 48hpf embryo in example 5 of the present invention;

FIG. 2D is a photograph showing casc5 homozygous mutant zebrafish 48hpf embryo in example 5 of the present invention;

FIG. 3A is a photograph of an in situ hybridization of a wild-type zebrafish 24hpf embryo according to example 6 of the present invention;

FIG. 3B is a photograph of an in situ hybridization of a homozygous zebrafish 24hpf embryo with a casc5 knockout gene as described in example 6 of the present invention.

Detailed Description

To further illustrate the technical means adopted by the present invention and the effects thereof, the present invention is further described below with reference to the embodiments and the accompanying drawings. It is to be understood that the specific embodiments described herein are merely illustrative of the invention and are not limiting of the invention.

The examples do not show the specific techniques or conditions, according to the technical or conditions described in the literature in the field, or according to the product specifications. The reagents or apparatus used are conventional products commercially available from normal sources, not indicated by the manufacturer.

Materials:

in vitro transcription kits were purchased from Ambion corporation;

PCR amplification reagents were purchased from Genestar;

NaOH and Tris were purchased from sigma;

the zebra fish is from a national zebra fish resource center strain TU;

the zebra fish breeding conditions are as follows: feeding at 28 deg.C, salinity of 0.25 ‰, and pH of 7.0 under light and dark conditions of 14h/10h for 2 times per day, and feeding fresh Toyota arborescens as feed to provide sufficient amount of feed for zebra fish to freely feed.

Paraformaldehyde from sigma;

proteinase K was purchased from Thermo fisher;

blocking buffer was purchased from Roche;

Anti-digoxigenin-AP antibody was purchased from Roche;

NBT/BCIP dye was purchased from Roche.

Example 1

The present example provides a sgRNA targeting a casc5 gene, wherein the sgRNA targeting a casc5 gene includes a nucleic acid sequence shown in SEQ ID No. 1.

SEQ ID No.1：GGACCTCTTACATCACTATC。

The sgRNA targets the No. 7 exon of the casc5 gene to trigger gene frame shift mutation, and the casc5 protein loses biological function, so that the gene knockout effect is achieved.

Example 2

The present example provides a casc5 gene editing system, and the casc5 gene editing system includes sgRNA targeting a casc5 gene and Cas9 mRNA.

Through the matching of sgRNA of a targeted casc5 gene and Cas9 mRNA, the casc5 gene editing system can specifically knock out the casc5 gene, has good specificity, low off-target rate and small toxic effect on cells, and an edited individual is easier to survive and has higher efficiency.

Example 3

This example provides a recombinant cell, which is a fertilized egg of zebrafish with mutant casc5 gene in its genome, edited by the casc5 gene editing system described in example 2.

The recombinant cell is constructed by the following method:

(1) in vitro transcription of mRNA of a Cas9 gene, and mixing with sgRNA targeting a casc5 gene to obtain the casc5 gene editing system, wherein the final concentration of the sgRNA is 25 ng/mu L, and the final concentration of the Cas9 mRNA is 100 ng/mu L;

(2) collecting fertilized eggs of the zebra fish, and microinjecting the casc5 gene editing system into cytoplasm of the fertilized eggs of the zebra fish to obtain recombinant cells;

wherein, the casc5 gene editing system is required to be injected into the cytoplasm of fertilized eggs of zebra fish at the 1-cell stage, and 3nL of each fertilized egg is required to be injected.

The casc5 gene editing system is directly injected into the cytoplasm of the fertilized egg of the zebra fish in a microinjection manner, so that the gene editing efficiency is improved; fertilized eggs in the period of 1 cell are selected to construct recombinant cells, sense mutation can be inherited through cell division, the probability of chimera occurrence is reduced, the edited genotype can be inherited to filial generations, and the screening workload is reduced.

Example 4

In this example, the recombinant cells constructed in example 3 were cultured to construct an animal model of microcephaly, which specifically comprises the following steps:

(1) culturing the recombinant cells described in the embodiment 3, extracting DNA of tail fin tissues after the recombinant cells grow into zebra fish individuals, performing PCR amplification by using SEQ ID Nos. 2-3, performing sequencing identification on amplification products, and selecting the zebra fish individuals with casc5 gene deletion as F0-generation zebra fish;

the DNA extraction steps are as follows:

shearing zebra fish tail fins with the length of 1mM, adding 50 mu L of NaOH solution with the concentration of 50mM, incubating for 15min at 95 ℃, adding 5 mu L of Tris-HCl with the concentration of 1M for neutralization, and centrifuging to obtain a supernatant, namely the amplified DNA template.

The system and procedure for PCR amplification was as follows:

pre-denaturation at 95 ℃ for 5 min;

denaturation at 94 ℃ for 30 s;

annealing at 55 ℃ for 30 s;

stretching at 72 ℃ for 40 s;

the cycle number is 35;

and (5) extending the cycle for 5min at 72 degrees.

SEQ ID No.2：CAAGACGACAATTCTGGCGATAT；

SEQ ID No.3：CAGTTCTTCCTGTTCGGTTTGAG。

(2) Hybridizing the zebra fish of the F0 generation with wild zebra fish to obtain zebra fish of a heterozygote of the F1 generation;

(3) selfing the F1 generation heterozygous zebra fish, performing PCR amplification by using SEQ ID No. 2-3, performing sequencing identification on an amplification product, and screening the F2 generation casc5 gene knockout homozygous zebra fish, namely the microcephaly animal model.

Through screening, the homozygous zebra fish with the casc5 gene knockout, namely the microcephaly animal model, is successfully constructed in the embodiment. Sequencing identification shows that the casc5 gene of the microcephaly animal model has-3 bp, +11bp frameshift mutation, the deleted sequence is shown as SEQ ID No.4, and the inserted sequence is shown as SEQ ID No. 5.

SEQ ID No.4：ACT；

SEQ ID No.5：TTACATCTTAC。

The sequencing results of wild-type zebrafish, heterozygous zebrafish F1 and mutant homozygous zebrafish F2 are shown in fig. 1. It is evident from the figure that the gene of F2 generation mutant homozygous zebra fish has been mutated. The genotype of zebrafish generation F1 was a wild type/mutant heterozygote and thus was multimodal at the site of mutation.

Example 5

This example demonstrates the phenotypic characterization of homozygous zebrafish with the casc5 knockout screened in example 4.

Wild-type zebra fish embryos and casc5 homozygous mutant zebra fish embryos are cultured under the same conditions and observed, and the results are shown in fig. 2A to 2D. Compared with the phenotype of the wild zebra fish 24h after fertilization (figure 2A) and 48h after fertilization (figure 2C), the mutant homozygous casc5 zebra fish obviously shows the phenotype of delayed development and smaller head at 24h after fertilization (figure 2B) and 48h after fertilization (figure 2D), and dies at the 4 th day after fertilization, and is basically consistent with the phenotype of the microcephaly disease caused by casc5 gene deletion in clinical human, which further proves that the construction method of the microcephaly animal model is scientific and reasonable, and the result is real and reliable.

Example 6

In this example, the detection of the casc5 gene of the homozygous zebra fish with the casc5 gene knockout screened in example 4 is performed on the mRNA level by whole in situ hybridization, and the specific steps are as follows:

all the following steps must be carried out on a decolourisation shaker.

(1) Immobilization of zebrafish embryos

Zebrafish embryos were collected in EP tubes, 30 per tube. After one PBST rinse, 1mL of 4% paraformaldehyde was added and incubated overnight at 4 ℃. Fixed embryos were rinsed with PBST, 3 times for 5min each at room temperature. Gradient dehydration was performed with 50% methanol solution (diluted with PBST) and 100% methanol solution, respectively, each time incubated at room temperature for 5 min. The 100% methanol solution is replaced for 1 time, and the mixture is kept at-20 ℃ overnight, so that the product can be stored for a long time.

(2) Probe incubation

The fixed embryos were subjected to gradient rehydration with 75%, 50% and 25% methanol solutions (PBST dilution), respectively, each time with incubation at room temperature for 5 min. Rinse 3 times with PBST at room temperature for 5min each time. Treating with proteinase K for 1min to increase tissue permeability.

Embryos were rinsed with PBST, fixed with 4% paraformaldehyde at room temperature for 20min, and rinsed with PBST at room temperature 3 times for 5min each.

Add hybridization buffer and incubate at 65 ℃ for 30 min. Fresh hybridization buffer was replaced and prehybridization was carried out at 65 ℃ for 3 h. The prehybridization buffer was recovered and replaced with 500ng/mL RNA probe in buffer and incubated overnight at 65 ℃.

The sequence of the probe is shown as SEQ ID No. 6.

SEQ ID No.6：

GAACTGGATGAATCTTTGGCTGTACCCATGAAAGAAGAGTTTTTAATAGACGATGTCTTCGAGTCAGGCACAAGCCCTTCTTTTAAAAGGCCACATCCAGAGGAAGAACCTATTACACCAGAACAAACCAAGAAGACCTGTGTTTCTGACATGGGGTCTGACTGTCATGAAGCTGCCGTACAGTGGGAAGGTAATTTTACAAGGCATGCCGCTCAGAATCCCAAGGCAAAGACAATTGAAGATACAGGAGTCTCTGAATCCACTCTCAGGCACTCGCAGTTTGACTCTCATATGGACGGCATGCAGGATAATCTATTTGATTTTAATAAGAAACTTGAGGACGGAAGCATCACAGTGAACGAGTTTCTTAGCCACTTTGGCATCAAATTCGTCATCCACAGATCTAGACCAAGTGCTCTGCCTGTCAGGTGTGGCGCTGGTGAGACACGCACCATCGAAGATTTGCTGAAAGAAAAATACATAAGCCACCCCAAGCAGAGAGTATATGAGCAAGACTGTAAGAACATTACAGAAATAGTGGAGAGACTTAAAGAACAAATGTCTGCACAAGAGAAATCCCTGAGAAGCATCAATGGAGCCCTTCAACAAGAGATATGTACTCTCTCTGAAGAACAGTTAAAAAGCTTTGGATCCAAGTTGAAGGAGCGAAGGGCTTATTTTGGGAAGAAAAGCAAAGCAGTTTCTCATGAAATGAAAGGAGTGTTGTACTCTGAGCTCATAAAAACAACACAGGATGCAAAACTGAGCCTGATATCTAAAATCAAAGAGACAGATGAAATGATTGAAGACTTGGATGGCTGCATTAAAGATTTAGAAACCGATCTTGCGTCAGTTGATGCCATGATCACAGGGGATCGTCTTGATCTTCCTCAAGCAGGACCAGCCTTAAAAGCCAAGGAAGAAGATTTGCATCGACTCAATTCAGCTGTCACTTTCAAAGAGAGGGAAATTGGTGAGCTGGAGATTCAGCTGAAGACTTTGGAGAGCCAACAGGAGAAGCTGCAAGGGGAATCCAGTAGCCTTAAGAGTCATCTGGCAACTTTAAACAGTTTGAACGAGTGGCGTCTTGAAGCGACAGATGAAACAGGGGCTTTGTTTTCCTTCCTTCATAAAACTGTGCATCTGCAGGTGAACCTTCAAACACCTGCTGGGAAGGAATGGATGACTGAGGATGTGGAGAGAAATGTAGATGTAGTCTTCCAGTTGCAGCTGGATGGACAAAAGTCAGAATGTCATGCAAGCATGATTCATAATTTACTCGCAACGAAGATTGAGTCTCAAAGTCATTGGAAACAGAGGTACACAACAACCAGACATATACCAGAGCTCTTGCATACCATGAGTTTGGTGGTGGGTCGTCTCAGGCTTTTGGGTGAGGAGATTCACCGGTTGAAGAAGTGGGGAGGTTTGAGGCTTAGAATACTGAAAATCACTTGTACGGATACACGAGTTCATGTCATCTTCTCAAGTCTGAAATCCTTTGAAAAGTTTGAGCTGAGTCTGACGGTCACTCCAGACTATCCCTTTGGACCACTTCACATACAGGACTTCAAAAACCACATGGGAAACACAAGGTTGGATCAGCTCGAGGAGATCATATCGTCAGTTAAACCAGCCAAGAACTATCTGTCAAAAATCCTCAAGAAGATCCACGATGACCTCCTGTGCTAGGACCTCAGGTCTTATTGTTTACTCTGTTCTGTCTTTTAAATGTTTGTACATGTTTGTATTATCCCAAAATAAATGTGGCCGTAAACTACAAGTTTGC。

(3) Antibody incubation

The buffer containing the probe was recovered and the embryos rinsed with 50% formamide/2 XSSCT, 2 XSSCT and 0.2 XSSCT solutions, respectively, pre-warmed at 65 deg.C, each incubated 2 times at 65 deg.C for 20min each. PBST was rinsed 3 times at room temperature for 5min each time, blocking buffer was added, and incubation was carried out at room temperature for 1 h. The cells were incubated overnight at 4 ℃ with blocking buffer containing antibody (Anti-digoxigenin-AP, 1: 4000).

(4) Dyeing process

The antibody was recovered and PBST rinsed 6 times for 20min at room temperature, and then rinsed 2 times for 10min at Buffer 9.5T at room temperature. Adding NBT/BCIP dye solution, and dyeing for 20 min. The plates were rinsed 2 times with PBST at room temperature and observed under a stereomicroscope for 5min each time.

The overall in situ hybridization pictures of the wild-type zebrafish 24hpf embryo and the casc5 knockout homozygous zebrafish 24hpf embryo are shown in fig. 3A and fig. 3B, respectively. As can be seen from the figure, after 24h of fertilization, the casc5 gene in the wild zebra fish embryo is mainly expressed at the head, while the expression of the casc5 gene in the homozygous zebra fish with the casc5 gene knockout cannot be detected, which indicates that the expression of the casc 3526 gene cannot be detected at the mRNA level after the casc5 gene knockout, and further proves the correctness of the construction method of the microcephaly animal model, and the method has wide application value.

In conclusion, the sgRNA targeting the casc5 gene is synthesized, the sgRNA and the Cas9 mRNA form a casc5 gene editing system, the sgRNA and the Casc 9 mRNA are injected into the fertilized eggs of the zebra fish in the cell period of 1 cell in a microinjection manner, and the homozygous zebra fish with the casc5 gene knocked out is successfully screened through identification and screening, namely the microcephalic animal model. The homozygous zebra fish with the casc5 gene knockout obviously shows symptoms of small head and slow development within 48h after fertilization, dies on the 4 th day after fertilization and is consistent with symptoms of human casc5 gene-deleted microcephaly diseases; the result of the whole in situ hybridization shows that the expression of the casc5 gene cannot be detected on the mRNA level of the mutant homozygous zebra fish, and the correctness of the construction method of the animal model is further proved; the method for constructing the microcephaly animal model is mature in technology, low in workload and high in efficiency, and has wide application prospects in microcephaly pathogenesis research and related drug screening.

The applicant states that the present invention is illustrated in detail by the above examples, but the present invention is not limited to the above detailed methods, i.e. it is not meant that the present invention must rely on the above detailed methods for its implementation. It should be understood by those skilled in the art that any modification of the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific modes, etc., are within the scope and disclosure of the present invention.

Sequence listing

<110> southern university of science and technology

<120> sgRNA targeting casc5 gene and application thereof

<130> 2021

<160> 6

<170> PatentIn version 3.3

<210> 1

<211> 20

<212> DNA

<213> Artificial sequence

<400> 1

ggacctctta catcactatc 20

<210> 2

<211> 23

<212> DNA

<213> Artificial sequence

<400> 2

caagacgaca attctggcga tat 23

<210> 3

<211> 23

<212> DNA

<213> Artificial sequence

<400> 3

cagttcttcc tgttcggttt gag 23

<210> 4

<211> 3

<212> DNA

<213> Artificial sequence

<400> 4

act 3

<210> 5

<211> 11

<212> DNA

<213> Artificial sequence

<400> 5

ttacatctta c 11

<210> 6

<211> 1789

<212> DNA

<213> Artificial sequence

<400> 6

gaactggatg aatctttggc tgtacccatg aaagaagagt ttttaataga cgatgtcttc 60

gagtcaggca caagcccttc ttttaaaagg ccacatccag aggaagaacc tattacacca 120

gaacaaacca agaagacctg tgtttctgac atggggtctg actgtcatga agctgccgta 180

cagtgggaag gtaattttac aaggcatgcc gctcagaatc ccaaggcaaa gacaattgaa 240

gatacaggag tctctgaatc cactctcagg cactcgcagt ttgactctca tatggacggc 300

atgcaggata atctatttga ttttaataag aaacttgagg acggaagcat cacagtgaac 360

gagtttctta gccactttgg catcaaattc gtcatccaca gatctagacc aagtgctctg 420

cctgtcaggt gtggcgctgg tgagacacgc accatcgaag atttgctgaa agaaaaatac 480

ataagccacc ccaagcagag agtatatgag caagactgta agaacattac agaaatagtg 540

gagagactta aagaacaaat gtctgcacaa gagaaatccc tgagaagcat caatggagcc 600

cttcaacaag agatatgtac tctctctgaa gaacagttaa aaagctttgg atccaagttg 660

aaggagcgaa gggcttattt tgggaagaaa agcaaagcag tttctcatga aatgaaagga 720

gtgttgtact ctgagctcat aaaaacaaca caggatgcaa aactgagcct gatatctaaa 780

atcaaagaga cagatgaaat gattgaagac ttggatggct gcattaaaga tttagaaacc 840

gatcttgcgt cagttgatgc catgatcaca ggggatcgtc ttgatcttcc tcaagcagga 900

ccagccttaa aagccaagga agaagatttg catcgactca attcagctgt cactttcaaa 960

gagagggaaa ttggtgagct ggagattcag ctgaagactt tggagagcca acaggagaag 1020

ctgcaagggg aatccagtag ccttaagagt catctggcaa ctttaaacag tttgaacgag 1080

tggcgtcttg aagcgacaga tgaaacaggg gctttgtttt ccttccttca taaaactgtg 1140

catctgcagg tgaaccttca aacacctgct gggaaggaat ggatgactga ggatgtggag 1200

agaaatgtag atgtagtctt ccagttgcag ctggatggac aaaagtcaga atgtcatgca 1260

agcatgattc ataatttact cgcaacgaag attgagtctc aaagtcattg gaaacagagg 1320

tacacaacaa ccagacatat accagagctc ttgcatacca tgagtttggt ggtgggtcgt 1380

ctcaggcttt tgggtgagga gattcaccgg ttgaagaagt ggggaggttt gaggcttaga 1440

atactgaaaa tcacttgtac ggatacacga gttcatgtca tcttctcaag tctgaaatcc 1500

tttgaaaagt ttgagctgag tctgacggtc actccagact atccctttgg accacttcac 1560

atacaggact tcaaaaacca catgggaaac acaaggttgg atcagctcga ggagatcata 1620

tcgtcagtta aaccagccaa gaactatctg tcaaaaatcc tcaagaagat ccacgatgac 1680

ctcctgtgct aggacctcag gtcttattgt ttactctgtt ctgtctttta aatgtttgta 1740

catgtttgta ttatcccaaa ataaatgtgg ccgtaaacta caagtttgc 1789