1. A method for improving the bacterial leaf blight resistance of rice is characterized in that the OsRLK1 gene of the rice is knocked out, or the OsRLK1 gene is inactivated, so that the OsRLK1 protein is inactivated.

2. The method of claim 1, wherein the RLK1 gene is knocked out using CRISPR technology.

3. The method of claim 2, wherein the nucleotide sequence set forth in SEQ ID NO: 3 and/or SEQ ID NO: 4 knockdown of the RLK1 gene.

4. The method of claim 4, wherein the target sequence is ligated into a Cas9 vector driven by the U6a promoter to obtain a targeting vector; and introducing the targeting vector into a wild rice plant through an agrobacterium-mediated genetic transformation system, and screening and/or identifying to obtain a positive transgenic plant.

5. The method of claim 4, wherein the nucleotide sequence set forth in SEQ ID NO: 5-6 for screening and/or identifying.

6. The method of claim 4, wherein resistance to the Cas9 vector is selected and/or identified.

7. A target sequence for constructing rice with resistance to bacterial blight is characterized in that the nucleotide sequence is shown as SEQ ID NO: 3 to 4.

8. The use of the target sequence of claim 7 in the construction of rice resistant to bacterial blight or OsRLK1 gene-deleted rice.

Application of an inhibitor of OsRLK1 gene and/or OsRLK1 protein in improving bacterial leaf blight resistance of rice.

Background

Rice is one of the most important grain crops in the world and is also the main grain crop in China. Rice is affected by about 70 pathogens, particularly viruses, bacteria, fungi and nematodes, during its growth, which not only deprive the rice of nutrients but also disturb the growth and development process of rice, and severely reduce yield by causing tissue damage to the host through the production of toxins, cell wall degrading enzymes and toxic proteins. How to reduce the loss caused by these diseases has been the focus of rice research. The improvement of disease resistance by genetically modifying a disease resistance gene in rice can reduce the use of pesticides and is the best practice for environmental friendliness. By gene function excavation, a new disease-resistant variety is developed to protect the rice from being damaged by pathogens, and the method has very important significance for clarifying the molecular mechanism of rice disease resistance and further improving the disease resistance and yield of the rice.

The bacterial blight of rice is bacterial wilt caused by xanthomonas oryzae, and is a bacterial disease causing the greatest harm to rice in the world. Xanthomonas relies mainly on various effectors secreted through various types of secretory protein systems to attack plants to suppress host immunity and obtain nutrition from plants. In response, plants have a precise immune system that can detect invading microorganisms and initiate defense responses.

Plant innate immunity is a bi-layer immune system consisting of Pattern Recognition Receptor (PRR) triggered immunity (PTI) and Effector Triggered Immunity (ETI) (1). The pattern recognition receptor-triggered immunity is the first line of defense in plant innate immunity, enhancing the basic defense capacity of plants to resist most invading pathogens, while the effector-triggered immune response is more often associated with an allergic response (a programmed cell death), and the plant resistance (R) gene encodes a protein that interacts with the effector of a particular pathogen and confers dominant resistance to the pathogen. Both innate immune responses and effector-triggered immunity are mediated by a complex network of signaling pathways that activate the expression of defense response genes, such as pathogenesis-related genes (PR), Reactive Oxygen Species (ROS), glucanases, chitinases, secondary metabolites, stomatal closure, and callus and lignin deposition.

The most well studied pattern recognition receptor-triggered immune pathway in the model plant Arabidopsis thaliana is initiated by the receptor kinase FLS 2. When bound to bacterial flagellin flg22, FLS2 rapidly binds to another receptor-like kinase BAK1, activating the downstream immune response. At present, the research on the prior immunity of the receptor-like protein kinase in arabidopsis thaliana is more, the report on the disease-resistant immune reaction of the receptor-like protein kinase in rice is less, the molecular mechanism is not clear, and the disease-resistant factor in rice needs to be further researched.

Disclosure of Invention

The invention aims to overcome the defects in the prior art and provide a method for improving the bacterial leaf blight resistance of rice.

The first purpose of the invention is to provide a method for improving the bacterial leaf blight resistance of rice.

The second purpose of the invention is to provide a target sequence for constructing rice with resistance to bacterial blight.

The third purpose of the invention is to provide the application of the target sequence in constructing rice resisting bacterial leaf blight or OsRLK1 gene deletion rice.

The fourth purpose of the invention is to provide the application of the inhibitor of OsRLK1 gene and/or OsRLK1 protein in improving the bacterial blight resistance of rice.

In order to achieve the purpose, the invention is realized by the following scheme:

the invention claims a method for improving rice bacterial leaf blight resistance, which knocks out a rice OsRLK1 gene, or inactivates an OsRLK1 gene, so that OsRLK1 protein is inactivated.

The nucleotide sequence of the rice OsRLK1 gene, namely Os06G22810, is shown as SEQ ID NO: 1 is shown in the specification; the amino acid sequence of the encoded protein is shown as SEQ ID NO: 2, respectively.

Preferably, the RLK1 gene is knocked out using CRISPR technology.

More preferably, the nucleotide sequence shown as SEQ ID NO: 3 and/or SEQ ID NO: 4 knockdown of the RLK1 gene.

Most preferably, the nucleotide sequence as set forth in SEQ ID NO: 3 and SEQ ID NO: 4 knockdown of the RLK1 gene.

More preferably, the target sequence is ligated into a Cas9 vector, which is driven by the U6a promoter, to obtain a targeting vector; and introducing the targeting vector into a wild rice plant through an agrobacterium-mediated genetic transformation system, and screening and/or identifying to obtain a positive transgenic plant.

More preferably, the nucleotide sequence shown as SEQ ID NO: 5-6 for screening and/or identifying.

More preferably, resistance to the Cas9 vector is screened and/or identified.

The invention also protects a target sequence for constructing rice with bacterial leaf blight resistance, and the nucleotide sequence is shown as SEQ ID NO: 3 and/or SEQ ID NO: 4, respectively.

More preferably, the nucleotide sequence is as set forth in SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

And the application of the target sequence in constructing rice resisting bacterial blight or OsRLK1 gene deletion rice.

The invention also protects the application of the inhibitor of OsRLK1 gene and/or OsRLK1 protein in improving the bacterial leaf blight resistance of rice.

Compared with the prior art, the invention has the following beneficial effects:

the invention discloses a new molecular mechanism for regulating and controlling rice disease resistance and provides a new method for resisting rice bacterial blight, wherein a receptor-like kinase gene OsRLK1 in rice is edited by utilizing a genome target, so that an immune signal of the rice can be activated, and the rice disease resistance is realized.

Drawings

FIG. 1 shows the editing of OsRLK1 gene: FIG. 1A is a model of OsRLK1 gene, the OsRLK1 gene includes one intron and two exons, and two target points T1 and T2 are selected from the second exon as targeted editing sites; FIG. 1B shows the gene editing of 8 stably inherited mutant lines.

FIG. 2 is a map of CRISPR/Cas9 vector used in the present invention.

FIG. 3 is the active oxygen burst of OsRLK1 mutant Osrlk 1: FIG. 3A shows the active oxygen burst phenotype of Osrlk1, with leaf yellowing and cell death on a10 cm scale; FIG. 3B is trypan blue staining with enhanced cell death of Osrlk1 compared to wild type ZH 11; FIG. 3C is a DAB staining with Osrlk1 showing higher accumulation of hydrogen peroxide than wild type ZH 11; FIG. 3D shows NBT staining with Osrlk1 showing higher superoxide anion accumulation than wild-type ZH 11.

FIG. 4 shows that OsRLK1 mutant Osrlk1 has the function of improving the bacterial leaf blight resistance of rice: FIG. 4A is a plot length measurement of 30 biological replicates of Xanthomonas oryzae pv. oryzae guangdong 4 lesions, with asterisks indicating 2 differences in phosphorus levels (Student's T-test), significant (ρ <0.05), very significant (ρ <0.01), and 1cm on the scale; fig. 4B shows that the spot length measurements of inoculated b.albugenosus Xanthomonas oryzae pv. oryzae guangdong 5 are the mean and standard error of 30 biological replicates, the asterisks indicate 2 sample-to-sample differences (Student's T-test), the asterisks indicate significant differences (ρ <0.05), the asterisks indicate very significant differences (ρ <0.01), and the scale indicates 1 cm.

Fig. 5 shows that RLK1 mutant Osrlk1 causes activation of resistance genes and activates disease resistance signal response of rice, qRT-PCR detects seven-week-seedling resistance related genes (N ═ 3) of mutant Osrlk1 and wild-type ZH11, the OsActin gene is used as an internal reference, asterisks represent 2 differences among samples (Student's T-test),. + -. represents significant differences (ρ <0.05),. + -. represents significant differences (ρ <0.01), and experiments are repeated three times, and all have similar results.

Detailed Description

The present invention will be described in further detail with reference to the drawings and specific examples, which are provided for illustration only and are not intended to limit the scope of the present invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.

Example 1 OsRLK1 Gene editing and vector transformation of wild type Rice Z H11

First, experiment method

Designing a gene editing target sequence 1 according to a Nipponbare reference sequence: GAGGCTGCAAGCCGCAACCA (SEQ ID NO: 3), and target sequence 2: AGAGCACGACGCTCGGCACG (SEQ ID NO: 4); the position of which is shown in figure 1A. Firstly, finding out the genome sequence of OsRLK1 from NCBI website (www.ncbi.nlm.nih.gov), then selecting the two targets from the genome sequence of OsRLK1, and respectively connecting the DNA sequences of the two targets together into a Cas9 vector (shown in figure 2) started by a U6a promoter to obtain a double-target targeting vector.

Then, the targeting vector is introduced into a wild-type rice ZH11 plant through genetic transformation mediated by agrobacterium EHA105, the transgenic plant is screened through hygromycin, and the transgenic plant is sequenced and identified by using primers OsRLK1-F and OsRLK1-R (Table 1). As a result, independently transformed individuals were obtained.

TABLE 1 primers for identification

Gene	Primer sequence (5 '→ 3')
		OsRLK1-F	CGAATGGTGGTCGGTCTCC(SEQ ID NO：5)
OsRLK1-R	ACACCTCCCTGGAAATCCT(SEQ ID NO：6)

2. Results of the experiment

Obtaining 8 stably inherited mutant lines in total; as shown in FIG. 1B, 8 gene-edited lines all resulted in a frameshift of the amino acid or premature termination of the coding sequence, all with the same phenotype. Representative lines L1 and L3 were selected as the lines of the study of the present invention.

Example 2 ROS and cell death assays

First, experiment method

(1) DAB dyeing: eight-week-old mutant Osrlk1(L1 and L3) and wild-type ZH11 plants were separately harvested from two leaves, quickly inserted into DAB (pH 3.8) solution at a concentration of 1mg/mL, evacuated for 30 minutes, allowed to stand at room temperature in the dark for 5 hours, and after staining was completed, the color separation was performed in 95% ethanol, and 6 leaves were used for each genotype for measurement.

(2) NBT staining: eight-week-old mutant Osrlk1(L1 and L3) and wild-type ZH11 plants were separately harvested from two leaves, quickly inserted into NBT solution at a concentration of 0.1%, evacuated for 30 minutes, and left to stand at room temperature in the dark for 3 hours, after completion of staining, the color was removed in 95% ethanol, and 6 leaves were used for each genotype for measurement.

(3) Trypan blue staining: two leaves were removed from eight weeks old mutant Osrlk1(L1 and L3) and wild type ZH11 plants, respectively, and trypan blue (10 g phenol, 10 ml glycerol, 10 ml lactic acid, 10 ml ddH) was quickly inserted into the leaves₂O,0.02 g Trypan Blue) solution, boiling for two minutes, treating at room temperature overnight, and decolorizing with 250 g chloral hydrate in 100ml ddH the next day₂O) to remove the color floating.

2. Results of the experiment

As in fig. 3, mutant Osrlk1 died to a higher degree than wild-type ZH 11; the mutant Osrlk1 has higher hydrogen peroxide accumulation than the wild type ZH 11; mutant Osrlk1 has higher superoxide anion accumulation than wild type ZH 11. Indicating that the mutant has ROS outbreak and cell death related to disease resistance.

EXAMPLE 3 Rhizoctonia solani test

First, experiment method

The inoculation was carried out by leaf-cutting method using two strains Xanthomonas oryzae pv. oryzae guard 4 (FIG. 3A) and Xanthomonas oryzae pv. oryzae guard 5 (FIG. 3B), and the cells were cultured in an incubator at 28 ℃ for 2 days to become bright yellow, diluted with PBS solution, and diluted to a concentration of about 9X 10 by turbidimetry⁹bacteria/mL. (the strain is from plant protection research of Guangdong province academy of agricultural sciencesTherefore), mutant Osrlk1(L1 and L3) and wild type ZH11 plants were inoculated at the rice booting stage. The bacterial solution was dipped with scissors during inoculation, the leaves were cut off about 2cm long, and the length of the lesion was measured 21 days after inoculation.

2. Results of the experiment

As shown in fig. 4, the length of lesion of Osrlk1 inoculated with Xanthomonas oryzae pv. oryzae guangdong 4 (fig. 4A) mutant is significantly shorter, and the length of lesion of Osrlk1 inoculated with Xanthomonas oryzae pv. oryzae guangdong 5 (fig. 4B) mutant is also shorter than that of wild type, indicating that mutant Osrlk1 has a definite effect of resisting bacterial blight, and simultaneously confirming that Osrlk1 gene is involved in disease resistance regulation network.

Example 4 real-time quantitative PCR (qRT-PCR) analysis

First, experiment method

Respectively extracting RNA from eight-week-old mutant Osrlk1 and wild type ZH11 plant leaves, performing reverse transcription and qRT-PCR detection, and taking OsActin gene as internal reference, 2^-△△CTThe relative level of gene expression is calculated by function, and the genes used for detection are OsWRKY45, OsWRKY50, OsPR5, OsPBZ1 and OsNAC4, and the primers are shown in Table 2.

TABLE 2qRT-PCR primers

2. Results of the experiment

As shown in figure 5, disease-resistance related genes OsWRKY45, OsWRKY50, OsPR5, OsPBZ1 and OsNAC4 are all remarkably up-regulated in a mutant Osrlk1, which indicates that the mutation of the OsRLK1 gene can cause the activation of resistance genes and activate the disease-resistance signal response of rice.

It should be noted that the above embodiments are only used for illustrating the technical solutions of the present invention, and not for limiting the scope of the present invention, and those skilled in the art can make other variations or modifications based on the above description and ideas, and it is not necessary or exhaustive to all embodiments. Any modification, equivalent replacement, and improvement made within the spirit and principle of the present invention should be included in the protection scope of the claims of the present invention.

Sequence listing

<110> southern China university of agriculture

<120> a method for improving bacterial blight resistance of rice

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2580

<212> DNA

<213> Oryza sativa

<400> 1

atgcccgccg cgcggcgctc cggcggacgg cttacggagg aggtgaacat gatggtggct 60

ctgtccggga ggaagaggag gctgcaagcc gcaaccatgg tggctttgtg tttcttgtca 120

tccatttgcg tttccacagc gcaattcaag cctgccgaca actacctggt ggactgcgga 180

tcctccaaga gcacgacgct cggcacgagg acctttgcgg ctgacggggc tgccccggtg 240

aaggtggaca cctccctgga aatccttgcc ggcacgtcgg cgaatggggt tgcgtcattc 300

gataactcgg cgctttacca gaccgcccgc atcttcacga gcccttcatc gtatactttc 360

ccgatccaga agcagggccg gcattttgtt cgtctctact tcttcgcctt tgcctaccag 420

agctatgatc tttccactgc caagttcacc gtgtcgaccc aagaaatgct cttgcttagt 480

gacttccaac agccagacaa gactgcgcca ttgttcaagg aatactcttt gaacatcacc 540

caagacaagc tcattatttc cttcaagcca tcgaatggaa tcgcattcat caatgcgatt 600

gaagtggttt cagtcccaga tgatctcata ggtgatagtg ccccgatggt caaccctatg 660

cagcagtaca gcggtttatc tacacaacca ttggaaacag tgtaccgtgt taacatgggt 720

ggaccaaagg tcactgcaga caatgatacc ctctccagga cctgggtcac tgacaaaaag 780

tatttagtga acccatctgt gactagagag gttaatgggg ggaaggtcaa ttatatgaaa 840

ggtggaggat caacaccgct gattgctcct gatattgttt atagcacagc tacagaattg 900

gcagcttcga atacaacgaa cgcacttttc aacatgacat ggcagtttga tgtggattca 960

ggtttcagct acttgataag atttcacttc tgtgatatag tcagcaaggc acttaaccaa 1020

ctctatttca atgcatatgt tggcagcttc tatgcgcagc atgatattga tctctcaatt 1080

caatcaatga atcagttggc tacagctatc tatttggatg tggttctttc atcaaatgat 1140

gcatctaaca agctcagcat cagtattggt ccatccactt tgaacaatgc attaccagat 1200

gggattctga atggtcttga ggtcatgaag atgagcagtg gctcaggttc tgctttcact 1260

gttggatcat ctggttcaaa caagaattta ggtgtgatta ttgggtcagt ccttggagct 1320

gttggtattc tgataattgt ccttgtcata gtacttcttt gccgaaagaa aaagactctg 1380

gagaagcagc actcaaagac ttggatgcct ttctctatca atgggctcac ctctctcagt 1440

acaggaagta gaacttctta tggtactact ctcacatcag ggctgaatgg aagctatgga 1500

taccgatttg cctttagcgt gctccaagaa gcaacaaaca attttgatga gaactgggtt 1560

attggcgttg gaggttttgg gaaggtctac aaaggtgtgc tgagggatga caccaaggtt 1620

gcagtgaagc gagggaaccc gaagtctcag caaggtctca atgagttccg tacagagatc 1680

gaactccttt cacggctgcg gcaccgccat ctggtgtccc tgattgggta ttgtgatgaa 1740

aggaatgaga tgatcttggt ctatgaatat atggaaaaag ggactctgaa aagccacctg 1800

tatggctcgg ataacccctc actcaactgg aagcagcggt tggagatttg cattggagca 1860

gcaaggggac ttcactacct tcataccggt tctgcgaagg ctattatcca ccgtgatgtc 1920

aagtctgcaa acatcttgct tgatgagaat ctcctagcaa aggttgctga ctttgggcta 1980

tcaaagactg ggcctgagtt ggaccaaact catgtcagta ctgcagtgaa gggtagcttt 2040

gggtatcttg accctgaata tttccgaagg cagcaactga ctgagaagtc agatgtctac 2100

tccttcggtg ttgttttgct cgaggtgctt tgcgcaaggc cagtgattga ccctacgctc 2160

ccaagggaga tggtgaattt ggcagagtgg gggatgaaat ggcagaagag aggagagctg 2220

catcagatcg tcgatcagcg agtttctggt tcaatcaggc cggattctct gaggaagttt 2280

ggcgaaacag tggagaaatg cctggcggac tacggtgtgg agcggccatc catgggagat 2340

gtcctgtgga acttggagta cgtcctgcag ctccaggatg cagattcatc gacagtatca 2400

gatgtaaaca gcatgaacag gattgtcgaa ctcccgtcgc aagtccagaa catcggcgcc 2460

ctcgagagca tcagcgtgac aatggcggaa gctggagctt cacatgagcc tgatcatgac 2520

ctctccgacg tttccatgag cagggtgttc tctcagctaa tcaaagctga gggaaggtga 2580

<210> 2

<211> 859

<212> PRT

<213> Oryza sativa

<400> 2

Met Pro Ala Ala Arg Arg Ser Gly Gly Arg Leu Thr Glu Glu Val Asn

1 5 10 15

Met Met Val Ala Leu Ser Gly Arg Lys Arg Arg Leu Gln Ala Ala Thr

20 25 30

Met Val Ala Leu Cys Phe Leu Ser Ser Ile Cys Val Ser Thr Ala Gln

35 40 45

Phe Lys Pro Ala Asp Asn Tyr Leu Val Asp Cys Gly Ser Ser Lys Ser

50 55 60

Thr Thr Leu Gly Thr Arg Thr Phe Ala Ala Asp Gly Ala Ala Pro Val

65 70 75 80

Lys Val Asp Thr Ser Leu Glu Ile Leu Ala Gly Thr Ser Ala Asn Gly

85 90 95

Val Ala Ser Phe Asp Asn Ser Ala Leu Tyr Gln Thr Ala Arg Ile Phe

100 105 110

Thr Ser Pro Ser Ser Tyr Thr Phe Pro Ile Gln Lys Gln Gly Arg His

115 120 125

Phe Val Arg Leu Tyr Phe Phe Ala Phe Ala Tyr Gln Ser Tyr Asp Leu

130 135 140

Ser Thr Ala Lys Phe Thr Val Ser Thr Gln Glu Met Leu Leu Leu Ser

145 150 155 160

Asp Phe Gln Gln Pro Asp Lys Thr Ala Pro Leu Phe Lys Glu Tyr Ser

165 170 175

Leu Asn Ile Thr Gln Asp Lys Leu Ile Ile Ser Phe Lys Pro Ser Asn

180 185 190

Gly Ile Ala Phe Ile Asn Ala Ile Glu Val Val Ser Val Pro Asp Asp

195 200 205

Leu Ile Gly Asp Ser Ala Pro Met Val Asn Pro Met Gln Gln Tyr Ser

210 215 220

Gly Leu Ser Thr Gln Pro Leu Glu Thr Val Tyr Arg Val Asn Met Gly

225 230 235 240

Gly Pro Lys Val Thr Ala Asp Asn Asp Thr Leu Ser Arg Thr Trp Val

245 250 255

Thr Asp Lys Lys Tyr Leu Val Asn Pro Ser Val Thr Arg Glu Val Asn

260 265 270

Gly Gly Lys Val Asn Tyr Met Lys Gly Gly Gly Ser Thr Pro Leu Ile

275 280 285

Ala Pro Asp Ile Val Tyr Ser Thr Ala Thr Glu Leu Ala Ala Ser Asn

290 295 300

Thr Thr Asn Ala Leu Phe Asn Met Thr Trp Gln Phe Asp Val Asp Ser

305 310 315 320

Gly Phe Ser Tyr Leu Ile Arg Phe His Phe Cys Asp Ile Val Ser Lys

325 330 335

Ala Leu Asn Gln Leu Tyr Phe Asn Ala Tyr Val Gly Ser Phe Tyr Ala

340 345 350

Gln His Asp Ile Asp Leu Ser Ile Gln Ser Met Asn Gln Leu Ala Thr

355 360 365

Ala Ile Tyr Leu Asp Val Val Leu Ser Ser Asn Asp Ala Ser Asn Lys

370 375 380

Leu Ser Ile Ser Ile Gly Pro Ser Thr Leu Asn Asn Ala Leu Pro Asp

385 390 395 400

Gly Ile Leu Asn Gly Leu Glu Val Met Lys Met Ser Ser Gly Ser Gly

405 410 415

Ser Ala Phe Thr Val Gly Ser Ser Gly Ser Asn Lys Asn Leu Gly Val

420 425 430

Ile Ile Gly Ser Val Leu Gly Ala Val Gly Ile Leu Ile Ile Val Leu

435 440 445

Val Ile Val Leu Leu Cys Arg Lys Lys Lys Thr Leu Glu Lys Gln His

450 455 460

Ser Lys Thr Trp Met Pro Phe Ser Ile Asn Gly Leu Thr Ser Leu Ser

465 470 475 480

Thr Gly Ser Arg Thr Ser Tyr Gly Thr Thr Leu Thr Ser Gly Leu Asn

485 490 495

Gly Ser Tyr Gly Tyr Arg Phe Ala Phe Ser Val Leu Gln Glu Ala Thr

500 505 510

Asn Asn Phe Asp Glu Asn Trp Val Ile Gly Val Gly Gly Phe Gly Lys

515 520 525

Val Tyr Lys Gly Val Leu Arg Asp Asp Thr Lys Val Ala Val Lys Arg

530 535 540

Gly Asn Pro Lys Ser Gln Gln Gly Leu Asn Glu Phe Arg Thr Glu Ile

545 550 555 560

Glu Leu Leu Ser Arg Leu Arg His Arg His Leu Val Ser Leu Ile Gly

565 570 575

Tyr Cys Asp Glu Arg Asn Glu Met Ile Leu Val Tyr Glu Tyr Met Glu

580 585 590

Lys Gly Thr Leu Lys Ser His Leu Tyr Gly Ser Asp Asn Pro Ser Leu

595 600 605

Asn Trp Lys Gln Arg Leu Glu Ile Cys Ile Gly Ala Ala Arg Gly Leu

610 615 620

His Tyr Leu His Thr Gly Ser Ala Lys Ala Ile Ile His Arg Asp Val

625 630 635 640

Lys Ser Ala Asn Ile Leu Leu Asp Glu Asn Leu Leu Ala Lys Val Ala

645 650 655

Asp Phe Gly Leu Ser Lys Thr Gly Pro Glu Leu Asp Gln Thr His Val

660 665 670

Ser Thr Ala Val Lys Gly Ser Phe Gly Tyr Leu Asp Pro Glu Tyr Phe

675 680 685

Arg Arg Gln Gln Leu Thr Glu Lys Ser Asp Val Tyr Ser Phe Gly Val

690 695 700

Val Leu Leu Glu Val Leu Cys Ala Arg Pro Val Ile Asp Pro Thr Leu

705 710 715 720

Pro Arg Glu Met Val Asn Leu Ala Glu Trp Gly Met Lys Trp Gln Lys

725 730 735

Arg Gly Glu Leu His Gln Ile Val Asp Gln Arg Val Ser Gly Ser Ile

740 745 750

Arg Pro Asp Ser Leu Arg Lys Phe Gly Glu Thr Val Glu Lys Cys Leu

755 760 765

Ala Asp Tyr Gly Val Glu Arg Pro Ser Met Gly Asp Val Leu Trp Asn

770 775 780

Leu Glu Tyr Val Leu Gln Leu Gln Asp Ala Asp Ser Ser Thr Val Ser

785 790 795 800

Asp Val Asn Ser Met Asn Arg Ile Val Glu Leu Pro Ser Gln Val Gln

805 810 815

Asn Ile Gly Ala Leu Glu Ser Ile Ser Val Thr Met Ala Glu Ala Gly

820 825 830

Ala Ser His Glu Pro Asp His Asp Leu Ser Asp Val Ser Met Ser Arg

835 840 845

Val Phe Ser Gln Leu Ile Lys Ala Glu Gly Arg

850 855

<210> 3

<211> 20

<212> DNA

<213> Oryza sativa

<400> 3

gaggctgcaa gccgcaacca 20

<210> 4

<211> 20

<212> DNA

<213> Oryza sativa

<400> 4

agagcacgac gctcggcacg 20

<210> 5

<211> 19

<212> DNA

<213> Oryza sativa

<400> 5

cgaatggtgg tcggtctcc 19

<210> 6

<211> 19

<212> DNA

<213> Oryza sativa

<400> 6

acacctccct ggaaatcct 19