1. A pig BRS3 gene, wherein the CDs sequence of the gene is shown in SEQ ID NO: 4, respectively.

2. The method for cloning the CDs sequence of the porcine BRS3 gene in a full-length segmentation manner according to claim 1, wherein the BRS3 gene is segmented, and the porcine BRS3 gene sequence is obtained by the segmentation cloning and gene splicing method.

3. The method of claim 2, wherein the BRS3 gene is divided into three sequences, fragment 1, fragment 2 and fragment 3; fragment 1, fragment 2 and fragment 3 are partially overlapped with each other, and after three-segment sequence genes are spliced, a pig BRS3 gene containing a complete CDs sequence can be obtained; the 5 'end of fragment 1 sequence includes the 5' end of CDs sequence, the 3 'end of fragment 1 sequence is overlapped with the 5' end part sequence of fragment 2 sequence, the 3 'end of fragment 2 sequence is overlapped with the 5' end part sequence of fragment 3 sequence, and the 3 'end of fragment 3 sequence includes the 3' end of CDs sequence.

4. The method of claim 2, wherein the sequences of fragment 1, fragment 2 and fragment 3 are set forth in SEQ ID NO: 1. SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

5. The method of claim 2, wherein the fragment 1, fragment 2 and fragment 3PCR amplification primers are as follows:

fragment 1 primer:

F1：ATGTCTTGAATTTGCTTGCCAT；

R1：TTACAGCCAATTCTTCCGAAC；

fragment 2 primer:

F2：GGCGTTCCTAATGATACCAC；

R2：CATGGCTTTGTTCCTCCGTA；

fragment 3 primer:

F3：TATTCTTTGATCGCTAGGACCC；

R3：GCCCAATAAGATCATTGTTCGT。

6. a cloning vector, characterized in that the CDs sequence of the porcine BRS3 gene of claim 1 is amplified by PCR to obtain a BRS3 full-length CDs sequence fragment, and the fragment is inserted into pMD19T plasmid to construct TA cloning vector, so as to obtain the cloning vector pMD19T-BRS3 of BRS3 full-length CDs sequence.

7. The cloning vector of claim 6, wherein the PCR amplification primers are:

an upstream primer F: 5'-GCTCTAGAATGGCTCAAAGGCAGC-3', respectively;

a downstream primer R: 5'-GGAATTCTTAGACTCTGTCTTCTTCCTTC-3' are provided.

8. The cloning vector of claim 7, wherein Xba I and EcoR I are selected as the inserted cleavage sites, and wherein the upstream primer inserts the protection bases GC and the Xba I cleavage site TCTAGA; the downstream primer inserts protective base G and EcoR I enzyme cutting site GAATTC.

9. An overexpression vector, which is characterized in that the cloning vector pMD19T-BRS3 and pCD513B1 plasmid of claim 6 are used for carrying out double digestion and then are connected by T4 DNA Ligase, and a lentiviral overexpression vector pCD513B1-BRS3 is constructed in a recombinant mode.

10. Use of the gene of claim 1, the method of any one of claims 2 to 5, the cloning vector of any one of claims 6 to 8, or the overexpression vector of claim 9 for genetic modification or breeding in swine.

Background

Bombesin (Bn) was originally an amidated tetradecapeptide isolated from the skin of a Rana nigromaculata. Subsequently, two bombesin-like peptides, Gastrin-releasing peptide (GRP) and Neuromedin B (NMB), have been found in mammals. Mammalian bombesin receptors belong to the G-protein coupled receptors, including NMB receptor (NMBR), GRP receptor (GRPR), and bombesin receptor subtype 3 (BRS 3). Since no endogenous ligand, also called orphan receptor, was found in BRS 3. Although, no endogenous ligands for BRS3 have been discovered, studies have shown that BRS3 has important physiological functions, including: affecting tumor growth/differentiation, regulating energy balance and carbohydrate metabolism, regulating satiety through ingestion, regulating body weight, blood pressure and heart rate, regulating hormone secretion, and the like.

Since the discovery of BRS3, researchers at home and abroad have focused on BRS3 in humans and mice, and BRS3 is expressed in Central Nervous System (CNS) and various peripheral tissues and organs, especially in tumor and lung. The pig is one of the main sources of the animal protein of the main economic livestock and people in China, is also an important model animal, ensures the health of the pig, improves the production performance and the reproductive capacity of the pig, is an important responsibility of the work of animal husbandry and veterinarian, and provides an important reference value for further researching human diseases. Therefore, the cloned pig BRS3 gene (including the full-length CDs sequence) has important significance for researching the function of BRS3 in pigs. Through analysis of the predicted sequence of the porcine BRS3 gene, the total length of the CDs sequence is 1200 bp. Although the sequence of the porcine BRS3 gene is not particularly long, the amplification is difficult to succeed by the conventional method, even if a plurality of high-fidelity amplification enzymes are replaced, the sequence is found to be very different from the prediction after the sequencing, and due to the high homology of the BRS3 gene and other genes, the amplified longer sequence is easily mismatched, other genes are amplified, or the amplified sequence only comprises a part of the BRS3 sequence, so the porcine BRS3 gene cannot be used. Therefore, an effective BRS3 gene sequence cannot be obtained by using a direct amplification method, the full-length CDs sequence is difficult to amplify at one time, and the porcine BRS3 gene is not successfully cloned at present.

Disclosure of Invention

In order to make up for the defects of the prior art, the invention improves the amplification success rate by reducing the length of an amplified fragment, obtains a porcine BRS3 gene (comprising a full-length CDs sequence) by adopting segmented cloning and gene splicing, then obtains the BRS3 full-length CDs sequence by amplification, constructs the sequence on a cloning vector, and provides an effective method for research and application of over-expression of the BRS3 gene, screening of interference sequences and the like based on the BRS3 gene CDs sequence.

In order to achieve the purpose, the invention is realized by the following technical scheme:

a pig BRS3 gene, wherein the sequence of CDs gene is shown as SEQ ID NO: 4, respectively.

A method for cloning a CDs sequence of a porcine BRS3 gene in a full-length segmentation manner comprises the steps of segmenting a BRS3 gene, and obtaining a porcine BRS3 gene sequence by a segmentation cloning and gene splicing method.

Further, the BRS3 gene is divided into three sequences, namely fragment 1, fragment 2 and fragment 3; fragment 1, fragment 2 and fragment 3 are partially overlapped with each other, and after three-segment sequence genes are spliced, a pig BRS3 gene containing a complete CDs sequence can be obtained; the 5 'end of fragment 1 sequence includes the 5' end of CDs sequence, the 3 'end of fragment 1 sequence is overlapped with the 5' end part sequence of fragment 2 sequence, the 3 'end of fragment 2 sequence is overlapped with the 5' end part sequence of fragment 3 sequence, and the 3 'end of fragment 3 sequence includes the 3' end of CDs sequence.

Further, the sequences of fragment 1, fragment 2 and fragment 3 are shown in SEQ ID NO: 1. SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

Further, fragment 1, fragment 2 and fragment 3PCR amplification primers are as follows:

fragment 1 primer:

F1：ATGTCTTGAATTTGCTTGCCAT；

R1：TTACAGCCAATTCTTCCGAAC；

fragment 2 primer:

F2：GGCGTTCCTAATGATACCAC；

R2：CATGGCTTTGTTCCTCCGTA；

fragment 3 primer:

F3：TATTCTTTGATCGCTAGGACCC；

R3：GCCCAATAAGATCATTGTTCGT。

a cloning vector is obtained by adopting PCR to amplify the CDs sequence of the porcine BRS3 gene to obtain a BRS3 full-length CDs sequence fragment, and inserting pMD19T plasmid to construct a TA cloning vector, so that the cloning vector pMD19T-BRS3 of the BRS3 full-length CDs sequence is obtained.

Further, the PCR amplification primers are:

an upstream primer F: 5'-GCTCTAGAATGGCTCAAAGGCAGC-3', respectively;

a downstream primer R: 5'-GGAATTCTTAGACTCTGTCTTCTTCCTTC-3' are provided.

Further, Xba I and EcoR I are selected as inserted enzyme cutting sites, wherein the upstream primer is inserted with a protection base GC and an Xba I enzyme cutting site TCTAGA; the downstream primer inserts protective base G and EcoR I enzyme cutting site GAATTC.

An overexpression vector is constructed by adopting the cloning vector pMD19T-BRS3 and pCD513B1 plasmids to be connected by T4 DNA Ligase after double enzyme digestion, and recombining and constructing a lentiviral overexpression vector pCD513B1-BRS 3.

The gene, the method, the cloning vector or the overexpression vector are applied to the gene modification or breeding of the pig.

A method for cloning CDs sequences of BRS3 genes in full length segments comprises the following steps:

the method comprises the following steps: designing and synthesizing BRS3 gene segment amplification PCR primers;

step two: PCR amplification of BRS3 gene fragment 1/2/3;

step three: cloning and splicing fragment 1/2/3 fragment;

step four: designing and synthesizing primers for amplifying the full-length CDs sequence of BRS 3;

step five: obtaining a BRS3 full-length CDs sequence by PCR amplification;

step six: construction of BRS3 full-length CDs sequence cloning and overexpression vectors.

In the first step, the BRS3 gene segmented amplification PCR primer design steps are as follows:

according to the predicted sequence of the porcine BRS3 mRNA, the BRS3 gene is analyzed by using Primer Premier 5.0 and Oligo7.0 software, and BRS3 gene is divided into three sections to design amplification primers, wherein the Primer sequences are as follows:

(1) fragment 1 primer

F1：ATGTCTTGAATTTGCTTGCCAT

R1：TTACAGCCAATTCTTCCGAAC

(2) fragment 2 primer

F2：GGCGTTCCTAATGATACCAC

R2：CATGGCTTTGTTCCTCCGTA

(3) fragment 3 primer

F3：TATTCTTTGATCGCTAGGACCC

R3：GCCCAATAAGATCATTGTTCGT

Further, the second step is specifically as follows:

using mixed cDNA (stored in a laboratory) of all tissues of the whole pig body as a template, and respectively carrying out PCR amplification to obtain fragment 1/2/3:

(1) amplification of fragment 1 fragment:

the PCR reaction system was 25. mu.L (2 XTAQU Plus Master Mix 12.5. mu.L, 1. mu.L each of F1/R1, 2. mu.L of cDNA, ddH₂O8.5. mu.L) under the reaction conditions (94 ℃, 5 min; 35 cycles (94 ℃, 30 s; 53 ℃ (annealing temperature), 30 s; 72 ℃, 90 s); 72 ℃ and 7min), carrying out agarose gel electrophoresis detection on the PCR amplification product, cutting a correct band, carrying out gel recovery and purification on fragment 1 fragments, and storing at-20 ℃ for later use.

(2) Amplification of fragment 2 fragment:

the annealing temperature of the PCR reaction was 55 ℃ under the same conditions as in (1).

(3) Amplification of fragment 3 fragment:

the annealing temperature of the PCR reaction was 56 ℃ under the same conditions as in (1).

Further, the third step includes:

and (3) respectively inserting the fragment 1/2/3 obtained in the second step into the pMD19T plasmid to construct a cloning vector:

(1) TA cloning of fragment 1 fragment:

the ligation reaction system was 10. mu.L (fragment 1 fragment 2. mu.L, pMD19T plasmid 1. mu.L, ddH)₂O2 mu L and Solution I5 mu L), lightly mixing uniformly, and reacting for 30min at 16 ℃; then, the cells are transformed into DH5 alpha competent cells, and then the cells are plated, screened by blue-white spots, and single colonies are selected for bacterial liquid amplification; then carrying out PCR identification on the bacterial liquid, extracting plasmids, and sending the plasmids to a sequencing company for sequencing to obtain a cloning vector of the fragment 1, wherein the sequence of the fragment 1 is SEQ ID NO: 1.

(2) TA cloning of fragment 2 fragment:

the operation steps are the same as those in (1), and a cloning vector of fragment 2 fragment is obtained, wherein the sequence of fragment 2 fragment is SEQ ID NO: 2.

(3) TA cloning of fragment 3 fragment:

the operation steps are the same as those in (1), and a cloning vector of fragment 3 fragment is obtained, wherein the sequence of the fragment 3 fragment is SEQ ID NO: 3.

and splicing fragment 1/2/3 fragment sequences to obtain a BRS3 gene sequence.

Further, in the fourth step, primer design for amplifying the full-length CDs sequence of BRS3 is specifically performed as follows:

by analyzing the sequence of BRS3 CDs, Xba I and EcoR I are selected as inserted enzyme cutting sites, and upstream and downstream primers are designed and synthesized:

F：GCTCTAGAATGGCTCAAAGGCAGC

R：GGAATTCTTAGACTCTGTCTTCTTCCTTC

further, the fifth step of PCR amplification of the full-length sequence of BRS3 CDs comprises the following specific operations:

the PCR reaction system was 25. mu.L (2 XTAQU Plus Master Mix 12.5. mu.L, F/R each 1. mu.L, fragment 1/2/3 fragment gel as template, 1. mu.L each of mixed DNA, ddH₂O7.5. mu.L) under the reaction conditions (94 ℃, 5 min; 35 cycles (94 ℃, 30 s; 58 ℃ (annealing temperature), 30 s; 72 ℃, 90 s); 72 ℃ and 7min), carrying out agarose gel electrophoresis detection on the PCR amplification product, cutting a correct band, carrying out gel recovery and purification on CDs sequence fragments, and storing at-20 ℃ for later use.

Further, the sixth step is specifically operated as:

inserting the BRS3 full-length CDs sequence fragment obtained in the fifth step into pMD19T plasmid to construct TA cloning vector, and then carrying out PCR identification of bacterial liquid and plasmid sequencing verification to obtain a cloned target fragment of SEQ ID NO: 4. obtaining the cloning vector of BRS3 full-length CDs sequence. The constructed pMD19T-BRS3 plasmid and pCD513B1 plasmid are subjected to double digestion and then are connected by T4 DNA Ligase, and a lentivirus overexpression vector pCD513B1-BRS3 is constructed through recombination.

Has the advantages that:

in order to solve the problem that the one-time amplification of the porcine BRS3 gene (including a full-length CDs sequence) is difficult to directly realize by PCR in the prior art, the invention segments the BRS3 gene, obtains the porcine BRS3 gene sequence by segmented cloning and gene splicing, and fills the blank of research of the BRS3 gene on pigs.

The invention successfully amplifies the cloned mixed DNA of all the fragments to obtain the full-length CDs sequence fragment of the porcine BRS3 by taking the cloned mixed DNA as a template, and constructs the full-length CDs sequence fragment on a cloning vector, thereby providing an effective method for research and application based on the CDs sequence of the BRS3 gene, such as overexpression, interference sequence screening and the like of the BRS3 gene.

Drawings

FIG. 1 is a schematic diagram of the amplification process of the porcine BRS3 gene;

FIG. 2 shows the agarose gel electrophoresis detection results of fragment 1/2/3 PCR amplification products, wherein 1 and 2 are fragment 1 (493bp), 3 and 4 are fragment 2 (700bp), and 5 and 6 are fragment 3 (662 bp);

FIG. 3 is a graph showing the alignment of fragment 1/2/3 fragment sequences after gene splicing with predicted sequences (part of the alignment is shown);

FIG. 4 shows the result of agarose gel electrophoresis detection of PCR amplification products of porcine BRS3 CDs sequences;

FIG. 5 shows the result of double restriction enzyme identification of the pMD19T-BRS3 cloning vector;

FIG. 6 pCD513B1 double digestion results;

FIG. 7 is a lentiviral over-expression vector.

Detailed Description

The invention is further illustrated by the following specific examples. It should be understood that the examples are given for illustrative purposes only and do not limit the scope of the invention. The experimental methods described in the following examples are all conventional methods unless otherwise specified; the reagents and materials are commercially available, unless otherwise specified.

Example 1, pig BRS3 Gene segmentation cloning and acquisition of the Gene sequence, the procedure was as follows:

first, designing and synthesizing BRS3 gene segment amplification PCR primer

The BRS3 gene was subjected to sequence analysis using Primer Premier 5.0 and Oligo7.0 software based on the predicted sequence of porcine BRS3 mRNA, SEQ ID NO.6, and the BRS3 gene was divided into three sequences (fragment 1/2/3). Wherein, the 5 'end of fragment 1 sequence includes the 5' end of CDs sequence, the 3 'end of fragment 1 sequence is overlapped with the 5' end part sequence of fragment 2 sequence, the 3 'end of fragment 2 sequence is overlapped with the 5' end part sequence of fragment 3 sequence, and the 3 'end of fragment 3 sequence includes the 3' end of CDs sequence (FIG. 1 so). Because fragments 1/2/3 are partially overlapped with each other, the pig BRS3 gene containing complete CDs sequence can be obtained after splicing fragment 1/2/3 three-segment sequence gene.

fragment 1/2/3 sequence PCR amplification primers were designed as follows:

(1) fragment 1 primer

F1：ATGTCTTGAATTTGCTTGCCAT

R1：TTACAGCCAATTCTTCCGAAC

(2) fragment 2 primer

F2：GGCGTTCCTAATGATACCAC

R2：CATGGCTTTGTTCCTCCGTA

(3) fragment 3 primer

F3：TATTCTTTGATCGCTAGGACCC

R3：GCCCAATAAGATCATTGTTCGT

The designed primers were sent to the company for synthesis and stored at-20 ℃ for further use.

Secondly, obtaining fragment 1/2/3 fragment by PCR amplification

The reaction system for fragment 1 fragment PCR amplification is 25 μ L, specifically: 2 × Taq Plus Master Mix 12.5 μ L, F1/R1 Each 1 μ L, cDNA (porcine tissue Mixed cDNA)2 μ L, ddH₂O8.5. mu.L. After being mixed uniformly, the mixture is put into a PCR instrument for reactionThe amplification is carried out according to the optimized reaction conditions, and the specific reaction conditions are as follows: 5min at 94 ℃, 35 cycles (30 s at 94 ℃, 30s at 53 ℃ (annealing temperature), 90s at 72 ℃), 7min at 72 ℃ and 4 ℃ for termination. After the PCR procedure was completed, the amplified product was subjected to nucleic acid electrophoresis using 2% agarose gel, and photographed by a gel imaging system (FIG. 2). Cutting corresponding bands according to the size (493bp) of fragment 1, then operating according to the instruction of the universal DNA purification and recovery kit, purifying and recovering to obtain fragment 1, and storing at-20 ℃ for later use.

fragment 2 fragment PCR amplification reaction system (amplification primer F2/R2) and reaction conditions (annealing temperature 55 ℃) are the same as fragment 1. fragment 2 fragment size 700bp, purified and recovered, and stored at-20 ℃ for use.

fragment 3 fragment PCR amplification reaction system (amplification primer F3/R3) and reaction conditions (annealing temperature 56 ℃) are the same as fragment 1. fragment 3 fragment size 662bp, purified and recovered, stored at-20 ℃ for use.

Cloning and sequence splicing of fragment 1/2/3

The fragment 1/2/3 obtained was ligated into the TA cloning vector pMD19T, respectively, in a ligation reaction system of 10. mu.L, specifically: fragment 1/2/3 fragment 2. mu. L, pMD19T plasmid 1. mu. L, ddH₂O2 mu L and Solution I5 mu L. After mixing gently, the mixture was reacted in a water bath at 16 ℃ for 30 min. The constructed TA cloning plasmid was subsequently transformed into DH 5. alpha. competent cells, ice-washed for 30min, then accurately heat-shocked in a water bath at 42 ℃ for 90s, immediately placed in ice-water for 2min, and then ampicillin-free (Amp) was added^-) The normal LB liquid culture medium is cultured for 60min at 37 ℃ with shaking at 180rpm/min for rejuvenation. In the presence of aminobenzyl (Amp)⁺) The LB solid medium of (5) was cultured on a plate at 37 ℃ for overnight inversion, colony colonies were selected, and single colonies were picked up and plated on Amp-containing plates⁺The LB liquid medium of (1) for bacterial amplification.

Referring to the PCR reaction system and conditions of fragment 1/2/3 fragment amplification, the bacterial liquid is used as template cDNA for PCR amplification, and the bacterial liquid successfully transferred into the TA clone plasmid of the target fragment is primarily screened out. And extracting plasmids in the bacterial liquid according to the instruction of a high-purity plasmid miniextraction kit (centrifugal column type) and sending the plasmids to a sequencing company for sequencing. And analyzing the sequencing result to obtain that the gene sequences of fragment 1/2/3 fragments are respectively shown in sequence tables SEQ ID NO. 1-3.

The gene sequence of fragment 1/2/3 is subjected to gene splicing to obtain the porcine BRS3 gene sequence shown in the sequence table SEQ ID NO.5, the obtained porcine BRS3 gene sequence is 1501bp in length, and CDs sequences are arranged between sites 132-1331 and 1200bp in length. The cloned porcine BRS3 sequence was then aligned with the porcine BRS3 predicted sequence (fig. 3), and the alignment indicated: the 1501bp porcine BRS3 gene cloned by the invention has only 2 bases and different predicted sequences, which proves that the porcine BRS3 gene is successfully cloned, and the sequence of the porcine BRS3 gene is shown as SEQ ID NO. 5. The successful cloning of the porcine BRS3 gene makes up the blank of research of the BRS3 gene on the pig, and provides a basis for researching the function of the BRS3 gene in the pig body.

Example 2, obtaining of CDs sequence of porcine BRS3 gene and construction of overexpression vector, the steps are as follows:

PCR primer for designing and synthesizing BRS3 full-length CDs sequence

Based on the CDs sequence of the porcine BRS3 gene that we cloned in example 1, sequence analysis was performed on the CDs sequence of the porcine BRS3 gene (SEQ ID NO.5) by bioinformatics software, Xba I and EcoR I were selected as the inserted cleavage sites, and upstream primers (insertion protection bases GC and Xba I cleavage site TCTAGA) F were designed and synthesized: 5'-GCTCTAGAATGGCTCAAAGGCAGC-3', respectively; downstream primer (insert protection base G and EcoR I cleavage site GAATTC) R: 5'-GGAATTCTTAGACTCTGTCTTCTTCCTTC-3' are provided. The designed primers were sent to the company for synthesis and stored at-20 ℃ for further use.

Secondly, PCR amplification of BRS3 CDs full-length sequence

The PCR reaction system was 25. mu.L (2 XTAQU Plus Master Mix 12.5. mu.L, F/R each 1. mu.L, fragment 1/2/3 fragment gel as template, 1. mu.L each of mixed DNA, ddH₂O7.5. mu.L) under the reaction conditions (94 ℃, 5 min; 35 cycles (94 ℃, 30 s; 58 ℃ (annealing temperature), 30 s; 72 ℃, 90 s); 72 ℃ for 7 min; stop at 4 ℃). After the PCR procedure was completed, the amplified product was subjected to nucleic acid electrophoresis using 1.2% agarose gel and photographed by a gel imaging system (FIG. 4). According to the size of the CDs sequence (12)00bp) is cut, then the operation is carried out according to the instruction of a general DNA purification and recovery kit, and after purification and recovery, a pig BRS3 CDs fragment with enzyme cutting sites at two ends is obtained and is stored at the temperature of minus 20 ℃ for later use.

Thirdly, constructing BRS3 full-length CDs sequence cloning vector and overexpression vector

The BRS3 full-length CDs sequence fragment obtained above is inserted into pMD19T plasmid to construct TA cloning vector, and then bacterial liquid PCR identification and plasmid sequencing verification are carried out. The cloning vector pMD19T-BRS3 of the full-length CDs sequence of BRS3 was obtained, and the sequence is shown in SEQ ID NO. 4. The construction of BRS3 TA cloning vector, PCR identification of bacterial liquid and plasmid extraction method are the same as above.

According to the optimized enzyme cutting system (50 mu L), the enzyme cutting system is shown in the table 1:

TABLE 1 double digestion reaction System

The digestion reaction condition is 37 ℃ water bath for 2h, and then 6 mu L10 XLoading Buffer is added to terminate the digestion reaction. Detecting the obtained enzyme digestion product by agarose gel electrophoresis (figure 5 and figure 6), cutting a target band, and purifying and recovering a target fragment according to a general DNA purification and recovery kit; connecting the obtained target bands under the action of T4 DNA Ligase according to an optimized connecting system, recombining and constructing a lentivirus over-expression vector pCD513B1-BRS3, transforming the lentivirus over-expression vector into DH5 alpha competent cells for bacterial liquid amplification (the culture, screening and amplification of bacterial colonies are the same as above), and verifying plasmid sequencing.

SEQ ID NO. 1: fragment 1 fragment sequence, length 493 bp; the sequence is as follows:

ATGTCTTGAATTTGCTTGCCATTCTGCTCTGTTCTCCTAGCATCTCATTGCTAGACGTAGGCATTAGACGTGACAATCAAGTACCTCTGAACTGAGCAGAAGAAAGATTAAAGGCATAGGCTTCAGAAGCAATGGCTCAAAGGCAGCCTCAGTCACCTAATCAGACTTTAATTTCAACCACAAATGACACAGAATCATCAAGCCCCGGCGTTCCTAATGATACCACAAATAAAGGAAGGACCGGAGACAACTCTCCAGGAATAGAAGCATTGTGTGTCATCTATTTCACTTATGCCGTGATCATTTCAGTGGGCATCCTTGGAAATGCTATTCTCATCAAAGTCTTTTTCAAGACCAAGTCCATGCAAACAGTTCCCAACATTTTCATCACCAGCCTGGCTTTTGGAGATCTTTTACTTCTGCTAACTTGTGTGCCAGTGGATGCAACCCACTACCTTGCAGAAGGATGGCTGTTCGGAAGAATTGGCTGTAA；

SEQ ID NO. 2: fragment 2 fragment sequence with length of 700 bp; the sequence is as follows:

GGCGTTCCTAATGATACCACAAATAAAGGAAGGACCGGAGACAACTCTCCAGGAATAGAAGCATTGTGTGTCATCTATTTCACTTATGCCGTGATCATTTCAGTGGGCATCCTTGGAAATGCTATTCTCATCAAAGTCTTTTTCAAGACCAAGTCCATGCAAACAGTTCCCAACATTTTCATCACCAGCCTGGCTTTTGGAGATCTTTTACTTCTGCTAACTTGTGTGCCAGTGGATGCAACCCACTACCTTGCAGAAGGATGGCTGTTCGGAAGAATTGGCTGTAAGGTGCTCTCTTTCATCCGGCTCACTTCTGTTGGTGTATCAGTGTTCACGTTAACAATTCTCAGTGCTGACAGATACAAGGCAGTTGTGAAACCCCTGGAGCGGCAGCCCTCCAACGCCATCCTGAAGACCTGTGCCAAAGCTGGCTGCATCTGGATCGTGTCCATGCTAATTGCTCTACCAGAGGCTATATTTTCCAATGTATATACTTTTCACGATCCCAACAGAAATATGACATTTGAAGCGTGTGCCTCCTATCCTGTTTCTGAGAGGCTCCTGCAAGAGATACATTCTCTGCTGTGCTTCTTAGTATTCTACATTATTCCCCTCTCCATCATCTCTGTCTATTATTCTTTGATCGCTAGGACCCTTTACAAAAGCACCTTGAACATACCTACGGAGGAACAAAGCCATG；

SEQ ID NO. 3: fragment 3 fragment sequence of 662bp in length; the sequence is as follows:

TATTCTTTGATCGCTAGGACCCTTTACAAAAGCACCTTGAACATACCTACGGAGGAACAAAGCCATGCCCGAAGGCAGATCGAATCCCGGAAGCGAATTGCCAAAACAGTGTTGGTGCTGGTGGCTCTGTTTGCTCTCTGCTGGTTGCCGAATCACCTCCTGTATCTTTACCGCTCATTCACTTACCAAACCTACGTGGACTCCTCTGCCATTCATTTTATTGTCACCATTTTCTCTCGGGTTCTGGCTTTCAGCAATTCTTGCGTAGACCCCTTTGCTCTTTACTGGCTGAGCAAAACCTTCCAGCAGCATTTTAAAGCTCAGTTATTCTGTTGCAAGGCAGAGGCGCCTGAACCTTCTGCTGGTGATATACCTCTTGACAACCTGGCAGTGATGGGACGGGTCCGGGGTGCTGCGAGCACTCAGGTGTCTGAAATTAGTGCGTCCCTGTTTCCTGGCAGTGGTGTCAAGAAGGAAGAAGACAGAGTCTAACTTTTCCATTAAAACCGGTGTTTTTCCTTCCAGCATGTGTATTCGACTCTGGGCGACGTGTAGGTTTATGGTGTCAGGTTGCTCGTTTGTGAATAGTGCTGAAGTCTTAGGAGGGAAGGCTTGGACAAACCATGATTTTCTTCAAGGTACGAACAATGATCTTATTGGGC；

SEQ ID NO. 4: enzyme cutting sites and protective bases are added at two ends of a CDs sequence of the BRS3 gene, and the length is 1215 bp; the sequence is as follows:

GCTCTAGAATGGCTCAAAGGCAGCCTCAGTCACCTAATCAGACTTTAATTTCAACCACAAATGACACAGAATCATCAAGCCCCGGCGTTCCTAATGATACCACAAATAAAGGAAGGACCGGAGACAACTCTCCAGGAATAGAAGCATTGTGTGTCATCTATTTCACTTATGCCGTGATCATTTCAGTGGGCATCCTTGGAAATGCTATTCTCATCAAAGTCTTTTTCAAGACCAAGTCCATGCAAACAGTTCCCAACATTTTCATCACCAGCCTGGCTTTTGGAGATCTTTTACTTCTGCTAACTTGTGTGCCAGTGGATGCAACCCACTACCTTGCAGAAGGATGGCTGTTCGGAAGAATTGGCTGTAAGGTGCTCTCTTTCATCCGGCTCACTTCTGTTGGTGTATCAGTGTTCACGTTAACAATTCTCAGTGCTGACAGATACAAGGCAGTTGTGAAACCCCTGGAGCGGCAGCCCTCCAACGCCATCCTGAAGACCTGTGCCAAAGCTGGCTGCATCTGGATCGTGTCCATGCTAATTGCTCTACCAGAGGCTATATTTTCCAATGTATATACTTTTCACGATCCCAACAGAAATATGACATTTGAAGCGTGTGCCTCCTATCCTGTTTCTGGGAGGCTCCTGCAAGAGATACATTCTCTGCTGTGCTTCTTAGTATTCTACATTATTCCCCTCTCCATCATCTCTGTCTATTATTCTTTGATCGCTAGGACCCTTTACAAAAGCACCTTGAACATACCTACGGAGGAACAAAGCCATGCCCGAAAGCAGATCGAATCCCGGAAGCGAATTGCCAAAACAGTGTTGGTGCTGGTGGCTCTGTTTGCTCTCTGCTGGTTGCCGAATCACCTCCTGTATCTTTACCGCTCATTCACTTACCAAACCTACGTGGACTCCTCTGCCATTCATTTTATTGTCACCATTTTCTCTCGGGTTCTGGCTTTCAGCAATTCTTGCGTAAACCCCTTTGCTCTTTACTGGCTGAGCAAAACCTTCCAGCAGCATTTTAAAGCTCAGTTATTCTGTTGCAAGGCAGAGGCGCCTGAACCTTCTGCTGGTGATATACCTCTTGACAACCTGGCAGTGATGGGACGGGTCCGGGGTGCTGCGAGCACTCAGGTGTCTGAAATTAGTGCGTCCCTGTTTCCTGGCAGTGGTGTCAAGAAGGAAGAAGACAGAGTCTAAAAGCTTG；

SEQ ID No. 5: BRS3 gene sequence with length 1501 bp; CDs are the 132-1331 sites of the sequence, the length is 1200bp, and the sequence is:

ATGTCTTGAATTTGCTTGCCATTCTGCTCTGTTCTCCTAGCATCTCATTGCTAGACGTAGGCATTAGACGTGACAATCAAGTACCTCTGAACTGAGCAGAAGAAAGATTAAAGGCATAGGCTTCAGAAGCAATGGCTCAAAGGCAGCCTCAGTCACCTAATCAGACTTTAATTTCAACCACAAATGACACAGAATCATCAAGCCCCGGCGTTCCTAATGATACCACAAATAAAGGAAGGACCGGAGACAACTCTCCAGGAATAGAAGCATTGTGTGTCATCTATTTCACTTATGCCGTGATCATTTCAGTGGGCATCCTTGGAAATGCTATTCTCATCAAAGTCTTTTTCAAGACCAAGTCCATGCAAACAGTTCCCAACATTTTCATCACCAGCCTGGCTTTTGGAGATCTTTTACTTCTGCTAACTTGTGTGCCAGTGGATGCAACCCACTACCTTGCAGAAGGATGGCTGTTCGGAAGAATTGGCTGTAAGGTGCTCTCTTTCATCCGGCTCACTTCTGTTGGTGTATCAGTGTTCACGTTAACAATTCTCAGTGCTGACAGATACAAGGCAGTTGTGAAACCCCTGGAGCGGCAGCCCTCCAACGCCATCCTGAAGACCTGTGCCAAAGCTGGCTGCATCTGGATCGTGTCCATGCTAATTGCTCTACCAGAGGCTATATTTTCCAATGTATATACTTTTCACGATCCCAACAGAAATATGACATTTGAAGCGTGTGCCTCCTATCCTGTTTCTGAGAGGCTCCTGCAAGAGATACATTCTCTGCTGTGCTTCTTAGTATTCTACATTATTCCCCTCTCCATCATCTCTGTCTATTATTCTTTGATCGCTAGGACCCTTTACAAAAGCACCTTGAACATACCTACGGAGGAACAAAGCCATGCCCGAAGGCAGATCGAATCCCGGAAGCGAATTGCCAAAACAGTGTTGGTGCTGGTGGCTCTGTTTGCTCTCTGCTGGTTGCCGAATCACCTCCTGTATCTTTACCGCTCATTCACTTACCAAACCTACGTGGACTCCTCTGCCATTCATTTTATTGTCACCATTTTCTCTCGGGTTCTGGCTTTCAGCAATTCTTGCGTAGACCCCTTTGCTCTTTACTGGCTGAGCAAAACCTTCCAGCAGCATTTTAAAGCTCAGTTATTCTGTTGCAAGGCAGAGGCGCCTGAACCTTCTGCTGGTGATATACCTCTTGACAACCTGGCAGTGATGGGACGGGTCCGGGGTGCTGCGAGCACTCAGGTGTCTGAAATTAGTGCGTCCCTGTTTCCTGGCAGTGGTGTCAAGAAGGAAGAAGACAGAGTCTAACTTTTCCATTAAAACCGGTGTTTTTCCTTCCAGCATGTGTATTCGACTCTGGGCGACGTGTAGGTTTATGGTGTCAGGTTGCTCGTTTGTGAATAGTGCTGAAGTCTTAGGAGGGAAGGCTTGGACAAACCATGATTTTCTTCAAGGTACGAACAATGATCTTATTGGGC；

SEQ ID NO. 6: the BRS3 gene prediction sequence has the length of 2808 bp; CDs are sequences at position 173-1372, the sequences are:

TGCTGGGAGATACAGAACTACTGAAGGGAAGGAGTCTCCGGATGTCTTGAATTTGCTTGCCATTCTGCTCTGTTCTCCTAGCATCTCATTGCTAGACGTAGGCATTAGACGTGACAATCAAGTACCTCTGAACTGAGCAGAAGAAAGATTAAAGGCATAGGCTTCAGAAGCAATGGCTCAAAGGCAGCCTCAGTCACCTAATCAGACTTTAATTTCAACCACAAATGACACAGAATCATCAAGCCCCGGCGTTCCTAATGATACCACAAATAAAGGAAGGACCGGAGACAACTCTCCAGGAATAGAAGCATTGTGTGTCATCTATTTCACTTATGCCGTGATCATTTCAGTGGGCATCCTTGGAAATGCTATTCTCATCAAAGTCTTTTTCAAGACCAAGTCCATGCAAACAGTTCCCAACATTTTCATCACCAGCCTGGCTTTTGGAGATCTTTTACTTCTGCTAACTTGTGTGCCAGTGGATGCAACCCACTACCTTGCAGAAGGATGGCTGTTCGGAAGAATTGGCTGTAAGGTGCTCTCTTTCATCCGGCTCACTTCTGTTGGTGTATCAGTGTTCACGTTAACAATTCTCAGTGCTGACAGATACAAGGCAGTTGTGAAACCCCTGGAGCGGCAGCCCTCCAACGCCATCCTGAAGACCTGTGCCAAAGCTGGCTGCATCTGGATCGTGTCCATGCTAATTGCTCTACCAGAGGCTATATTTTCCAATGTATATACTTTTCACGATCCCAACAGAAATATGACATTTGAAGCGTGTGCCTCCTATCCTGTTTCTGAGAGGCTCCTGCAAGAGATACATTCTCTGCTGTGCTTCTTAGTATTCTACATTATTCCCCTCTCCATCATCTCTGTCTATTATTCTTTGATCGCTAGGACCCTTTACAAAAGCACCTTGAACATACCTACGGAGGAACAAAGCCATGCCCGAAAGCAGATCGAATCCCGGAAGCGAATTGCCAAAACAGTGTTGGTGCTGGTGGCTCTGTTTGCTCTCTGCTGGTTGCCGAATCACCTCCTGTATCTTTACCGCTCATTCACTTACCAAACCTACGTGGACTCCTCTGCCATTCATTTTATTGTCACCATTTTCTCTCGGGTTCTGGCTTTCAGCAATTCTTGCGTAAACCCCTTTGCTCTTTACTGGCTGAGCAAAACCTTCCAGCAGCATTTTAAAGCTCAGTTATTCTGTTGCAAGGCAGAGGCGCCTGAACCTTCTGCTGGTGATATACCTCTTGACAACCTGGCAGTGATGGGACGGGTCCGGGGTGCTGCGAGCACTCAGGTGTCTGAAATTAGTGCGTCCCTGTTTCCTGGCAGTGGTGTCAAGAAGGAAGAAGACAGAGTCTAACTTTTCCATTAAAACCGGTGTTTTTCCTTCCAGCATGTGTATTCGACTCTGGGCGACGTGTAGGTTTATGGTGTCAGGTTGCTCGTTTGTGAATAGTGCTGAAGTCTTAGGAGGGAAGGCTTGGACAAACCATGATTTTCTTCAAGGTACGAACAATGATCTTATTGGGCTTTCTAAATAAAGCGAAGCCCCACCAGGCATAGGAAGACACGTTTGTATATGTCAGTGGGTCCTAAGGGAAGTTGAAGAGGAAGGGAAGGCGAAATCAACAAGATGACACTGAAAAATCTAATTTATTTCCATCACATCTACGAAGCTTCTAATTTCACATATGCTCCTGTGATTTGCATAAAACTGTGATTGTGTTTGTTATGTGGTGTAAATCTATAGATTATACTTTGCATTTGAAGAGGGGATCAAAGTGAGGTAAAACATGTCTTCTGCAGTTTTCTTTTTAAAAAGTCCTAAAAAAGAATCCTTCGTGGGTGGCTTTTTTGTTTGGCTGATTTTCGTTTTTGACTGCCCTTTTCCATTAATCGCTATTCCATCAGAATCAATGCTGTGAAATGGCAATGAAAATGTTTTGGGGTCAGCGGCGTACACGAGAAAGGATCTGGGGCAAGGTGTTTGCCTTACTAGGTCAGCGCTTACTAACTTAAGGTAGTTCTACTTCCAACTACCATTGATTGATAATTGGGCAAAGTTATCTTTCACAAATATTGTGAAGAACTTGCCTTCTTCACGGGCAGAATAAGTGGCCACGTTTATGGTGTCATTTGAGGGCTCCAAAGAGGGCCCCCCTGGTCAAAAACTCTGCGAGCCTGCCAGTGTCTGAAATTCTTCCTTTAAGGAAATTCATTTCTTTCTGGTAAGCAGTGCCCTCTTTCTAAAAGATGCAGAAGTACCACATGTGATCCCTAACACCTGGGTGTGCAGATGTCATCAGATCATCTTCCTGCCTGACTACCCGAAACCCCAAGTGTGCCTGAGTCCTGTAAGAGTATGACCTCATTAATCTCTGCCCTTGGAAATCAGATGGAAGGTTCTGATTTTCTGTCCTCTGCTCCTACTTGCTACCGCTTTAAGCTTACTAATAAATATTATTTCCAACAACTGCTGTTGTCAATAGATGTGTCAGATTTAGATTTGTGGTTTCAGAAAAATGTTTTCTTGGGGCAAATTAAAGCATATGTTTGGCACTATTGATAGTTAAATCTGTATTTTCAAAAACTTGATTTTGGGGTGTGCTTTTGGTAACTCCGAGCTTCTTTAAGTGGCTTGTGTACCTGTGAGCTTTTGCTTAAAGATGTGGCTTGAATGGGGACATCTATATTAACACTAGGCTTTCCATTTCTGTAAAACTGGCTTCCTTAAAGTGGGAGGGGGTCTTAGTATTGTTTTGAGTTGGACATTGTACTAAGTGGAGAGAAACAAAT。

sequence listing

<110> Yangzhou university

<120> method for cloning CDs sequence of BRS3 gene in full length and in segments

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 493

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgtcttgaa tttgcttgcc attctgctct gttctcctag catctcattg ctagacgtag 60

gcattagacg tgacaatcaa gtacctctga actgagcaga agaaagatta aaggcatagg 120

cttcagaagc aatggctcaa aggcagcctc agtcacctaa tcagacttta atttcaacca 180

caaatgacac agaatcatca agccccggcg ttcctaatga taccacaaat aaaggaagga 240

ccggagacaa ctctccagga atagaagcat tgtgtgtcat ctatttcact tatgccgtga 300

tcatttcagt gggcatcctt ggaaatgcta ttctcatcaa agtctttttc aagaccaagt 360

ccatgcaaac agttcccaac attttcatca ccagcctggc ttttggagat cttttacttc 420

tgctaacttg tgtgccagtg gatgcaaccc actaccttgc agaaggatgg ctgttcggaa 480

gaattggctg taa 493

<210> 2

<211> 700

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ggcgttccta atgataccac aaataaagga aggaccggag acaactctcc aggaatagaa 60

gcattgtgtg tcatctattt cacttatgcc gtgatcattt cagtgggcat ccttggaaat 120

gctattctca tcaaagtctt tttcaagacc aagtccatgc aaacagttcc caacattttc 180

atcaccagcc tggcttttgg agatctttta cttctgctaa cttgtgtgcc agtggatgca 240

acccactacc ttgcagaagg atggctgttc ggaagaattg gctgtaaggt gctctctttc 300

atccggctca cttctgttgg tgtatcagtg ttcacgttaa caattctcag tgctgacaga 360

tacaaggcag ttgtgaaacc cctggagcgg cagccctcca acgccatcct gaagacctgt 420

gccaaagctg gctgcatctg gatcgtgtcc atgctaattg ctctaccaga ggctatattt 480

tccaatgtat atacttttca cgatcccaac agaaatatga catttgaagc gtgtgcctcc 540

tatcctgttt ctgagaggct cctgcaagag atacattctc tgctgtgctt cttagtattc 600

tacattattc ccctctccat catctctgtc tattattctt tgatcgctag gaccctttac 660

aaaagcacct tgaacatacc tacggaggaa caaagccatg 700

<210> 3

<211> 662

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tattctttga tcgctaggac cctttacaaa agcaccttga acatacctac ggaggaacaa 60

agccatgccc gaaggcagat cgaatcccgg aagcgaattg ccaaaacagt gttggtgctg 120

gtggctctgt ttgctctctg ctggttgccg aatcacctcc tgtatcttta ccgctcattc 180

acttaccaaa cctacgtgga ctcctctgcc attcatttta ttgtcaccat tttctctcgg 240

gttctggctt tcagcaattc ttgcgtagac ccctttgctc tttactggct gagcaaaacc 300

ttccagcagc attttaaagc tcagttattc tgttgcaagg cagaggcgcc tgaaccttct 360

gctggtgata tacctcttga caacctggca gtgatgggac gggtccgggg tgctgcgagc 420

actcaggtgt ctgaaattag tgcgtccctg tttcctggca gtggtgtcaa gaaggaagaa 480

gacagagtct aacttttcca ttaaaaccgg tgtttttcct tccagcatgt gtattcgact 540

ctgggcgacg tgtaggttta tggtgtcagg ttgctcgttt gtgaatagtg ctgaagtctt 600

aggagggaag gcttggacaa accatgattt tcttcaaggt acgaacaatg atcttattgg 660

gc 662

<210> 4

<211> 1215

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gctctagaat ggctcaaagg cagcctcagt cacctaatca gactttaatt tcaaccacaa 60

atgacacaga atcatcaagc cccggcgttc ctaatgatac cacaaataaa ggaaggaccg 120

gagacaactc tccaggaata gaagcattgt gtgtcatcta tttcacttat gccgtgatca 180

tttcagtggg catccttgga aatgctattc tcatcaaagt ctttttcaag accaagtcca 240

tgcaaacagt tcccaacatt ttcatcacca gcctggcttt tggagatctt ttacttctgc 300

taacttgtgt gccagtggat gcaacccact accttgcaga aggatggctg ttcggaagaa 360

ttggctgtaa ggtgctctct ttcatccggc tcacttctgt tggtgtatca gtgttcacgt 420

taacaattct cagtgctgac agatacaagg cagttgtgaa acccctggag cggcagccct 480

ccaacgccat cctgaagacc tgtgccaaag ctggctgcat ctggatcgtg tccatgctaa 540

ttgctctacc agaggctata ttttccaatg tatatacttt tcacgatccc aacagaaata 600

tgacatttga agcgtgtgcc tcctatcctg tttctgggag gctcctgcaa gagatacatt 660

ctctgctgtg cttcttagta ttctacatta ttcccctctc catcatctct gtctattatt 720

ctttgatcgc taggaccctt tacaaaagca ccttgaacat acctacggag gaacaaagcc 780

atgcccgaaa gcagatcgaa tcccggaagc gaattgccaa aacagtgttg gtgctggtgg 840

ctctgtttgc tctctgctgg ttgccgaatc acctcctgta tctttaccgc tcattcactt 900

accaaaccta cgtggactcc tctgccattc attttattgt caccattttc tctcgggttc 960

tggctttcag caattcttgc gtaaacccct ttgctcttta ctggctgagc aaaaccttcc 1020

agcagcattt taaagctcag ttattctgtt gcaaggcaga ggcgcctgaa ccttctgctg 1080

gtgatatacc tcttgacaac ctggcagtga tgggacgggt ccggggtgct gcgagcactc 1140

aggtgtctga aattagtgcg tccctgtttc ctggcagtgg tgtcaagaag gaagaagaca 1200

gagtctaaaa gcttg 1215

<210> 5

<211> 1501

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atgtcttgaa tttgcttgcc attctgctct gttctcctag catctcattg ctagacgtag 60

gcattagacg tgacaatcaa gtacctctga actgagcaga agaaagatta aaggcatagg 120

cttcagaagc aatggctcaa aggcagcctc agtcacctaa tcagacttta atttcaacca 180

caaatgacac agaatcatca agccccggcg ttcctaatga taccacaaat aaaggaagga 240

ccggagacaa ctctccagga atagaagcat tgtgtgtcat ctatttcact tatgccgtga 300

tcatttcagt gggcatcctt ggaaatgcta ttctcatcaa agtctttttc aagaccaagt 360

ccatgcaaac agttcccaac attttcatca ccagcctggc ttttggagat cttttacttc 420

tgctaacttg tgtgccagtg gatgcaaccc actaccttgc agaaggatgg ctgttcggaa 480

gaattggctg taaggtgctc tctttcatcc ggctcacttc tgttggtgta tcagtgttca 540

cgttaacaat tctcagtgct gacagataca aggcagttgt gaaacccctg gagcggcagc 600

cctccaacgc catcctgaag acctgtgcca aagctggctg catctggatc gtgtccatgc 660

taattgctct accagaggct atattttcca atgtatatac ttttcacgat cccaacagaa 720

atatgacatt tgaagcgtgt gcctcctatc ctgtttctga gaggctcctg caagagatac 780

attctctgct gtgcttctta gtattctaca ttattcccct ctccatcatc tctgtctatt 840

attctttgat cgctaggacc ctttacaaaa gcaccttgaa catacctacg gaggaacaaa 900

gccatgcccg aaggcagatc gaatcccgga agcgaattgc caaaacagtg ttggtgctgg 960

tggctctgtt tgctctctgc tggttgccga atcacctcct gtatctttac cgctcattca 1020

cttaccaaac ctacgtggac tcctctgcca ttcattttat tgtcaccatt ttctctcggg 1080

ttctggcttt cagcaattct tgcgtagacc cctttgctct ttactggctg agcaaaacct 1140

tccagcagca ttttaaagct cagttattct gttgcaaggc agaggcgcct gaaccttctg 1200

ctggtgatat acctcttgac aacctggcag tgatgggacg ggtccggggt gctgcgagca 1260

ctcaggtgtc tgaaattagt gcgtccctgt ttcctggcag tggtgtcaag aaggaagaag 1320

acagagtcta acttttccat taaaaccggt gtttttcctt ccagcatgtg tattcgactc 1380

tgggcgacgt gtaggtttat ggtgtcaggt tgctcgtttg tgaatagtgc tgaagtctta 1440

ggagggaagg cttggacaaa ccatgatttt cttcaaggta cgaacaatga tcttattggg 1500

c 1501

<210> 6

<211> 2808

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tgctgggaga tacagaacta ctgaagggaa ggagtctccg gatgtcttga atttgcttgc 60

cattctgctc tgttctccta gcatctcatt gctagacgta ggcattagac gtgacaatca 120

agtacctctg aactgagcag aagaaagatt aaaggcatag gcttcagaag caatggctca 180

aaggcagcct cagtcaccta atcagacttt aatttcaacc acaaatgaca cagaatcatc 240

aagccccggc gttcctaatg ataccacaaa taaaggaagg accggagaca actctccagg 300

aatagaagca ttgtgtgtca tctatttcac ttatgccgtg atcatttcag tgggcatcct 360

tggaaatgct attctcatca aagtcttttt caagaccaag tccatgcaaa cagttcccaa 420

cattttcatc accagcctgg cttttggaga tcttttactt ctgctaactt gtgtgccagt 480

ggatgcaacc cactaccttg cagaaggatg gctgttcgga agaattggct gtaaggtgct 540

ctctttcatc cggctcactt ctgttggtgt atcagtgttc acgttaacaa ttctcagtgc 600

tgacagatac aaggcagttg tgaaacccct ggagcggcag ccctccaacg ccatcctgaa 660

gacctgtgcc aaagctggct gcatctggat cgtgtccatg ctaattgctc taccagaggc 720

tatattttcc aatgtatata cttttcacga tcccaacaga aatatgacat ttgaagcgtg 780

tgcctcctat cctgtttctg agaggctcct gcaagagata cattctctgc tgtgcttctt 840

agtattctac attattcccc tctccatcat ctctgtctat tattctttga tcgctaggac 900

cctttacaaa agcaccttga acatacctac ggaggaacaa agccatgccc gaaagcagat 960

cgaatcccgg aagcgaattg ccaaaacagt gttggtgctg gtggctctgt ttgctctctg 1020

ctggttgccg aatcacctcc tgtatcttta ccgctcattc acttaccaaa cctacgtgga 1080

ctcctctgcc attcatttta ttgtcaccat tttctctcgg gttctggctt tcagcaattc 1140

ttgcgtaaac ccctttgctc tttactggct gagcaaaacc ttccagcagc attttaaagc 1200

tcagttattc tgttgcaagg cagaggcgcc tgaaccttct gctggtgata tacctcttga 1260

caacctggca gtgatgggac gggtccgggg tgctgcgagc actcaggtgt ctgaaattag 1320

tgcgtccctg tttcctggca gtggtgtcaa gaaggaagaa gacagagtct aacttttcca 1380

ttaaaaccgg tgtttttcct tccagcatgt gtattcgact ctgggcgacg tgtaggttta 1440

tggtgtcagg ttgctcgttt gtgaatagtg ctgaagtctt aggagggaag gcttggacaa 1500

accatgattt tcttcaaggt acgaacaatg atcttattgg gctttctaaa taaagcgaag 1560

ccccaccagg cataggaaga cacgtttgta tatgtcagtg ggtcctaagg gaagttgaag 1620

aggaagggaa ggcgaaatca acaagatgac actgaaaaat ctaatttatt tccatcacat 1680

ctacgaagct tctaatttca catatgctcc tgtgatttgc ataaaactgt gattgtgttt 1740

gttatgtggt gtaaatctat agattatact ttgcatttga agaggggatc aaagtgaggt 1800

aaaacatgtc ttctgcagtt ttctttttaa aaagtcctaa aaaagaatcc ttcgtgggtg 1860

gcttttttgt ttggctgatt ttcgtttttg actgcccttt tccattaatc gctattccat 1920

cagaatcaat gctgtgaaat ggcaatgaaa atgttttggg gtcagcggcg tacacgagaa 1980

aggatctggg gcaaggtgtt tgccttacta ggtcagcgct tactaactta aggtagttct 2040

acttccaact accattgatt gataattggg caaagttatc tttcacaaat attgtgaaga 2100

acttgccttc ttcacgggca gaataagtgg ccacgtttat ggtgtcattt gagggctcca 2160

aagagggccc ccctggtcaa aaactctgcg agcctgccag tgtctgaaat tcttccttta 2220

aggaaattca tttctttctg gtaagcagtg ccctctttct aaaagatgca gaagtaccac 2280

atgtgatccc taacacctgg gtgtgcagat gtcatcagat catcttcctg cctgactacc 2340

cgaaacccca agtgtgcctg agtcctgtaa gagtatgacc tcattaatct ctgcccttgg 2400

aaatcagatg gaaggttctg attttctgtc ctctgctcct acttgctacc gctttaagct 2460

tactaataaa tattatttcc aacaactgct gttgtcaata gatgtgtcag atttagattt 2520

gtggtttcag aaaaatgttt tcttggggca aattaaagca tatgtttggc actattgata 2580

gttaaatctg tattttcaaa aacttgattt tggggtgtgc ttttggtaac tccgagcttc 2640

tttaagtggc ttgtgtacct gtgagctttt gcttaaagat gtggcttgaa tggggacatc 2700

tatattaaca ctaggctttc catttctgta aaactggctt ccttaaagtg ggagggggtc 2760

ttagtattgt tttgagttgg acattgtact aagtggagag aaacaaat 2808