1. A gene mutation having a c.128delg mutation and/or a c.1001+5G > C mutation compared to the wild-type SLC26a4 gene;

optionally, the genetic mutation is detectable.

2. A nucleic acid having a c.128delg mutation and/or a c.1001+5G > C mutation, as compared to a wild-type SLC26a4 gene.

3. A polypeptide having the following mutations in its amino acid sequence compared to the amino acid sequence of a polypeptide expressed by the wild-type SLC26a4 gene:

amino acid frameshift mutations caused by p.arg43proffsterr 23 and/or c.1001+5G > C mutations.

4. Use of a reagent for detecting a mutation in a gene according to claim 1 or a nucleic acid according to claim 2 or a polypeptide according to claim 3 for the preparation of a kit or device for the diagnosis of non-syndromic deafness;

optionally, the non-syndromic deafness is autosomal recessive non-syndromic deafness;

optionally, the reagents include at least one of antibodies, probes, primers, and mass spectrometry detection reagents specific for at least one of the gene mutation, the nucleic acid, and the polypeptide.

5. Use of a biological model for screening for a drug, wherein the biological model carries at least one of:

(1) a mutation of the gene of claim 1;

(2) the nucleic acid of claim 2;

(3) expressing the polypeptide of claim 3;

optionally, the biological model is a cellular model or an animal model;

optionally, the biological model is used to screen for drugs for the treatment of non-syndromic deafness.

6. Use of an agent that specifically alters a gene mutation of claim 1 or a nucleic acid of claim 2 in the manufacture of a medicament for the treatment of non-syndromic deafness;

optionally, the non-syndromic deafness is autosomal recessive non-syndromic deafness;

optionally, the agent is an agent based on at least one of shRNA, antisense nucleic acid, ribozyme, dominant negative mutation, CRISPR-Cas9, CRISPR-Cpf1, and zinc finger nuclease.

7. A medicament for the treatment of non-syngenic deafness, said medicament comprising:

an agent that specifically alters the genetic mutation of claim 1 or the nucleic acid of claim 2;

optionally, the non-syndromic deafness is autosomal recessive non-syndromic deafness;

optionally, the agent is an agent based on at least one of shRNA, antisense nucleic acid, ribozyme, dominant negative mutation, CRISPR-Cas9, CRISPR-Cpf1, and zinc finger nuclease.

8. A construct comprising a genetic mutation of claim 1 or a nucleic acid of claim 2.

9. A recombinant cell obtained by transforming a recipient cell with the construct of claim 8.

10. A kit for detecting non-syndromic deafness, comprising a reagent for detecting a mutation in the gene of claim 1, and/or a reagent for detecting the nucleic acid of claim 2, and/or a reagent for detecting the polypeptide of claim 3.

Background

Deafness (HL) is the most common disease with sensory dysfunction, and the onset of a considerable number of deafness patients is related to genetic factors. The molecular mechanism of deafness is determined by means of gene detection, prenatal gene diagnosis and intervention measures are further adopted, and the method is an effective means for reducing the incidence rate of deafness and is also one of the fundamental ways for preventing and treating deafness. Hereditary hearing loss can be classified into Syndromic Hearing Loss (SHL) and non-syndromic hearing loss (NSHL) depending on whether there are other clinical phenotypes that are concurrent.

Non-syndromic deafness accounts for about 70% of congenital hereditary deafness, and 75% -80% of them are Autosomal Recessive (AR). To date, more than 100 loci (loci) have been associated with autosomal recessive deafness, these loci being designated DFNB. The non-syndromic deafness caused by different pathogenic genes has obvious differences in the onset age, hearing loss degree, progressiveness and the like. The determination of the pathogenic gene of the deafness helps to select a proper hearing intervention means for the patient, and the life quality of the deafness patient is better improved.

With the development of sequencing technology, more and more genes related to genetic deafness are identified, which provides a basis for the molecular diagnosis of genetic deafness and enables more patients with genetic deafness to be diagnosed and treated. However, due to the strong genetic heterogeneity of hereditary hearing loss, a large number of pathogenic genes are still unidentified, so that the research on the aspect has a large space, and the research on the aspect of enhancing the gene identification is still needed.

Disclosure of Invention

The present invention is directed to solving, at least to some extent, one of the technical problems in the related art. Therefore, an object of the present invention is to provide a mutant SLC26A4 gene and its application.

Whole-exon sequencing (WES) is the most frequently used method for sequencing genomes. Exons are protein-coding regions of the human genome whose DNA can be captured and enriched using sequence capture techniques. Although the exon regions only account for about 1% of the whole genome, 85% of the pathogenic mutations are contained. Compared with whole genome sequencing, whole exon sequencing is more economical and efficient. Exome sequencing is used primarily to identify and study variations in coding regions and UTR regions associated with disease, population evolution. The combination of a large number of exon data provided by public databases is beneficial to better explain the relationship between the obtained variation and the disease.

The inventor carries out detection and verification of pathogenic mutation by a method of whole exon sequencing and family analysis combined with Sanger sequencing verification aiming at one autosomal recessive non-syndromic deafness Trio family (parents + probands) collected by self. Finally, according to each detection result, the inventor determines a new pathogenic mutation of autosomal recessive non-syndrome type deafness, namely c.128delG mutation on SLC26A4 gene, and the mutation c.1001+5G > C of the same gene on the other chromosome of the patient form compound heterozygosis (in trans), thus leading to the occurrence of autosomal recessive non-syndrome type deafness.

The SLC26A4 gene is located in human chromosome 7q31, comprises 21 exons, consists of 780 amino acids, encodes a Pendrin transmembrane transporter, and plays an important role in maintaining the balance of the ionic components of the organism. In the inner ear, Pendrin is expressed in the inner lymphatic vessel, the inner lymphatic sac, the oval sac, the sacculus and the like, and the abnormal protein can affect the normal physiological functions of the structures to cause deafness.

Some variation sites on the SLC26A4 gene can cause diseases, such as large vestibular aqueduct, hearing loss in children, bilateral hearing loss in 90% of patients, different hearing loss degrees, nearly normal or heavy-extremely severe hearing loss, stable, progressive or fluctuating disease course, gradually reduced hearing to deafness, falling, bumping and other behaviors, or possibly caused hearing loss without external influence. The inventor researches an autosomal recessive non-syndrome deafness Trio family to find that a c.128delG mutation on a pathogenic mutation site SLC26A4 gene and a mutation c.1001+5G > C of the same gene form a composite heterozygosity (in trans) to cause the occurrence of autosomal recessive non-syndrome deafness, and the mutation site can be used for screening carriers of autosomal recessive deafness pathogenic mutations. The combination of the two mutation sites can be used for molecular diagnosis of autosomal recessive deafness patients and differential diagnosis of related diseases, and has the advantages of rapidness, accuracy, high efficiency, simplicity and high early diagnosis rate. Of course, the gene can also be used together with other reported variant loci and the like on the SLC26A4 gene according to requirements, or be used together with other reported mutant loci for the characterization of autosomal recessive deafness, and can be applied to molecular diagnosis of autosomal recessive deafness patients and identification and diagnosis of related diseases.

In a first aspect of the invention, the invention provides a genetic mutation. According to an embodiment of the invention, the gene mutation has a c.128delG mutation and/or a c.1001+5G > C mutation compared to the wild type SLC26A4 gene. The inventor finds that the c.128delG mutation and/or c.1001+5G > C mutation of the SLC26A4 gene are closely related to the onset of non-syndrome deafness, so that whether the biological sample suffers from non-syndrome deafness can be effectively detected by detecting whether the gene mutation occurs in the biological sample. According to embodiments of the invention, the provided gene mutation is detectable.

In a second aspect of the invention, the invention provides a nucleic acid. According to embodiments of the invention, there is provided a nucleic acid having a c.128delg mutation and/or a c.1001+5G > C mutation as compared to the wild-type SLC26a4 gene. The inventor finds that the c.128delG mutation and/or c.1001+5G > C mutation of SLC26A4 gene are closely related to the onset of non-syndrome deafness, so that whether a biological sample is susceptible to non-syndrome deafness can be effectively detected by detecting whether the nucleic acid exists in the biological sample. According to an embodiment of the invention, the nucleic acids provided are isolatable.

In a third aspect of the invention, the invention provides a polypeptide having the following mutations in its amino acid sequence compared to the amino acid sequence of a polypeptide expressed by the wild-type SLC26a4 gene: amino acid frameshift mutations caused by p.arg43proffsterr 23 and/or c.1001+5G > C mutations. As mentioned above, the c.128delG mutation of SLC26A4 gene and/or the amino acid frame shift mutation caused by c.1001+5G > C mutation are closely related to the onset of non-syndrome deafness, so the protein or polypeptide expressed by the nucleic acid is closely related to the onset of non-syndrome deafness, and the presence of the protein or polypeptide in a biological sample can be detected, so that whether the biological sample is susceptible to non-syndrome deafness can be effectively detected. According to an embodiment of the invention, the provided polypeptide is isolatable.

In a fourth aspect of the invention, the invention provides the use of a reagent for detecting a gene mutation, which is a gene mutation according to the first aspect of the invention, or a nucleic acid, which is a nucleic acid according to the second aspect of the invention, or a polypeptide, which is a polypeptide according to the third aspect of the invention, in the manufacture of a kit or a device for diagnosing non-syndromic deafness. As described above, the aforementioned gene mutation, nucleic acid, polypeptide are closely related to the onset of non-syndromic deafness, and further, reagents capable of detecting these gene mutation, nucleic acid, or polypeptide can be used to prepare kits or devices, and the obtained kits or devices can effectively screen biological samples suffering from non-syndromic deafness.

In a fifth aspect of the invention, there is provided the use of a biological model for screening for a drug, the biological model carrying at least one of: (1) a mutation in the gene according to the first aspect of the invention; (2) a nucleic acid according to the second aspect of the invention; (3) expressing the polypeptide of the third aspect of the invention. It should be noted that "the biological model carries the gene mutation according to the first aspect of the present invention" means that the biological model carries the SLC26a4 gene having the c.128delg mutation and/or the c.1001+5G > C mutation compared to the wild-type SLC26a4 gene; "biological model carries a nucleic acid according to the second aspect of the invention" means that the biological model carries a nucleic acid sequence having a c.128delG mutation and/or a c.1001+5G > C mutation compared to the nucleic acid sequence of the wild-type SLC26A4 gene; "the biological model carries the polypeptide according to the third aspect of the present invention" means that the biological model carries a polypeptide having an amino acid frame shift mutation caused by the p.arg43ProfsTer23 and/or c.1001+5G > C mutation, as compared to the polypeptide expressed by the wild-type SLC26A4 gene. The provided biological model can be effectively used as a related research of non-syndromic deafness, especially autosomal recessive non-syndromic deafness. According to embodiments of the present invention, the provided biological model can be used to screen drugs for the treatment of non-syndromic deafness. The biological model provided may be a cellular model or an animal model.

In a sixth aspect, the present invention provides the use of an agent which specifically alters a genetic mutation or a nucleic acid for the manufacture of a medicament for the treatment of non-syndromic deafness, wherein the genetic mutation is a genetic mutation according to the first aspect of the invention and the nucleic acid is a nucleic acid according to the second aspect of the invention. It is to be noted that the specific alteration is such that the mutated nucleic acid or mutated site of the gene is restored to its original wild-type state or other non-pathogenic state without substantially affecting other sequences in the genome of the individual. As described above, the aforementioned gene mutation or the aforementioned nucleic acid is closely related to the onset of non-syndromic deafness, particularly autosomal recessive non-syndromic deafness, and thus, a drug prepared from an agent that specifically alters the aforementioned nucleic acid or the aforementioned gene mutation is effective for treating non-syndromic deafness, particularly autosomal recessive non-syndromic deafness.

In a seventh aspect of the present invention, there is provided a medicament for the treatment of non-syngenic deafness, said medicament comprising: an agent which specifically alters a genetic mutation according to the first aspect of the invention or a nucleic acid according to the second aspect of the invention. It is to be noted that the specific alteration is such that the mutated nucleic acid or mutated site of the gene is restored to its original wild-type state or other non-pathogenic state without substantially affecting other sequences in the genome of the individual. As described above, the aforementioned nucleic acids or the aforementioned gene mutations are closely related to the onset of non-syndromic deafness, and thus, a medicament comprising an agent that specifically alters the aforementioned nucleic acids or the aforementioned gene mutations can be effectively used for treating non-syndromic deafness.

In an eighth aspect of the invention, there is provided a construct comprising a mutation in a gene according to the first aspect of the invention or a nucleic acid according to the second aspect of the invention. It is noted that "the construct comprises a mutation of a gene according to the first aspect of the invention" means that the construct has a c.128delG mutation and/or a c.1001+5G > C mutation compared to the wild type SLC26A4 gene; by "the construct comprises a nucleic acid according to the second aspect of the invention" is meant that the construct carries a nucleic acid sequence having a c.128delG mutation and/or a c.1001+5G > C mutation compared to the nucleic acid sequence of the wild type SLC26A4 gene. Thus, the recombinant cells obtained by transforming the receptor cells with the constructs according to the embodiments of the present invention can be effectively used as a model for research related to non-syndromic deafness, especially autosomal recessive non-syndromic deafness.

In a ninth aspect of the invention, there is provided a recombinant cell obtained by transforming a recipient cell with the construct of the eighth aspect of the invention. According to some embodiments of the invention, the recombinant cells of the invention can be effectively used as a research related to non-syndromic deafness, in particular autosomal recessive non-syndromic deafness.

In a tenth aspect of the invention, the invention provides a kit for detecting non-syndromic deafness, said kit comprising reagents for detecting a mutation in a gene according to the first aspect of the invention, and/or reagents for detecting a nucleic acid according to the second aspect of the invention, and/or reagents for detecting a polypeptide according to the third aspect of the invention. As described above, the nucleic acids, gene mutations and polypeptides described above are closely related to the onset of non-syndromic deafness, and thus can be used in a kit comprising reagents effective for detecting the nucleic acids described above or the gene mutations described above or the polypeptides described above, to effectively screen a biological sample suffering from non-syndromic deafness, particularly autosomal recessive non-syndromic deafness.

Drawings

The above and/or additional aspects and advantages of the present invention will become apparent and readily appreciated from the following description of the embodiments, taken in conjunction with the accompanying drawings of which:

FIG. 1 shows an autosomal recessive non-synthetic deafness Trio family plot provided according to an embodiment of the present invention.

Figure 2 shows pure tone audiometry results for patients in a patient's family provided in accordance with one embodiment of the present invention.

Figure 3 shows a representative Sanger sequencing validation peak plot of the c.1001+5G > C mutation site of the SLC26a4 gene for all family members in a patient's family provided according to one embodiment of the present invention.

Figure 4 shows a representative Sanger sequencing validation peak plot of the c.128delg mutation site of the SLC26a4 gene for all family members in a patient's family provided according to one embodiment of the present invention.

Detailed Description

The embodiments described below with reference to the drawings are illustrative and intended to be illustrative of the invention and are not to be construed as limiting the invention. Also, certain terminology is used herein for the purpose of description and illustration only and is not to be taken as a limitation on the scope of the invention.

Herein, the term "non-syndromic deafness" is also commonly referred to in the art as "non-syndromic hereditary deafness", which refers to deafness as the sole symptom of the affected individual, without other genetically impaired sexual organ dysfunction.

The term "autosomal recessive non-syndromic deafness", also commonly referred to in the art as "autosomal recessive non-syndromic hereditary deafness" or as "non-syndromic autosomal recessive deafness" or "non-syndromic autosomal recessive hereditary deafness", means that hereditary deafness is controlled by recessive alleles that occur on autosomes, i.e., both alleles are required to appear recessive, and the patient appears diseased. And since the c.128delG mutation and the c.1001+5G > C mutation show compound heterozygosity, only two sites are mutated, and the patient shows illness.

The invention discovers the c.128delG mutation of a pathogenic site on an autosomal recessive deafness gene SLC26A4, and the mutation and the c.1001+5G > C mutation of the same gene on the other chromosome of a patient form a composite heterozygosis (in trans), thereby causing the occurrence of autosomal recessive non-syndromic deafness. The mutation site can be used for screening autosomal recessive deafness pathogenic mutation carriers, can also be used for molecular diagnosis of autosomal recessive deafness patients and differential diagnosis of related diseases, is rapid, accurate, efficient, simple and convenient, has high early diagnosis rate, and can provide scientific basis for early diagnosis, differential diagnosis and drug treatment of autosomal recessive deafness.

It should be noted that the mutation site on the SLC26a4 gene provided herein can be used as a marker of non-syndromic deafness, more specifically, an autosomal recessive non-syndromic deafness; or the presence of these mutation sites is indicative of a biological sample having non-syndromic deafness, more particularly autosomal recessive non-syndromic deafness. This does not mean that "non-syndromic deafness" or "autosomal recessive non-syndromic deafness" is a restriction of this mutation site in the SLC26A4 gene. That is, if the disease characterized by the SLC26A4 gene at the mutation site is to be specifically indicated or indicated, it is known that it is indicative that the biological sample is afflicted with non-syndromic deafness, more specifically autosomal recessive non-syndromic deafness; but can just as well be informed directly, depending on the specific purpose or on the subject, that genetic deafness, or rather deafness, is present.

Herein, the DNA sequence (e.g., intron sequence, exon sequence, etc.), RNA sequence, encoded protein information, etc. of the wild-type SLC26A4 gene are all included in the NCBI database and can be obtained by reference to the following website:https://www.ncbi.nlm.nih.gov/gene/5172. c.128delG mutation, c.1001+5G shown herein>The C mutations were determined with reference to the cDNA and intron sequences of the wild-type SLC26A4 gene in the NCBI database.

Here, the c.128delG mutation is shown to be a G base deletion at the 128 th base in the cDNA of the wild type SLC26A4 gene.

For purposes of illustration, the DNA sequence of the wild-type SLC26A4 gene portion is provided as follows, and the c.128delG mutation is the deletion of the double underlined bold bases corresponding to the portion of the wild-type sequence (SEQ ID NO:1) as the base G that occurs.

SEQ ID NO:1 (corresponding to NCBI Reference Sequence: NM-000441.1 for NCBI databases, corresponding to Sequence segments: INTRON1-EXON2-INTRON2, wherein the bases indicated with a repetition number.

Accordingly, the c.128delG mutation of the SLC26A4 gene resulted in an amino acid change, which can be expressed as p.Arg43ProfsTer23, representing that the 43 th amino acid of the mutated polypeptide was changed from arginine (Arg) to proline (Pro) with a frame shift and a termination after a frame shift of 23 amino acids (with the proline after the 43 th mutation as the first amino acid after the frame shift) compared to the amino acid expressed by the wild-type SLC26A4 gene.

Likewise, the c.1001+5G > C mutation shown herein refers to the G base mutation to a C base occurring at position 5 of intron8 of the wild-type SLC26a4 gene.

For convenience of examination, a partial DNA sequence of the wild-type SLC26A4 gene is provided as shown in SEQ ID NO:2 (wherein the base underlined in double underline is a mutant base, and the base G is mutated to the base C).

SEQ ID NO:2 (sequence segment: INTRON6-EXON7-INTRON7-EXON8-INTRON8, in which the bases indicated with a repetition number are an INTRON sequence)

Accordingly, c.1001+5G > C mutation of the SLC26A4 gene affects splicing, resulting in a frameshift mutation of the amino acids.

It should be noted that the mutation sites and sequences given above are all referred to the contents included in the NCBI database, and it should be understood by those skilled in the art that the mutation sites and sequences shown may be slightly different or changed due to the update of the database or the difference of the database, and the differences or changes may be determined by the contents of the database given as the standard, and are also included in the protection scope of the present invention.

Furthermore, as will be understood by those skilled in the art, the wild-type SLC26A4 gene sequence position used herein is based on the sequence of the wild-type SLC26A4 gene in the human genome GRCh38, but the sequence may differ when the wild-type SLC26A4 gene is present in other species, and the wild-type SLC26A4 gene of that species may be aligned with the wild-type SLC26A4 gene in the human genome to obtain the corresponding position in the wild-type SLC26A4 gene of that species.

Gene mutation

In one aspect of the invention, the invention features a genetic mutation. According to embodiments of the present invention, there is a c.128delg mutation and/or a c.1001+5G > C mutation as compared to the wild-type SLC26a4 gene. The inventor finds that the c.128delG mutation and/or the c.1001+5G > C mutation on the gene are closely related to the onset of non-syndrome deafness (such as autosomal recessive non-syndrome deafness), so that whether the biological sample suffers from non-syndrome deafness can be effectively detected by detecting whether the gene mutation occurs in the biological sample.

A gene mutation generally refers to a change in the structural base pair composition or arrangement of genes. Herein, the gene mutation refers to deletion, insertion, substitution, etc. of a base occurring on the SLC26A4 gene. The gene mutation can be detected or identified as a mutation site in the SLC26A4 gene, as part of the nucleic acid of the SLC26A4 gene or the entire nucleic acid of the SLC26A4 gene. Of course, it can be said that the gene mutation can be selected. The gene mutation can be detected by using an antibody, a probe, a primer, a mass spectrometric detection reagent and the like which are commonly used in the field.

Nucleic acids

In yet another aspect of the invention, a nucleic acid is provided. According to an embodiment of the invention, the nucleic acid has the following mutations compared to the wild type SLC26a4 gene: a 128delG mutation and/or a c.1001+5G > C mutation. The inventor finds that the c.128delG mutation and/or c.1001+5G > C mutation of SLC26A4 gene are closely related to the onset of non-syndrome deafness, so that whether the biological sample suffers from non-syndrome deafness can be effectively detected by detecting whether the nucleic acid exists in the biological sample.

For the purposes of the present description and claims, reference to nucleic acids will be understood by those skilled in the art to include virtually either or both of the complementary strands. For convenience, in the present specification and claims, although only one strand is given in most cases, the other strand complementary thereto is actually disclosed. For example, reference to the sequence of the SLC26a4 gene actually includes the complement thereof. One skilled in the art will also appreciate that one strand may be used to detect the other strand and vice versa.

Polypeptides

In another aspect of the invention, the invention features a polypeptide. According to an embodiment of the present invention, the amino acid sequence of the polypeptide expressed by the wild-type SLC26a4 gene has the following mutations compared to the amino acid sequence of the polypeptide: amino acid frameshift mutations caused by p.arg43proffsterr 23 and/or c.1001+5G > C mutations. As mentioned above, the c.128delG mutation and/or c.1001+5G > C mutation of SLC26A4 gene are closely related to the onset of non-syndromic deafness, and the protein expressed by the mutant gene is also closely related to the onset of non-syndromic deafness, so that whether a biological sample suffers from non-syndromic deafness can be effectively detected by detecting whether the polypeptide exists in the biological sample.

Use of reagent for detecting nucleic acid, gene mutation and polypeptide in preparation of kit or equipment

In a further aspect of the invention, the invention provides the use of a reagent for a mutation in a gene as hereinbefore described or a nucleic acid as hereinbefore described or a polypeptide as hereinbefore described in the manufacture of a kit or device. According to an embodiment of the invention, the kit or device is for diagnosing non-syndromic deafness. As mentioned above, the gene mutation, nucleic acid, polypeptide described above are closely related to the onset of non-syndromic deafness, and the reagent for detecting the nucleic acid described above or the gene mutation described above or the polypeptide described above can be used to prepare a kit or a device, and the obtained kit or device can effectively screen out biological samples suffering from non-syndromic deafness, especially autosomal recessive non-syndromic deafness.

According to an embodiment of the invention, the non-syndromic deafness is autosomal recessive non-syndromic deafness.

According to an embodiment of the invention, the reagent comprises at least one of an antibody specific for at least one of the nucleic acid, the genetic mutation and the polypeptide, a probe, a primer and a mass spectrometric detection reagent. For example, the inventors can detect the presence of the above mutation in a test sample by the specific binding of an antibody specifically recognizing the polypeptide to the polypeptide, i.e., the presence of the above polypeptide is detected by the interaction of a specific antibody with an antigen; the inventors can also identify the presence of the nucleic acid or gene mutation by designing in advance a probe that specifically recognizes the nucleic acid or gene mutation and complementarily pairing the probe with a nucleic acid fragment in which the site of the nucleic acid or gene mutation is located; the inventors can also design specific primers for amplifying the exons in which the gene mutations are located, and then determine whether the gene mutations exist through gene amplification and sequencing; the inventors also determined the presence of the p.arg43ProfsTer23 polypeptide and/or the c.1001+5G > C mutation causing amino acid frameshift mutation by detecting m/z of the polypeptide by mass spectrometry. At least one of the provided antibody, the probe, the primer and the mass spectrum detection reagent can specifically and high sensitively screen out the nucleic acid or the gene mutation or the polypeptide, and further specifically and high sensitively screen out a biological sample suffering from non-syndrome type deafness, especially autosomal recessive non-syndrome type deafness, and further can be effectively used for preparing a kit or equipment for screening the biological sample suffering from non-syndrome type deafness, especially autosomal recessive non-syndrome type deafness.

Biological model

In another aspect of the invention, the invention provides the use of a biological model for screening for a drug. According to an embodiment of the invention, the biological model carries at least one of the following: (1) the nucleic acid as described above; (2) mutations in the aforementioned genes; (3) expressing the polypeptide as described above. According to the provided biological model, the method can be effectively used as a model for related research of non-syndromic deafness, especially autosomal recessive non-syndromic deafness. These biological models may be cell models or animal models.

Use of agents for the manufacture of a medicament

In a further aspect of the invention, the invention proposes the use of an agent which specifically alters a nucleic acid as described above or a mutation in a gene as described above, in the manufacture of a medicament for the treatment of non-syndromic deafness. It is to be noted that the specific alteration is such that the mutated nucleic acid or mutated site of the gene is restored to its original wild-type state or other non-pathogenic state without substantially affecting other sequences in the genome of the individual. As described above, the aforementioned nucleic acids or the aforementioned gene mutations are closely related to the onset of non-syndromic deafness, and thus, drugs prepared from these agents capable of specifically altering the aforementioned nucleic acids or the aforementioned gene mutations can be effectively used for treating non-syndromic deafness.

According to embodiments of the invention, the agent is an agent based on at least one of shRNA, antisense nucleic acid, ribozyme, dominant negative mutation, CRISPR-Cas9, CRISPR-Cpf1, and zinc finger nuclease. For example, the CRISPR-Cas9 realizes genome modification mainly through three ways of gene knockout, introduction of special variation and site-directed transgene, based on the method of CRISPR-Cas9, the inventors can design sgRNA and synthesize gRNA of the sequence, co-express the gRNA and dCas9 in cells, and mediate d Cas9 protein to bind with a target DNA region through the gRNA, thereby realizing repair or change of a specific site.

Medicine for treating non-syndromic deafness

In another aspect of the invention, the invention provides a medicament for treating non-syndromic deafness. According to an embodiment of the invention, the medicament comprises: an agent which specifically alters the aforementioned nucleic acid or the aforementioned gene mutation. It is to be noted that the specific alteration is such that the mutated nucleic acid or mutated site of the gene is restored to its original wild-type state or other non-pathogenic state without substantially affecting other sequences in the genome of the individual. As described above, the aforementioned nucleic acids or the aforementioned gene mutations are closely related to the onset of non-syndromic deafness, particularly autosomal recessive non-syndromic deafness, and thus, a medicament comprising an agent that specifically alters the aforementioned nucleic acids or the aforementioned gene mutations can be effectively used for treating non-syndromic deafness.

According to embodiments of the invention, the agent is an agent based on at least one of shRNA, antisense nucleic acid, ribozyme, dominant negative mutation, CRISPR-Cas9, CRISPR-Cpf1, and zinc finger nuclease. For example, the CRISPR-Cas9 realizes genome modification mainly through three ways of gene knockout, introduction of special variation and site-directed transgene, based on the method of CRISPR-Cas9, the inventors can design sgRNA and synthesize gRNA of the sequence, co-express the gRNA and dCas9 in cells, and mediate d Cas9 protein to bind with a target DNA region through the gRNA, thereby realizing repair or change of a specific site.

Construct and recombinant cell

In yet another aspect of the invention, the invention features a construct. According to an embodiment of the invention, the construct comprises the nucleic acid or the genetic mutation as described above. The provided construct is transformed into a receptor cell to obtain a recombinant cell, which can be effectively used as a model for related researches on non-syndromic deafness, particularly autosomal recessive non-syndromic deafness. The type of the recipient cell is not particularly limited, and may be, for example, an escherichia coli cell or a mammalian cell, and the recipient cell is preferably derived from a mammal.

The term "construct" as used in the present invention refers to a genetic vector comprising a specific nucleic acid sequence and capable of transferring the nucleic acid sequence of interest into a host cell to obtain a recombinant cell. According to embodiments of the present invention, the form of the construct is not limited, and includes, but is not limited to, at least one of a plasmid, a bacteriophage, an artificial chromosome, a Cosmid (Cosmid), and a virus, preferably a plasmid. The plasmid is used as a genetic carrier, has the characteristics of simple operation, capability of carrying larger fragments and convenience for operation and treatment. The form of the plasmid is not particularly limited, and may be a circular plasmid or a linear plasmid, and may be either single-stranded or double-stranded. The skilled person can select as desired. The term "nucleic acid" used in the present invention may be any polymer containing deoxyribonucleotides or ribonucleotides, including but not limited to modified or unmodified DNA, RNA, the length of which is not subject to any particular limitation. For constructs used to construct recombinant cells, it is preferred that the nucleic acid be DNA, as DNA is more stable and easier to manipulate than RNA.

In yet another aspect of the invention, a recombinant cell is provided. According to an embodiment of the invention, the recombinant cell is obtained by transforming a recipient cell with the construct described above. According to some embodiments of the invention, the recombinant cells of the invention can be effectively used as a model for research related to non-syndromic deafness, in particular autosomal recessive non-syndromic deafness.

According to the embodiment of the present invention, the kind of the recipient cell is not particularly limited, and may be, for example, an escherichia coli cell, a mammalian cell, and preferably, the recipient cell is derived from a non-human mammal.

Kit for detecting non-syndromic deafness

In another aspect of the invention, the invention provides a kit for detecting non-syndromic deafness. According to an embodiment of the invention, the kit comprises reagents for detecting the nucleic acids described above, and/or reagents for detecting the genetic mutations described above, and/or reagents for detecting the polypeptides described above. As described above, the nucleic acids, gene mutations and polypeptides described above are closely related to the onset of non-syndromic deafness, and thus can be used in a kit comprising reagents effective for detecting the nucleic acids described above or the gene mutations described above or the polypeptides described above, to effectively screen a biological sample suffering from non-syndromic deafness, particularly autosomal recessive non-syndromic deafness.

Method for screening biological samples for non-syndromic deafness

In addition to the above, the present invention also provides a method of screening a biological sample for non-syndromic deafness. According to an embodiment of the invention, the method comprises the steps of:

extracting a nucleic acid sample from a biological sample;

determining a nucleic acid sequence of the nucleic acid sample based on the nucleic acid sample;

and (b) determining whether the biological sample has non-syndromic deafness based on whether the nucleic acid sequence of the nucleic acid sample or the complementary sequence thereof has the c.128delG mutation and/or the c.1001+5G > C mutation compared with the wild-type SLC26A4 gene, wherein the presence of the c.128delG mutation and/or the c.1001+5G > C mutation compared with the wild-type SLC26A4 gene is indicative of the biological sample having non-syndromic deafness. The provided method for screening the biological sample suffering from non-syndromic deafness can effectively screen the biological sample suffering from non-syndromic deafness, especially autosomal recessive non-syndromic deafness.

First, a nucleic acid sample is extracted from a biological sample. According to the embodiment of the present invention, the type of the biological sample is not particularly limited as long as a nucleic acid sample reflecting the presence or absence of a mutation in the SLC26A4 gene of the biological sample can be extracted from the biological sample. According to an embodiment of the present invention, the biological sample may be at least one selected from human blood, skin, and subcutaneous tissue. Therefore, the sampling and detection can be conveniently carried out, and the efficiency of screening the biological sample with non-syndromic deafness can be further improved. The term "nucleic acid sample" as used herein is to be understood broadly according to the embodiments of the present invention, and may be any sample capable of reflecting the presence or absence of a mutation in the SLC26A4 gene in a biological sample, such as whole genome DNA directly extracted from the biological sample, a portion of the whole genome containing the coding sequence of the SLC26A4 gene, total RNA extracted from the biological sample, or mRNA extracted from the biological sample. According to one embodiment of the invention, the nucleic acid sample is whole genomic DNA. Therefore, the source range of the biological sample can be expanded, and a plurality of information of the biological sample can be determined simultaneously, so that the efficiency of screening the biological sample suffering from non-syndromic genetic deafness can be improved. In addition, according to an embodiment of the present invention, for using RNA as the nucleic acid sample, extracting the nucleic acid sample from the biological sample may further include: extracting an RNA sample from the biological sample, preferably the RNA sample is mRNA; and obtaining a cDNA sample by reverse transcription reaction based on the obtained RNA sample, the obtained cDNA sample constituting a nucleic acid sample. Thus, the efficiency of screening biological samples suffering from non-syndromic deafness using RNA as a nucleic acid sample can be further improved.

The obtained nucleic acid sample is analyzed, and the nucleic acid sequence of the obtained nucleic acid sample can be determined. According to embodiments of the present invention, the method and apparatus for determining the nucleic acid sequence of the resulting nucleic acid sample are not particularly limited. According to embodiments of the present invention, the nucleic acid sequence of a nucleic acid sample may be determined by a sequencing method. The methods and apparatus that can be used to perform sequencing are not particularly limited, and for example, second generation sequencing techniques can be used, as can third and fourth generation or more advanced sequencing techniques. According to embodiments of the invention, a nucleic acid sequence may be sequenced using at least one of BGISEQ-500, BGISEQ-500RS, HISEQ2000, SOLID, 454, and a single molecule sequencing device. Therefore, by combining the latest sequencing technology, the higher sequencing depth can be achieved for a single site, and the detection sensitivity and accuracy are greatly improved, so that the characteristics of high throughput and deep sequencing of the sequencing devices can be utilized to further improve the efficiency of detecting and analyzing the nucleic acid sample. Therefore, the accuracy and the precision of the subsequent analysis of the sequencing data can be improved. Thus, according to embodiments of the present invention, determining the nucleic acid sequence of the nucleic acid sample may further comprise: firstly, aiming at the obtained nucleic acid sample, constructing a nucleic acid sequencing library; and sequencing the obtained nucleic acid sequencing library so as to obtain a sequencing result consisting of a plurality of sequencing data. According to some embodiments of the invention, the resulting nucleic acid sequencing library may be sequenced using at least one selected from the group consisting of BGISEQ-500, BGISEQ-500RS, HISEQ2000, SOLID, 454, and single molecule sequencing devices. In addition, according to the embodiments of the present invention, the nucleic acid sample may be screened to enrich for the exon of the SLC26a4 gene, and the screening enrichment may be performed before, during or after the construction of the sequencing library. Exon-targeted sequence enrichment systems such as: the capture chip of the Huada major autonomous exon, and other exons or target region capture platforms such as active SureSelect, Nimblegen and the like enrich target fragments. According to one embodiment of the present invention, constructing a nucleic acid sequencing library for a nucleic acid sample further comprises: performing PCR amplification on the nucleic acid sample by using at least one primer selected from SLC26A4 gene specificity; and constructing a nucleic acid sequencing library aiming at the obtained amplification products. Therefore, SLC26A4 gene exon can be enriched by PCR amplification, thereby further improving the efficiency of screening biological samples with non-syndromic hereditary hearing loss. According to the present example, the sequence of SLC26A4 gene specific primers is not particularly limited, and can be obtained by, for example, on-line design using Primer3.0 with reference to the human genome sequence database GRCh37.1/hg19, such as UCSC (http:// genome. UCSC. edu /), Primer3(version 0.4.0, http:// Primer3.ut. ee /) can be applied to design and synthesize candidate gene primers (synthetic by Biotech), and Primer-BLAST (http:// www.ncbi.nlm.nih.gov/tools/Primer-BLAST /) can be used to verify the Primer specificity.

The methods and procedures for constructing sequencing libraries for nucleic acid samples may be suitably selected by those skilled in the art based on different sequencing techniques, and for details of the procedures, reference may be made to the manufacturer of the sequencing instrument, e.g., the protocol provided by Illumina, Inc., see, e.g., Multiplexing Sample Preparation Guide (Part # 1005361; Feb 2010) or Paired-End Sample Preparation Guide (Part # 1005063; Feb 2010), which is incorporated herein by reference. The method and apparatus for extracting a nucleic acid sample from a biological sample according to an embodiment of the present invention are not particularly limited, and may be performed using a commercially available nucleic acid extraction kit.

It should be noted that the term "nucleic acid sequence" used herein should be understood in a broad sense, and may be complete nucleic acid sequence information obtained by assembling sequencing data obtained by sequencing a nucleic acid sample, or may be nucleic acid sequences directly obtained by sequencing nucleic acid samples (reads), as long as the nucleic acid sequences contain the coding sequence corresponding to the SLC26a4 gene.

Finally, after determining the nucleic acid sequence of the nucleic acid sample, the obtained nucleic acid sequence is aligned with a reference sequence, and when the obtained nucleic acid sequence has the aforementioned mutation, it indicates that the biological sample suffers from non-syndromic deafness. Thus, by the method for screening a biological sample suffering from non-syndromic deafness according to the embodiment of the present invention, a biological sample suffering from non-syndromic deafness can be effectively screened. The method and apparatus for aligning a nucleic acid sequence with a corresponding wild-type gene sequence according to embodiments of the present invention are not particularly limited and may be performed using any conventional software, and according to embodiments of the present invention, alignment may be performed using SOAPALIGNER/SOAP 2.

It should be noted that the use of the "method for screening a biological sample suffering from non-syndromic deafness" according to the embodiment of the present invention is not particularly limited, and for example, the method can be used as a screening method for non-diagnostic purposes, for example, in scientific research or other applications such as the production process of kits.

The scheme of the invention will be explained with reference to the examples. It will be appreciated by those skilled in the art that the following examples are illustrative of the invention only and should not be taken as limiting the scope of the invention. The examples, where specific techniques or conditions are not indicated, are to be construed according to the techniques or conditions described in the literature in the art or according to the product specifications. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

Example 1 determination of autosomal recessive deafness-causing mutations

1. Sample collection

The inventor collects the Trio family (parents + probands) of Chinese Han family autosomal recessive non-syndromic deafness patients, and the family chart is shown in figure 1.

As shown in FIG. 1, the family includes 3 members, the daughter is deaf (i.e. II-1 in the family map) and the parents are normal (i.e. I-1, I-2 in the family map), and the autosomal recessive inheritance pattern is conformed. The solid icon is the patient, the semi-solid icon is the carrier, and the arrow indicates the proband.

The pure tone audiometry results of patients in this family are shown in figure 2. In fig. 2, the abscissa represents the frequency of a pure tone and the ordinate represents the hearing level, and if the hearing is normal, the threshold curve should be floating around 0. As shown in FIG. 2, pure tone audiometry results showed extremely severe deafness in patient II-1 in both ears.

The inventors collected peripheral blood samples from all members of the family, added EDTA for anticoagulation, and stored at-80 ℃. All blood samples had signed an informed consent.

2. DNA extraction

Taking peripheral blood of all members of the family, extracting the genomic DNA of peripheral blood leucocyte by QIAmp BLOOD kit (Qiagen, Hilden, Germany), and measuring the concentration and purity of the DNA by using a QubitFluorometer and agarose gel electrophoresis, wherein the obtained genomic DNA OD260/OD280 of each sample is between 1.7 and 2.0, the concentration is not less than 50 ng/microliter, and the total amount is not less than 3 micrograms.

3. Capture sequencing

Samples of all family members were sequenced using a liquid phase capture system such as Agilent, combined with the high throughput sequencing technology of Illumina Hiseq 2500. The capture range comprises the exon region of the whole genome (accounting for about 1 percent of the whole genome), the total length of the capture region can reach 50M, the sequencing data volume is 10-12Gb, and 100 multiplied by the effective sequencing depth. The main steps include breaking, library preparation and sequencing on machine.

And after the sequencing data is downloaded, performing mutation detection, annotation and database comparison by using an internal customization process, and determining candidate pathogenic sites according to the means such as crowd frequency, software prediction results, family analysis and the like.

Results a composite hybrid C [1001+5G > C ] was found in the patient's SLC26a4 gene; [128delG ] mutation. Pedigree analysis showed that the patient's father and mother were c.1001+5G > C mutation and c.128delg heterozygous carriers, respectively.

According to the recessive inheritance pattern of SLC26A4 gene-related deafness, if C. [1001+5G > C ]; the [128delG ] mutation was confirmed to be true positive by Sanger, and the two mutations constituting the compound heterozygous could be basically identified as the causative factors of deafness in patients. This complex mutation was then verified by the Sanger method.

Example 2 sequencing validation by Sanger method

The SLC26A4 gene was tested for all family members (including patients and hearing-normal parents) in the family of autosomal recessive non-synthetic deafness patients provided in example 1:

designing primers aiming at the c.1001+5G > C and c.128delG mutations of the SLC26A4 gene, obtaining a related sequence of a mutation site by PCR amplification, product purification and sequencing, determining whether the mutation site belongs to a mutant type or a wild type, and verifying whether the c.1001+5G > C and c.128delG mutations of the SLC26A4 gene are detected in a sample.

The method comprises the following specific steps:

1. DNA extraction

According to the DNA extraction method described in example 1, genomic DNA in peripheral venous blood of a subject was extracted for use.

2. Primer design and PCR reaction

Firstly, specific primers are designed aiming at the c.128delG mutation and the c.1001+5G > C mutation of the SLC26A4 gene respectively by referring to a human genome reference sequence GRCh37/hg19, and specific sequences are as follows:

the primer sequences for the c.128delG mutation of SLC26A4 gene are as follows:

an upstream primer 1: TTTCTGTTCCTCGCTCTTCCC (SEQ ID NO:3, corresponding to the sequence shown by the wavy line in SEQ ID NO:1)

A downstream primer 1: TTCCCTCCCCAAGGCGTG (SEQ ID NO:4, reverse complement to the sequence shown by the wavy line in SEQ ID NO:1)

The primer sequences for the c.1001+5G > C mutation of the SLC26a4 gene were as follows:

an upstream primer 2: ATGGTCTCTGTATCAACCAACA (SEQ ID NO:5, corresponding to the sequence shown by the wavy line in SEQ ID NO: 2)

A downstream primer 2: GGAGTATCAGTGAAATGAAGCTTGT (SEQ ID NO:6, reverse complement to the sequence shown by the wavy line in SEQ ID NO: 2)

Then, PCR reaction systems of the DNA samples were prepared and PCR reactions were performed (using different primer pairs for amplification respectively) according to the following ratios:

the reaction system was as follows (20. mu.l):

name of reagent	Single reaction Standard quantity (. mu.L)
		ddH2O	12.8
10×Buffer	2.0
		dNTP(2.5mM)	2.0
Upstream primer (10pmol)	1.0
		Downstream primer (10pmol)	1.0
Taq enzyme (5U/q)	0.2
		DNA template	1.0
In total	20.0

The PCR reaction conditions were as follows:

thus, PCR amplification products of the genomic DNA samples of each subject were obtained.

3. Sanger sequencing

And (3) directly carrying out DNA sequencing after purifying the PCR product obtained in the step (2), and carrying out forward and reverse sequencing on the sequencing by using an ABI3730XL sequencer. The sequencing results are shown in FIGS. 3 and 4.

Figure 3 shows a representative Sanger sequencing validation peak plot of the c.1001+5G > C mutation site of the SLC26a4 gene for all family members in a patient's family. As shown in FIG. 3, the patient and the father with normal hearing are heterozygous carriers of the SLC26A4 gene c.1001+5G > C mutation, and the mother of the patient is homozygous wild type, indicating that the mutation of the patient is from the father.

Figure 4 shows a representative Sanger sequencing validation peak plot of the c.128delg mutation site of the SLC26a4 gene for all family members in the patient's family. As can be seen from FIG. 4, the patient was heterozygous carrier for the c.128delG mutation in SLC26A4 gene with a mother with normal hearing, and the patient's father was homozygous wild type, suggesting that the mutation originated from the mother.

Combining the above information, it can be confirmed that the complex heterozygous genotype composed of c.1001+5G > C and c.128delG mutations of SLC26A4 gene is the causative factor of II-1 of deafness patients in this family of recessive deafness.

Example 3 detection kit

Preparing a detection kit which comprises primers of c.1001+5G > C and c.128delG mutation capable of detecting SLC26A4 gene and is used for screening biological samples susceptible to autosomal recessive nonsyndromic deafness, wherein the primers are SLC26A4 gene specific primers, and the sequences of the primers are shown as SEQ ID NO. 3-4 and SEQ ID NO. 5-6 in embodiment 2.

The method for screening the biological sample susceptible to autosomal recessive nonsynthetic deafness by using the kit comprises the following specific steps:

extracting the DNA of a person to be tested according to the method described in the step 2 of the example 1, carrying out PCR reaction with the specific primer of the SLC26A4 gene by taking the extracted DNA as a template (see the example 2 for a PCR reaction system and reaction conditions), purifying PCR products according to a conventional method in the field, sequencing the purified products, and then observing whether the sequence obtained by sequencing has c.1001+5G > C and c.128delG mutations, so that whether the SLC26A4 gene mutant exists in the DNA of the person to be tested can be effectively detected, and therefore whether the person to be tested is susceptible to autosomal recessive non-synthetic deafness can be effectively detected, and further, a biological sample susceptible to autosomal recessive non-synthetic deafness can be screened from the person to be tested.

In the description herein, references to the description of the term "one embodiment," "some embodiments," "an example," "a specific example," or "some examples," etc., mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, the schematic representations of the terms used above are not necessarily intended to refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, various embodiments or examples and features of different embodiments or examples described in this specification can be combined and combined by one skilled in the art without contradiction.

Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention, and that variations, modifications, substitutions and alterations can be made to the above embodiments by those of ordinary skill in the art within the scope of the present invention.

SEQUENCE LISTING

<110> Shenzhen Hua Dagen shares GmbH

Union Medical College Affiliated Hospital of Tongji Medical College Huazhong University of science and technology

<120> SLC26A4 gene mutant and application thereof

<130> PIDC3200108

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 309

<212> DNA

<213> Artificial Sequence

<220>

<223> wild type SLC26A4 Gene

<400> 1

tttctgttcc tcgctcttcc cctccgatcg tcctcgctta ccgcgtgtcc tccctcctcg 60

ctgtcctctg gctcgcaggt catggcagcg ccaggcggca ggtcggagcc gccgcagctc 120

cccgagtaca gctgcagcta catggtgtcg cggccggtct acagcgagct cgctttccag 180

caacagcacg agcggcgcct gcaggagcgc aagacgctgc gggagagcct ggccaagtgc 240

tgcaggtagc ggccgcgcgg gcctgcgtag agagaagcgg agcggggcgt ccacgccttg 300

gggagggaa 309

<210> 2

<211> 623

<212> DNA

<213> Artificial Sequence

<220>

<223> wild type SLC26A4 Gene

<400> 2

atggtctctg tatcaaccaa cacattttta tcattttact gaaacttttg agtgttgttt 60

gatgctgata tcatggtttt tcatgtggga agattcatat gagaattgat tgtgtgtgtg 120

tgcgtgtgtg tgtgctcgtg tgcgtgtagc agcaggaagt atataaaatt attttctttt 180

tatagacgct ggttgagatt tttcaaaata ttggtgatac caatcttgct gatttcactg 240

ctggattgct caccattgtc gtctgtatgg cagttaagga attaaatgat cggtttagac 300

acaaaatccc agtccctatt cctatagaag taattgtggt aagtagaata tgtagttaga 360

aagttcagca ttatttggtt gacaaacaag gaattattaa aaccaatgga gtttttaaca 420

tcttttgttt tatttcagac gataattgct actgccattt catatggagc caacctggaa 480

aaaaattaca atgctggcat tgttaaatcc atcccaaggg ggtgagtgtg gtgttcctct 540

tagtactaat acattaagtc agtaagtcag tctttttatt taaataaaac cttttattac 600

aagcttcatt tcactgatac tcc 623

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> upstream primer 1

<400> 3

tttctgttcc tcgctcttcc c 21

<210> 4

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> downstream primer 1

<400> 4

ttccctcccc aaggcgtg 18

<210> 5

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> upstream primer 2

<400> 5

atggtctctg tatcaaccaa ca 22

<210> 6

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> downstream primer 2

<400> 6

ggagtatcag tgaaatgaag cttgt 25