Triple fluorescence PCR detection kit for porcine respiratory disease and detection method thereof
1. A triple fluorescence PCR detection kit for porcine respiratory disease is characterized in that: the kit comprises a primer group, wherein the nucleotide sequence of the primer group is as follows:
mycoplasma hyopneumoniae primers:
MHPF2：5'-GATATTAAATCTGGATTTTTC-3'，
MHPR2：5'-ATTGTATTTACCAAAGTCATA-3'；
porcine pasteurella multocida primers:
SAPF2：5'-TCTCTTCATTATTAGTTGCAT-3'，
SAPR1：5'-ACTATTTGATTGAACCGGTT-3'；
porcine actinobacillus pleuropneumoniae primers:
APPF3：5'-GGTATTGAACCTCTTGGTAA-3'，
APPR2：5'-GTCGATAATACTTTCCAAAC-3'；
the kit also comprises a probe, and the nucleotide sequence of the probe is shown as follows:
mycoplasma hyopneumoniae probe:
MHPP1：5'-ACAAGAGATCCAGTCATACCAAGGCA-3'；
porcine pasteurella multocida probe:
SAPP1：5'-TTCCTACACGGTCAGCACGATTTC-3'；
porcine actinobacillus pleuropneumoniae probe:
APPP1：5'-ACTAAGTTAGACCAAAAGCCGCC-3'。
2. the triple fluorescence PCR detection kit for the porcine respiratory disease according to claim 1, which is characterized in that: the probe is also labeled with a fluorescent group and a quenching group, and the fluorescent group is selected from one of FAM, HEX, VIC, TEXASRED, ROX, CY3 and CY 5; the quenching group is selected from one of BHQ1, BHQ2 and BHQ 3; the fluorescent groups labeled by different probes are different.
3. The detection method of the porcine respiratory disease triple fluorescence PCR detection kit according to claim 1, characterized in that: comprises the following steps:
1) extracting sample DNA;
2) taking the extracted DNA as a template, carrying out triple fluorescence quantitative PCR amplification reaction by using primer groups MHPF2, MHPR2, SAPF2, SAPR1, APPF3 and APPR2 and probes MHPP1, SAPP1 and APPP1 to obtain an amplification product;
3) and performing curve analysis on the amplification curve to determine whether the sample contains mycoplasma hyopneumoniae, porcine pasteurella multocida and porcine actinobacillus pleuropneumoniae.
4. The detection method of the triple fluorescence PCR detection kit for porcine respiratory diseases according to claim 3, characterized in that: the fluorescent quantitative PCR amplification reaction system in the step 2) is as follows:
2. mu.L of 2.5 mM/. mu.L dNTPmix, 5. mu.L of 5 XPCR buffer, 0.1. mu.L of 50 pmol/. mu.L primer MHPF2, 0.1. mu.L of 50 pmol/. mu.L primer MHPR2, 0.1. mu.L of 50 pmol/. mu.L primer SAPF2, 0.1. mu.L of 50 pmol/. mu.L primer SAPR1, 0.2. mu.L of 50 pmol/. mu.L primer APPF3, 0.2. mu.L of 50 pmol/. mu.L primer APPR2, 0.05. mu.L of 50 pmol/. mu.L probe MHPP1, 0.08. mu.L of 50 pmol/. mu.L probe SAPP1, 0.15. mu.L of 50 pmol/. mu.L probe APPP1, 1. mu.L of enzyme solution, and 1. mu.L of ddH2O was supplemented to 20. mu.L, and DNA template/positive control/negative control was 5. mu.L.
5. The detection method of the triple fluorescence PCR detection kit for porcine respiratory diseases according to claim 3, characterized in that: the triple fluorescent quantitative PCR reaction procedure of the step 2) is as follows: reverse transcription is carried out for 10-30min at 42-50 ℃ for 1 cycle; pre-denaturation at 93-95 ℃ for 2-10 min for 1 cycle; denaturation at 93-95 ℃ for 5-30 s, annealing at 55-60 ℃, extension and signal acquisition for 30-60 s; and circulating for 40-45 times.
6. The detection method of the triple fluorescence PCR detection kit for porcine respiratory diseases according to claim 4, characterized in that: the PCRbuffer comprises 250mM tris-base, 0.25% TritonX-100, 25mM MgCl22.5% glycerol.
7. The detection method of the triple fluorescence PCR detection kit for porcine respiratory diseases according to claim 4, characterized in that: the enzyme solution contains an antibody-modified hot start enzyme DNA polymerase.
Background
Mycoplasma Hyopneumoniae (MHP), Pasteurella multocida (Pm), and Actinobacillus pleuropneumoniae (App) are 3 common respiratory pathogens of pigs, respectively cause porcine infectious pleuropneumonia, swine plague, etc., cause acute and chronic inflammation of the porcine respiratory tract, and cause high mortality, low weight gain, increased treatment cost, etc. Respiratory diseases are one of the most serious problems in modern pig raising production, and the 3 pathogenic bacteria mixed infection is very common, so that the caused clinical symptoms are difficult to distinguish, the morbidity and the severity of the respiratory diseases of the swinery are improved, and the complexity and the diagnosis difficulty of the diseases are increased. Therefore, it is necessary to establish a diagnostic method capable of rapidly detecting these 3 pathogenic bacteria at the same time.
At present, the nucleic acid diagnosis method based on the real-time fluorescent quantitative PCR technology is one of the most widely applied methods in China, and the principle of the method is mainly based on marking Taq-Man fluorescent probes with different colors. The existing nucleic acid detection kit related to swine diseases mostly adopts a single or double fluorescent probe method to realize the rapid diagnosis of target genes. The invention adopts triple fluorescence quantitative PCR technology, adds 3 fluorescence probes with different color marks in the same reaction system, can realize the purpose of detecting 3 target genes simultaneously in one tube reaction, has high flux and high detection speed, can realize the premixing of reaction liquid and enzyme liquid, can detect the target genes at the upper level by only opening an eight-tube cover and adding the extracted nucleic acid sample into a corresponding reaction tube when in use, greatly saves clinical operation flow, greatly reduces the probability of cross contamination, and is clinically required at present.
Disclosure of Invention
The invention aims to provide a triple fluorescence PCR detection kit for porcine respiratory disease and a detection method thereof, wherein the kit comprises a primer group, and the nucleotide sequence of the primer group is as follows:
mycoplasma hyopneumoniae primers:
MHPF2：5'-GATATTAAATCTGGATTTTTC-3'，
MHPR2：5'-ATTGTATTTACCAAAGTCATA-3'；
porcine pasteurella multocida primers:
SAPF2：5'-TCTCTTCATTATTAGTTGCAT-3'，
SAPR1：5'-ACTATTTGATTGAACCGGTT-3'；
porcine actinobacillus pleuropneumoniae primers:
APPF3：5'-GGTATTGAACCTCTTGGTAA-3'，
APPR2：5'-GTCGATAATACTTTCCAAAC-3'；
the kit also comprises a probe, and the nucleotide sequence of the probe is shown as follows:
mycoplasma hyopneumoniae probe:
MHPP1：5'-ACAAGAGATCCAGTCATACCAAGGCA-3'；
porcine pasteurella multocida probe:
SAPP1：5'-TTCCTACACGGTCAGCACGATTTC-3'；
porcine actinobacillus pleuropneumoniae probe:
APPP1：5'-ACTAAGTTAGACCAAAAGCCGCC-3'。
preferably, the probe is also labeled with a fluorescent group and a quenching group, and the fluorescent group is selected from one of FAM, HEX, VIC, TEXAS RED, ROX, CY3 and CY 5; the quenching group is selected from one of BHQ1, BHQ2 and BHQ 3; the fluorescent groups labeled by different probes are different.
The invention also provides a detection method of the pig respiratory disease triple fluorescence PCR detection kit, which comprises the following steps:
1) extracting sample DNA;
2) taking the extracted DNA as a template, carrying out triple fluorescence quantitative PCR amplification reaction by using primer groups MHPF2, MHPR2, SAPF2, SAPR1, APPF3 and APPR2 and probes MHPP1, SAPP1 and APPP1 to obtain an amplification product;
3) and performing curve analysis on the amplification curve to determine whether the sample contains mycoplasma hyopneumoniae, porcine pasteurella multocida and porcine actinobacillus pleuropneumoniae.
Preferably, the fluorescent quantitative PCR amplification reaction system in step 2) is:
2.5 mM/. mu.L dNTPmix of 2. mu.L, 5 XPCR buffer of 5. mu.L, 50 pmol/. mu.L primer MHPF2 of 0.1. mu.L, 50 pmol/. mu.L primer MHPR2 of 0.1. mu.L, 50 pmol/. mu.L primer SAPF2 of 0.1. mu.L, 50 pmol/. mu.L primer SAPR1 of 0.1. mu.L, 50 pmol/. mu.L primer APPF3 of 0.2. mu.L, 50 pmol/. mu.L primer APPR2 of 0.2. mu.L, 50 pmol/. mu.L probe MHPP1 of 0.05. mu.L, 50 pmol/. mu.L probe SAPP1 of 0.08. mu.L, 50 pmol/. mu.L probe APPP1 of 0.15. mu.L,the enzyme solution is 1 mu L, ddH2O was supplemented to 20. mu.L, and DNA template/positive control/negative control was 5. mu.L.
Preferably, the triple fluorescent quantitative PCR reaction procedure of step 2) is: reverse transcription is carried out for 10-30min at 42-50 ℃ for 1 cycle; pre-denaturation at 93-95 ℃ for 2-10 min for 1 cycle; denaturation at 93-95 ℃ for 5-30 s, annealing at 55-60 ℃, extension and signal acquisition for 30-60 s; and circulating for 40-45 times.
Preferably, the PCR buffer comprises 250mM tris-base, 0.25% TritonX-100, 25mM MgCl22.5% glycerol.
Preferably, the enzyme solution comprises an antibody-modified hot start enzyme DNA polymerase and an enzyme preservation solution.
Compared with the prior art, the invention has the beneficial effects that: the rapid screening method can realize rapid and accurate rapid screening of the mycoplasma hyopneumoniae, the porcine pasteurella multocida and the porcine actinobacillus pleuropneumoniae in the sample. The method is simple to operate, high in accuracy, good in specificity and good in repeatability, and is favorable for popularization and application in clinical practice.
Drawings
FIG. 1 is a graph of the amplification of 10 fold dilution gradient series samples of positive standard of triple fluorescent quantitative PCR kit for Mycoplasma hyopneumoniae, Pasteurella multocida, and Actinobacillus pleuropneumoniae;
FIG. 2 is a graph of a FAM channel quantitative standard for Mycoplasma hyopneumoniae;
FIG. 3 is a graph of the HEX channel quantitative standard of porcine Pasteurella multocida;
FIG. 4 is a graph of the CY5 channel quantification standard for A. pleuropneumoniae;
FIG. 5 is a graph showing the results of amplification of a positive control sample by the method of the present invention;
FIG. 6 is a graph showing the results of amplification of a negative control sample by the method of the present invention;
FIG. 7 is a graph showing the results of amplification detection of 10 samples by the method of the present invention.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
Example 1 triple fluorescent quantitative PCR primers and probes for mycoplasma hyopneumoniae, pasteurella hyopneumoniae and actinobacillus pleuropneumoniae.
According to the nucleic acid sequences of mycoplasma hyopneumoniae, porcine pasteurella multocida and porcine actinobacillus pleuropneumoniae, a large number of primers and probes for detecting the mycoplasma hyopneumoniae, the porcine pasteurella multocida and the porcine actinobacillus pleuropneumoniae are respectively designed; through a large number of screening experiments, a group of primers and probe groups with high sensitivity and good specificity are screened out, and the sequences are as follows:
mycoplasma hyopneumoniae primers:
MHPF2：5'-GATATTAAATCTGGATTTTTC-3'，
MHPR2：5'-ATTGTATTTACCAAAGTCATA-3'；
porcine pasteurella multocida primers:
SAPF2：5'-TCTCTTCATTATTAGTTGCAT-3'，
SAPR1：5'-ACTATTTGATTGAACCGGTT-3'；
porcine actinobacillus pleuropneumoniae primers:
APPF3：5'-GGTATTGAACCTCTTGGTAA-3'，
APPR2：5'-GTCGATAATACTTTCCAAAC-3'。
mycoplasma hyopneumoniae probe:
MHPP1：5'-ACAAGAGATCCAGTCATACCAAGGCA-3'；
porcine pasteurella multocida probe:
SAPP1：5'-TTCCTACACGGTCAGCACGATTTC-3'；
porcine actinobacillus pleuropneumoniae probe:
APPP1：5'-ACTAAGTTAGACCAAAAGCCGCC-3'；
in a preferred embodiment, during the PCR detection, the different gene probes are labeled with a multi-color combined probe code using a fluorescent marker, so that the fluorescent signals labeled on the gene probes of mycoplasma hyopneumoniae, pasteurella multocida, and actinobacillus pleuropneumoniae are different. FAM, HEX and CY5 fluorescent labels are selected for use in the present invention, but the claims of the present invention are not limited to these 3 fixed fluorescent labels.
Example 2 preparation of Positive Standard and triple fluorescent quantitative PCR detection method
1) Preparation of Standard samples
In order to draw a standard curve of triple fluorescence quantitative PCR, DNAs of mycoplasma hyopneumoniae, pasteurella suicidae and actinobacillus pleuropneumoniae are respectively extracted as PCR templates, corresponding target sequences are respectively amplified by using primers, and amplified products are connected into a vector to respectively obtain plasmids containing the target sequences of the mycoplasma hyopneumoniae, the pasteurella suicidae and the actinobacillus pleuropneumoniae, namely a mycoplasma hyopneumoniae positive standard, a pasteurella suicidae positive standard and an actinobacillus pleuropneumoniae positive standard.
Amplification target gene sequence of mycoplasma hyopneumoniae:
GATATTAAATCTGGATTTTTCCCTGGAGACAAGAGATCCAGTCATACCAAGGCAGAAATTAGTAATCTTTTAAATAAAAAAGAAAATATTTATGACTTTGGTAAATACAAT
pig pasteurella multocida amplification target gene sequence:
TCTCTTCATTATTAGTTGCATGTAGCGGCGGTGGCGGTAGCGCTGGAAATCGTGCTGACCGTGTAGAGGAAAAAGCACAACCGGTTCAATCAAATAGT
porcine actinobacillus pleuropneumoniae target gene sequence:
GGTATTGAACCTCTTGGTAAGCAAGAAGATTTTGATTTTGTCGGCGGCTTTTGGTCTAACTTAGTGAATCGTGGTTTGGAAAGTATTATCGAC
2) sensitivity of triple fluorescence quantitative PCR detection positive standard sample
And (3) respectively carrying out gradient dilution on the mycoplasma hyopneumoniae positive standard substance, the swine pasteurella multocida positive standard substance and the swine actinobacillus pleuropneumoniae positive standard substance by 10 times, using the diluted solutions as standard substances to detect a quantitative range, and determining the sensitivity of the standard substances.
And respectively amplifying the diluted plasmid standard products under the optimal amplification conditions.
Wherein, the fluorescent quantitative PCR amplification reaction system is as follows:
2.5mM/μL dNTPmix
2μL
5×PCR buffer
5μL
50 pmol/. mu.L primer MHPF2
0.1μL
50 pmol/. mu.L primer MHPR2
0.1μL
50 pmol/. mu.L primer SAPF2
0.1μL
50 pmol/. mu.L primer SAPR1
0.1μL
50 pmol/. mu.L primer APPF3
0.2μL
50 pmol/. mu.L primer APPR2
0.2μL
50 pmol/. mu.L Probe MHPP1
0.05μL
50 pmol/. mu.L Probe SAPP1
0.08μL
50 pmol/. mu.L Probe APPP1
0.15μL
Enzyme solution
1μL
ddH2O
Make up to 20 mu L
DNA template/Positive control/negative control
5μL
The PCR amplification reaction program is as follows: pre-denaturation at 95 ℃ for 3min for 1 cycle; denaturation at 95 ℃ for 15s, annealing at 55 ℃, extension and signal acquisition for 30 s; the cycle is 45 times.
3) Sensitivity analysis
The detection results are shown in fig. 1-5, and fig. 1 is an amplification curve diagram of 10-fold dilution gradient series samples of a mycoplasma hyopneumoniae positive standard, a swine pasteurella multocida positive standard and a swine actinobacillus pleuropneumoniae positive standard; fig. 2 is a gradient graph of FAM channel positive standard of mycoplasma hyopneumoniae, fig. 3 is a gradient graph of HEX channel positive standard of porcine pasteurella multocida, and fig. 4 is a gradient graph of CY5 channel positive standard of porcine actinobacillus pleuropneumoniae. As can be seen in the figure, at 101～105The amplification curves of 3 channels in the range of copies/mL all present good linear relation, and the detection sensitivity can reach 500 copies/mL.
The results show that the PCR reaction can be realized and the fluorescent signal can be released under the condition that the reaction system contains the gene templates of the mycoplasma hyopneumoniae, the pasteurella multocida and the actinobacillus pleuropneumoniae. And (3) utilizing a fluorescent quantitative PCR instrument to carry out real-time monitoring and output on the signal intensity of the corresponding channel in the PCR process, thereby realizing qualitative and quantitative analysis of the detection result.
Example 3 triple fluorescent quantitative PCR detection method for Mycoplasma hyopneumoniae, Pasteurella suis and Actinobacillus pleuropneumoniae
1) Extracting nucleic acid of a sample: 10 samples were to be extracted, including 2 samples of Mycoplasma hyopneumoniae, 2 samples of Pasteurella multocida, 1 sample of Actinobacillus pleuropneumoniae, 2 samples of erysipelothrix rhusiopathiae, 2 samples of Streptococcus suis and 1 sample of Haemophilus parasuis.
2) The extracted nucleic acid is taken as a template to carry out quadruple fluorescent quantitative PCR amplification, and the reaction system is as follows:
2.5mM/μL dNTPmix
2μL
5×PCR buffer
5μL
50 pmol/. mu.L primer MHPF2
0.1μL
50 pmol/. mu.L primer MHPR2
0.1μL
50 pmol/. mu.L primer SAPF2
0.1μL
50 pmol/. mu.L primer SAPR1
0.1μL
50 pmol/. mu.L primer APPF3
0.2μL
50 pmol/. mu.L primer APPR2
0.2μL
50 pmol/. mu.L Probe MHPP1
0.05μL
50 pmol/. mu.L Probe SAPP1
0.08μL
50 pmol/. mu.L Probe APPP1
0.15μL
Enzyme solution
1μL
ddH2O
Make up to 20 mu L
DNA template/Positive control/negative control
5μL
The PCR amplification reaction program is as follows: pre-denaturation at 95 ℃ for 3min for 1 cycle; denaturation at 95 ℃ for 15 s; annealing at 55 ℃, extending and collecting signals for 30 s; the cycle is 45 times.
Meanwhile, a negative control group and a positive control group are arranged, wherein the negative control group is a physiological saline solution which does not contain genomes of mycoplasma hyopneumoniae, porcine pasteurella multocida and porcine actinobacillus pleuropneumoniae. The positive control group is a solution containing positive standard substances of mycoplasma hyopneumoniae, porcine pasteurella multocida and porcine actinobacillus pleuropneumoniae genomes.
3) And (4) analyzing results: and (3) judging whether the result is negative or positive according to the Ct value of the fluorescence amplification curve graph, and determining whether the sample contains mycoplasma hyopneumoniae, porcine pasteurella multocida and porcine actinobacillus pleuropneumoniae. When the Ct value of the amplification curve graph is less than or equal to 38 and obvious exponential amplification is presented, the result is positive; when the Ct value of the amplification curve graph is greater than 38 or no Ct value, the result is negative; therefore, in order to have a reference for determining the negative and positive, a negative control solution and a positive control solution need to be provided for a triple fluorescence quantitative PCR detection kit for Mycoplasma hyopneumoniae, Pasteurella suis and Actinobacillus pleuropneumoniae when a sample is detected.
In the embodiment of the present invention, the triple fluorescence quantitative PCR instrument for detecting mycoplasma hyopneumoniae, pasteurella suicidae and actinobacillus pleuropneumoniae includes but is not limited to: tianlong series, ABI series, Bio-Rad series (ICycler/MJ Opticon 2), Stratagene MX series, Roche Lightcycler, Ccpheid smartcycler, Corbett Rortor-Gene, Hangzhou Bori series.
The detection results are shown in FIGS. 5-7, wherein FIG. 5 is a positive control amplification result graph; FIG. 6 is the amplification result of the negative control group, and FIG. 7 is the amplification result of the sample, in which 2 cases of Mycoplasma hyopneumoniae, 2 cases of Pasteurella multocida, 1 case of Actinobacillus pleuropneumoniae and other samples were all detected negative, and the detection result is expected and the accuracy rate is 100%.
The above description is only for the preferred embodiment of the present invention, but the scope of the present invention is not limited thereto, and any person skilled in the art should be considered to be within the technical scope of the present invention, and the technical solutions and the inventive concepts thereof according to the present invention should be equivalent or changed within the scope of the present invention.
