1. A lactic acid bacterium transformed with a plasmid capable of expressing in said bacterium a protein selected from the group consisting of CXCL12, CXCL17 and Ym1, wherein said bacterium is Lactobacillus reuteri (Lactobacillus reuteri).

2. The lactic acid bacterium of claim 1, wherein the plasmid comprises a nucleotide sequence encoding a protein selected from the group consisting of:

(i) murine CXCL12-1 α, having the amino acid sequence of SEQ ID NO: 3 or 2;

(ii) human CXCL12-1 α having the amino acid sequence of SEQ ID NO: 6 or 5;

(iii) murine CXCL17 having the amino acid sequence of SEQ ID NO: 9 or 8;

(iv) human CXCL17 having the amino acid sequence of SEQ ID NO: 12 or 11;

(v) murine Ym1, having the amino acid sequence of SEQ ID NO: 15 or 14; and

(vi) human Ym1, as set forth in SEQ ID NO: 18 or 17.

3. The lactic acid bacterium of claim 1 or claim 2, wherein the plasmid comprises one or more regulatory sequences that allow expression in the lactic acid bacterium, wherein the regulatory sequences are obtained or derived from the lactic acid bacterium.

4. The lactic acid bacterium of claim 1 or claim 2, wherein expression of the protein is regulatable.

5. The lactic acid bacterium of claim 1 or claim 2, wherein the plasmid comprises one or more nucleotide sequences encoding one or more of the proteins under the control of an inducible promoter.

6. The lactic acid bacterium of claim 1 or claim 2, wherein the plasmid comprises inducible promoter and regulatory elements from the nisin modulator, sakacin a modulator, or sakacin P modulator of the lactic acid bacterium.

7. The lactic acid bacterium of claim 5, wherein the inducible promoter is a PorfX promoter from the sakacin P regulator.

8. The lactic acid bacterium of claim 1 or claim 2, wherein the plasmid is derived from a plasmid having the sequence of SEQ ID NO:20 sequence of plasmid named pSIP 411.

9. The lactic acid bacterium of claim 1 or claim 2, wherein the nucleotide sequence encoding the protein is codon optimized for expression in the lactic acid bacterium.

10. The lactic acid bacterium of claim 1 or claim 2, wherein the plasmid comprises one or more nucleotide sequences selected from the group consisting of: comprises the amino acid sequence of SEQ ID NO: 1. SEQ ID NO: 4. SEQ ID NO: 7. SEQ ID NO: 10. SEQ ID NO: 13 and SEQ ID NO: 16.

11. A wound dressing comprising a bacterium as defined in claim 1 or claim 2.

12. A medical device comprising a lactic acid bacterium according to claim 1 or claim 2.

13. A composition comprising a bacterium as defined in claim 1 or claim 2.

14. Use of a lactic acid bacterium as defined in claim 1 or claim 2 in the manufacture of a therapeutic product for wound healing in a human or animal subject.

15. The use of claim 14, wherein the bacteria are administered directly to a wound site.

16. The use according to claim 14 or claim 15, wherein the wound is a mucosal wound.

17. A kit, comprising:

(i) the lactic acid bacterium as defined in claim 1 or claim 2, wherein the plasmid comprises a nucleotide sequence encoding the protein under the control of an inducible promoter, the plasmid being capable of expressing the protein in the lactic acid bacterium; and

(ii) an inducer for said promoter.

18. The kit of claim 17, wherein the lactic acid bacteria are freeze-dried.

19. The kit of claim 18, wherein the kit further comprises a liquid for resuspending the freeze-dried lactic acid bacteria.

20. The kit of claim 19, wherein the liquid comprises an inducing agent.

21. The kit of claim 17, wherein the kit comprises a wound dressing comprising the lactic acid bacterium.

22. The kit of claim 17, wherein the kit further comprises a wound dressing.

23. Use of a lactic acid bacterium in the manufacture of a kit for wound healing in a human or animal subject, the kit comprising:

(i) the lactic acid bacterium as defined in claim 1 or claim 2, wherein the plasmid comprises a nucleotide sequence encoding the protein under the control of an inducible promoter, the plasmid being capable of expressing the protein in the lactic acid bacterium; and

(ii) an inducer for said promoter.

24. The use of claim 23, wherein the wound is a mucosal wound.

Background

The process of wound healing has overlapping phases (coagulation, inflammation and proliferation/remodeling phases) in which the composition of the local microenvironment changes over time, with different cell types playing different roles. Key cellular participants in the healing process are platelets, keratinocytes/epithelial cells, fibroblasts/myofibroblasts, different immune cells and endothelial cells. All tissues in the body may be injured and the healing process is somewhat specific to the organ, but the initial signals caused by damaged cells are similar. The wound healing form of greatest interest is on the skin.

Tissue damage disrupts homeostasis, initiates the coagulation process and activates the sympathetic nervous system. Platelet release signals for clot formation, mainly PDGF (platelet derived growth factor) and TGF (transforming growth factor), alter the local environment (see document 1). The injured and stressed cells release an alarm signal that triggers the recruitment of immune cells such as neutrophils and monocytes. Within the wound tissue, immune cells secrete various chemokines, growth factors such as VEGF-A, FGF and EGF (vascular endothelial growth factor a, fibroblast growth factor, epidermal growth factor), ROS (reactive oxygen species) and matrix digestive enzymes, which alter the microenvironment and allow the healing process to enter the proliferative phase where macrophages remove necrotic and dead tissue. Cells from the wound margins, such as fibroblasts and keratinocytes, migrate inward to the center of the wound and cover the wound surface with a layer of collagen and extracellular matrix. Fibroblasts within the wound are then transformed into myofibroblasts expressing contractile alpha-SMA (alpha-smooth muscle actin), causing the wound to contract and eventually close. The transition from fibroblasts to myofibroblasts depends on signals from the microenvironment, some of which are derived from immune cells, mainly macrophages. In this process, blood vessels grow to form newly formed tissue, granulation tissue. In addition to immune cell recruitment and migration to the site of the lesion, blood flow to adjacent areas is often increased at this stage to increase the availability of oxygen and nutrients.

After wound closure, the lesion is re-epithelialized by keratinocytes/epithelial cells, thereby restoring the integrity of the organ barrier. Even after wound closure, some tissue remodeling occurs to normalize the matrix structure, and most of the immune cells involved die or leave the site. In addition, at this stage, dead or dying cells are taken up and cleared (phagocytosed) by the remaining tissue macrophages (reference 1). Faster wound healing alleviates complications and discomfort for the patient.

Wounded or delayed skin or mucosal wound healing is a global clinical problem that leads to pain, direct exposure to pathogens, loss of tissue function, and loss of temperature and fluid balance regulation. There are several situations in which a tightly controlled wound healing process is impaired and skin or mucosal wounds remain unhealed for longer than normal, and in the worst case become chronic.

Reducing blood flow to the skin, particularly at the extremities, significantly reduces the efficiency of the healing process. Several clinical situations with reduced skin perfusion or impaired vascular system function such as PAD (peripheral arterial disease), intermittent claudication, venous insufficiency or vascular occlusion of arteriosclerotic plaques. Impaired blood flow to the wound area results in oxygen and nutrient starvation, and cells that assist tissue reconstruction die from necrosis or the inability to perform tasks at the site. Furthermore, if not adequately supplied, the surrounding tissue will fail and eventually begin to die. The tissue is very metabolically active during the remodeling stage and oxygen consumption is high.

Another factor that interferes with the healing of skin wounds is hyperglycemia and diabetes. Under hyperglycemic conditions, cell signaling and immune system function are impaired. Complications resulting from diabetes include microvascular changes and damage to peripheral neurons. Therefore, diabetics often develop chronic wounds on the feet, commonly referred to as diabetic feet. The treatment available today for these patients is surgical debridement or collagenase to remove dead tissue in conjunction with systemic antibiotic therapy and wound closure dressings. In some experimental studies, growth factors and biomaterials have been applied to chronic wounds (reference 2).

Stromal cell derived factor 1(SDF-1), also known as C-X-C motif chemokine 12(CXCL12), is a chemokine protein encoded in the body by the CXCL12 gene. WO2009/079451 discloses a method for promoting wound healing in a subject comprising administering SDF-1 directly to the wound or an area proximate to the wound in an amount effective to promote wound healing in the subject.

It has been demonstrated that wound healing can be promoted if certain probiotics (Lactobacillus reuteri ATCC PTA 6475) are supplemented in the drinking water during the healing process (reference 9), i.e. bacteria are ingested. Furthermore, the supernatant of a culture of Lactobacillus plantarum (Lactobacillus plantarum) has been shown to inhibit biofilm production by Pseudomonas aeruginosa (Pseudomonas aeruginosa) which normally infects chronic wounds (reference 10).

It has surprisingly been found that lactic acid bacteria modified according to the invention to express specific proteins (e.g. cytokines) can be used to promote wound healing. Lactic acid bacteria are sparsely present on human skin (reference 13) and are not the intended choice of bacteria for any intervention in the skin. Lactobacillus (lactobacillus) are difficult to work because they grow relatively slowly and require special media and conditions compared to more commonly used bacteria such as e.coli and s.aureus. In addition, lactobacilli have limited intracellular mechanisms for transcription, translation, and protein folding. For this reason, it is necessary to optimize the nucleotide sequence encoding the heterologous protein to suit the specific bacterial strain.

The different stages of wound healing include different key events that can be varied to alter the healing process. Vascular remodeling during healing is highly dependent on the induction of hypoxia inducible factor 1 alpha (HIF-1 alpha) that regulates the expression of VEGF-A (vascular endothelial growth factor A) and a range of chemokines, such as CXCL12 (also known as SDF-1; SEQ ID NOS: 3 and 6). CXCL12 is constitutively expressed in tissues and plays a role in inducing various cell behaviors through the receptor CXCR4 found on leukocytes and endothelial cells (reference 3). CXCL12 was found to have high levels in macrophages dedicated to tissue remodeling (reference 4). Cutaneous overexpression of CXCL12 using lentiviral vectors improved wound healing in diabetic mice (see document 5).

Another recently discovered chemokine is CXCL17(SEQ ID NOs: 9 and 12), which has a similar effect on the phenotype of tissue macrophages as CXCL 12. Similar to CXCL12, CXCL17 co-regulates VEGF-a measured in cell culture (reference 6). CXCL17 was mainly found in mucosal tissues and was reported to have a direct antibacterial effect against pathogenic bacteria also found on the skin, but had no effect on the survival of Lactobacillus casei (ref 7).

Another protein of interest is the chitinase-like protein Ym1(SEQ ID NO: 15 and 18). Chitin is a common polysaccharide in bacterial biofilms. Ym1 is capable of both preventing biofilm formation and inducing macrophage functions important for tissue remodeling and wound healing, and is specific for macrophages because it is not absorbed by vascular or epithelial cells (see document 8).

Disclosure of Invention

Thus, in a first aspect, the present invention provides a recombinant plasmid capable of expressing a protein in a lactic acid bacterium (i.e. when transformed into a lactic acid bacterial cell), wherein the protein is useful for improving wound healing, for example skin or mucosal wound healing, in a human or animal subject. Preferably, the protein is useful for wound healing due to its ability to target immune cells such as macrophages and their precursors. Preferably, the protein is a cytokine or chemokine. Most preferably, the protein is selected from the group consisting of murine CXCL12, particularly murine CXCL12-1 alpha (SEQ ID NO: 3); human CXCL12, particularly human CXCL12-1 α (SEQ ID NO: 6); murine CXCL17(SEQ ID NO: 9); human CXCL17(SEQ ID NO: 12); murine Ym1(SEQ ID NO: 15); and human Ym1(SEQ ID NO: 18).

The first aspect of the invention more particularly provides a plasmid capable of expressing a recombinant protein in a lactic acid bacterium (i.e. when transformed into a lactic acid bacterium cell), wherein said plasmid comprises a nucleotide sequence encoding a protein selected from CXCL12, CXCL17 and Ym 1.

More specifically, the nucleotide sequence may encode murine CXCL12, particularly murine CXCL12-1 α; human CXCL12, in particular human CXCL12-1 α; murine CXCL 17; human CXCL 17; murine Ym 1; or human Ym 1.

In one embodiment, the plasmid comprises a nucleotide sequence encoding a protein selected from the group consisting of a polypeptide having the amino acid sequence of SEQ ID NO: 3 or 2 or an amino acid sequence having at least 80% sequence identity thereto; has the sequence shown in SEQ ID NO: 6 or 5 or an amino acid sequence having at least 80% sequence identity thereto; has the sequence shown in SEQ ID NO: 9 or 8 or an amino acid sequence having at least 80% sequence identity thereto; has the sequence shown in SEQ ID NO: 12 or 11 or an amino acid sequence having at least 80% sequence identity thereto; has the sequence shown in SEQ ID NO: 15 or 14 or an amino acid sequence having at least 80% sequence identity thereto; and as shown in SEQ ID NO: 18 or 17 or an amino acid sequence having at least 80% sequence identity thereto.

More specifically, plasmids are used to express proteins in lactic acid bacteria, and thus provide or adapt for such use (e.g., they are designed, selected, adapted or modified for specific or particular use in lactic acid bacteria). Thus, in one embodiment, the plasmid is used for specific expression in lactic acid bacteria relative to bacteria or microorganisms in general. The plasmid may be suitable for expression in lactic acid bacteria by regulatory elements (regulatory sequences) and/or coding sequences, e.g. selected or modified for expression in lactic acid bacteria.

Thus, in a more specific aspect, the plasmid comprises one or more regulatory (i.e. expression control) sequences that allow expression or specific expression in a lactic acid bacterium. Thus, the plasmid may contain expression control sequences derived from or suitable for or specific for expression in lactic acid bacteria. Suitable expression control sequences include, for example, translation (e.g., start and stop codons, ribosome binding sites) and transcriptional control elements (e.g., promoter-operator regions, termination stop sequences) linked in matching reading frames to a nucleotide sequence encoding the protein to be expressed. The regulatory sequences are operably linked to the nucleotide sequence encoding the protein such that they drive or control the expression of the protein. The plasmid may be introduced into a lactic acid bacterial cell. Suitable transformation techniques are well described in the literature. Bacterial cells can be cultured or otherwise maintained under conditions that allow expression of the protein from the plasmid. This may include a condition in a wound of the subject.

In one embodiment, the promoter in the plasmid controlling the expression of the protein is a promoter that allows or is specific for expression in lactic acid bacteria. Thus, the plasmid may comprise a nucleotide sequence encoding a protein under the control of (or operably linked to) a promoter capable of expressing the protein in a lactic acid bacterium. In a particularly preferred embodiment, the plasmid comprises a lactic acid bacterium promoter, i.e. the promoter controlling the expression of the protein is a promoter derived from a lactic acid bacterium, or more particularly a gene obtained or derived from expression in a lactic acid bacterium.

In some embodiments, the plasmid may comprise, in addition to the lactic acid bacteria promoter, other regulatory elements or sequences that control the expression of proteins obtained from or derived from lactic acid bacteria. Thus, for example, such other lactic acid bacterial cell expression control elements or sequences may include enhancers, terminators and/or translation control elements or sequences as described above. In some embodiments, the plasmid may further comprise regulatory elements or sequences that control or regulate expression from a promoter, e.g., operator sequences and the like or one or more regulatory genes as discussed further below.

Alternatively or additionally, the plasmid may be adapted (or modified, etc.) for use in lactic acid bacteria by codon optimization of the nucleotide sequence encoding the protein for expression in lactic acid bacteria.

In a preferred embodiment, the promoter used for expression of the protein is a regulated (regulatable) or inducible promoter. Thus, by providing or contacting the bacterium with a regulatory molecule or inducer that activates or initiates (induces) the promoter, expression of the protein can be controlled or regulated (e.g., elicited, as desired or at an appropriate time). This is advantageous in the case of protein delivery to a wound.

Thus, a further aspect of the invention provides an expression system for expressing a protein in a lactic acid bacterium, said expression system comprising (i) a plasmid as defined herein, wherein said plasmid comprises a nucleotide sequence encoding said protein under the control of an inducible promoter, said plasmid being capable of expressing said protein in a lactic acid bacterium; and (ii) an inducer (or regulatory molecule) for the promoter. The expression system may conveniently be provided in the form of a kit comprising components (i) and (ii) as described above.

Another aspect of the invention is a bacterium (bacterium) or bacterium (bacteria) (i.e. bacterial cell or strain) transformed (i.e. comprising) with a plasmid of the invention as defined herein. In particular, the bacterium is a lactic acid bacterium, and thus the present invention provides a lactic acid bacterium (or lactic acid bacterium) comprising a plasmid of the invention as defined herein. Alternatively expressed, this aspect of the invention provides a bacterium (or bacterial cell) into which a plasmid of the invention has been introduced.

As further described herein, the plasmids and bacteria of the present invention are useful for promoting healing, and thus have particular utility in promoting wound healing, defined herein as wounds generally comprising damaged tissue (see below). Thus, a further aspect of the invention provides the use of such plasmids and bacteria in therapy, more particularly in wound healing.

The bacteria may be administered to a wound of a subject to be treated in the form of a pharmaceutical composition. Thus, another aspect of the present invention provides a pharmaceutical composition comprising a bacterium of the invention as defined herein and at least one pharmaceutically acceptable carrier or excipient.

More generally, the present invention provides probiotic products comprising the bacteria of the present invention.

Such products or pharmaceutical compositions may conveniently take the form of wound dressings comprising the bacteria of the present invention. Thus, in a further aspect, the present invention provides a wound dressing comprising a bacterium of the invention as defined above and at least one dressing material.

Another aspect of the invention provides the use of a plasmid or bacterium of the invention as defined herein for the manufacture of a medicament (or probiotic product) for wound healing.

Also provided is a method of treating a subject to heal a wound, the method comprising administering to the subject or the wound of the subject an amount of a bacterium of the invention as defined herein effective to promote wound healing.

Another aspect of the invention provides a kit for healing a wound, the kit comprising:

(i) a lactic acid bacterium comprising a plasmid of the invention as defined herein, wherein said plasmid comprises a nucleotide sequence encoding said protein under the control of an inducible promoter, said plasmid being capable of expressing said protein in a lactic acid bacterium; and

(ii) an inducer (or regulatory molecule) for the promoter.

Another aspect of the invention includes a pharmaceutical product (e.g., a kit or combination product) comprising:

(i) a lactic acid bacterium comprising a plasmid of the invention as defined herein, wherein said plasmid comprises a nucleotide sequence encoding said protein under the control of an inducible promoter, said plasmid being capable of expressing said protein in a lactic acid bacterium; and

(ii) an inducer (or regulatory molecule) for the promoter,

the pharmaceutical products are for separate, sequential or simultaneous use in wound healing (or for treating a wound in a subject) as a combined preparation.

The term "wound healing" is used broadly herein to include any aspect of promoting or improving wound healing. Thus, the various aspects of the invention set out above may alternatively be defined in relation to the use of a plasmid or bacterium in promoting or enhancing or improving wound healing or simply in promoting or enhancing healing.

Thus, wound healing may include or include any effect that results in faster wound healing or more complete healing of the wound, or even any improvement or improvement in wound healing, such as a reduction in healing time, e.g., a reduction in the time to achieve partial or complete closure of the wound, an improvement in wound appearance (e.g., the appearance of a healed or healing wound), a reduction or improvement in scarring, promotion of chronic or refractory wound healing, etc. (i.e., application of the bacteria of the present invention to a wound may induce or cause or initiate healing of the wound, which has not yet healed or has not yet developed any signs of healing). Wounds will be discussed in more detail below.

The subject having a wound to be treated may be any human or animal subject, including for example domestic animals, livestock, laboratory animals, sport animals (sport animals) or zoo animals. The animal is preferably a mammal, but also includes other animals, e.g., birds. Thus, the animal may be a primate, rodent (e.g., mouse or rat), or horse, dog or cat. Most preferably the subject is a human.

Lactic Acid Bacteria (LAB) or lactobacilli (lactobacilli) are branches of gram-positive, low-GC, acid-tolerant, generally non-sporulating, non-respiratory, rod-shaped (bacillus) or coccoid (coccus) bacteria with common metabolic and physiological characteristics. These bacteria produce lactic acid as the main metabolic end product of carbohydrate fermentation, which is characterized by an increased acid resistance (low pH range). These characteristics of LAB allow them to be superior to other bacteria in natural fermentation, as LAB can withstand increased acidity from organic acid production (e.g. lactic acid). LAB therefore plays an important role in food fermentation, as acidification inhibits the growth of spoilage agents. Several LAB strains also produce protein bacteriocins, which further inhibit spoilage and growth of pathogenic microorganisms. LAB is generally recognized as a safe (GRAS) state and is one of the most important microbial populations employed in the food industry.

The core genera containing the branching of lactic acid bacteria are Lactobacillus (Lactobacillus), Leuconostoc (Leuconostoc), Pediococcus (Pediococcus), Lactococcus (Lactococcus), and Streptococcus (Streptococcus), and also more peripheral Aerococcus (Aerococcus), Carnobacterium (Carnobacterium), Enterococcus (Enterococcus), Oenococcus (Oenococcus), Lactobacillus (Sporolactis), Tetragenococcus (Tetragenococcus), Vagococcus (Vagococcus), and Weissella (Weissella). Any lactic acid bacteria of these genera are included within the scope of the present invention, in particular bacteria from the genera Lactobacillus (Lactobacillus) or Lactococcus (Lactococcus).

The plasmid may encode one or more of said proteins. Thus, it may encode a combination of CXCL12, CXCL17, and/or Ym1 proteins (e.g., 2 or more of CXCL12, CXCL17, or Ym 1). Alternatively, it may encode 2 or more types of CXCL12, CXCL17 and/or Ym1 proteins (e.g., murine and human CXCL12, etc.). When more than one protein is encoded, the protein may be expressed from the nucleotide sequence encoding the protein under the control of a single promoter, or more than one promoter may be used. For example, each protein may be expressed from a separate promoter, which may be the same or different. Techniques for expressing 2 or more proteins together from the same plasmid are well known in the art and include, for example, translational coupling techniques and the like, means for achieving this are known and available in the art. For example, multiple transgenes can be expressed simultaneously under one promoter using the P2A and T2A sequences.

The CXCL12, CXCL17, or Ym1 proteins can be natural or native proteins (i.e., the nucleotide sequence can encode a protein having an amino acid sequence found in nature), and can be from any substance that produces these proteins. Typically, the protein will be a mammalian protein, and as noted above, human and murine proteins are preferred. However, the native nucleotide sequence or protein sequence may be modified, for example by one or more amino acid additions, insertions, deletions and/or substitutions, as long as the function or activity of the protein is not substantially or significantly altered, for example, as long as the activity of the protein is substantially retained. The protein may be a fragment or a truncated variant of the native protein. For example, a sequence modified variant protein may exhibit at least 80%, 85%, 90%, or 95% of the activity of the parent protein from which it is derived. This can be assessed according to assays known in the art for the activity of the above proteins. For example, activity assays can be performed in a system of receptor phosphorylation or calcium flux in culture cells treated with the protein after ligation, in a system of chemotaxis in vitro or in vivo of cells in a model of cell recruitment of the infected protein. In vitro chemotaxis-based assays are described in references 22 and 32. Reference 33 describes additional in vitro chemokine activity assays that may be employed. Thus, the terms "CXCL 12", "CXCL 17" or "Ym 1" include not only native proteins but also their functionally equivalent variants or derivatives. Thus, a protein may be a synthetic or sequence-modified variant, or may include one or more other modifications, e.g., post-translational modifications, etc.

As mentioned above, the encoded protein may have the amino acid sequence of a native human or murine protein as described above, i.e. SEQ ID NO: 3 and 6 are murine and human CXCL12, 9 and 12 are murine and human CXCL17, 15 and 18 are murine and human Ym1, respectively, or an amino acid sequence having at least 80% sequence identity to any of the foregoing sequences. Advantageously, as described above, the nucleotide sequences encoding these native proteins may be codon optimized for expression in lactic acid bacteria. This can result in encoded proteins with modified amino acid sequences. For example, a codon optimized sequence may encode a sequence, such as a secretory sequence suitable (or more suitable) for a lactic acid bacterium. Thus, an "optimized" protein encoded by a codon optimized nucleotide sequence may include altered or substituted leader or signal sequences (e.g., secretory sequences) as compared to the native protein. In a preferred embodiment, the mature or cleaved form of the protein encoded by the codon optimized sequence is identical to the native protein. The protein encoded by the codon-optimized nucleotide sequence may have the sequence as set forth in SEQ ID NO: 2. 5, 8, 11, 14 or 17, as set forth in table IV below. Thus, the protein encoded by the plasmid may have the sequence as set forth in SEQ ID NO:2 and 5 are the amino acid sequences of murine and human CXCL12, respectively, 8 and 11 are murine and human CXCL17, respectively, and 14 and 17 are murine and human Ym1, respectively, or an amino acid sequence having at least 80% sequence identity to any of the foregoing sequences.

In other embodiments, the encoded protein may have an amino acid sequence that has at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the above amino acid sequences.

Sequence identity can be readily determined by methods and software known and readily available in the art. Thus, sequence identity may be assessed by any convenient method. However, in order to determine the degree of sequence identity between sequences, computer programs that perform multiple alignments of sequences are useful, for example Clustal W (reference 24). Programs that compare and ALIGN pairs of sequences, such as ALIGN (ref 25), FASTA (ref 26 and ref 27), BLAST and gapped BLAST (ref 28) can also be used for this purpose, and default settings can be employed. In addition, the Dali server of the european bioinformatics institute provides structure-based protein sequence alignments (ref 29, ref 30 and ref 31). Multiple sequence alignments and percent identity calculations can be determined using standard BLAST parameters (e.g., using sequences from all available organisms, matrix Blosum62, gap cost: present 11, extension 1). Alternatively, the following procedures and parameters may be employed: the procedure is as follows: align Plus 4, version 4.10(Sci Ed Central Clone Manager Professional Suite). DNA comparison: global comparison, standard linear scoring matrix, mismatch penalty of 2, open gap penalty of 4, and extended gap penalty of 1. Amino acid comparison: global comparison, BLOSUM62 scoring matrix.

Variants of a naturally occurring polypeptide sequence as defined herein may be generated synthetically, for example by employing standard molecular biology techniques known in the art, for example standard mutagenesis techniques such as site-directed or random mutagenesis (for example employing shuffling or error-prone PCR).

Derivatives of the proteins defined herein may also be encoded. Derivative refers to a protein as described above or a variant thereof, wherein the amino acids are chemically modified, e.g. by glycosylation or the like.

When the protein comprises amino acid substitutions relative to the sequence of the native protein, the substitutions may preferably be conservative substitutions. The term "conservative amino acid substitution" refers to any amino acid substitution in which an amino acid is replaced (substituted) by an amino acid having similar physicochemical properties (i.e., amino acids of the same class/group). For example, the small residues glycine (G), alanine (a), serine (S) or threonine (T); the hydrophobic or aliphatic residues leucine (L), isoleucine (I); valine (V) or methionine (M); the hydrophilic residues asparagine (N) and glutamine (Q); the acidic residues aspartic acid (D) and glutamic acid (E); arginine (R), lysine (K), or histidine (H) with positively charged (basic) residues; or the aromatic residues phenylalanine (F), tyrosine (Y) and tryptophan (W)) may be interchangeably substituted without substantially altering the function or activity of the protein.

As described above, it is preferable to express a protein using an inducible promoter. "inducible" refers to any promoter whose function (i.e., the activity or action that allows or causes transcription of an encoding nucleotide sequence) can be regulated or controlled. The term "inducible" is therefore synonymous and can be used interchangeably with "controllable" (or "regulated"). Thus, there is no constitutive expression of the protein. Thus, expression of the protein may be induced or initiated (or more particularly initiated and switched off). More specifically, expression may be induced or initiated within a limited or defined time. This may be because expression ceases after a period of time, and/or because bacterial cells die.

In some embodiments, there may be no expression (transcription) from the promoter until the promoter is induced (or alternatively referred to as activated). However, as with any biological system, lack of activity may not be absolute, and some basal promoter activity may be present in the absence of promoter activation or induction. However, in preferred embodiments, any basal expression of the non-inducible promoter is low, minimal or insignificant, or more preferably, trace or negligible. Thus, expression from an inducible promoter is advantageously measurable or significantly increased when the promoter is induced compared to when the promoter is not induced.

Inducible promoters are well known in the art, including inducible promoters for use in lactic acid bacteria, and any suitable inducible promoter suitable for expression in lactic acid bacteria may be used.

Inducible promoters may be induced (or activated) in the presence of an inducer or activator molecule, which may act directly or indirectly on the promoter and may be added to induce the promoter, or more generally to cause or effect promoter induction or activation and allow expression of the protein, or may be induced (or activated) by a change in the conditions of the plasmid-containing bacterium, for example by introducing a change in conditions in the lactic acid bacterium, for example starvation or consumption of a particular nutrient. The inducer of the promoter may be encoded by a regulatory gene, which itself may be induced or activated in one embodiment. Thus, the term "inducing agent" is used broadly herein to include any regulatory molecule, or indeed any permissive condition, that can activate or initiate an inducible promoter, or that allows or causes an inducible promoter to be induced. Thus, induction of an inducible promoter may include introduction (e.g., contact with a lactic acid bacterium comprising a plasmid) of a regulatory molecule or conditions that allow induction (activation) of the promoter. In some embodiments, the inducing agent may be an activating peptide. This may induce the promoter directly or indirectly, e.g., as described further below.

As described above, promoters obtained or derived from lactic acid bacteria are preferred. These may be natural promoters or modified or mutated promoters. Suitable promoters may be identified, for example, by growing lactic acid bacteria in a wound and by determining which genes are expressed or upregulated in the bacteria in the wound. Promoters from these genes can then be identified. Alternatively, many different promoters and expression systems in or for lactic acid bacteria have been identified and described or are available in the art, including expression plasmids containing such promoters or expression systems for LAB. Any such known plasmid or expression system can be used as the basis for the recombinant plasmid of the present invention.

Various inducible expression systems are known in the art for LAB such as lactobacillus. One example includes an auto-inducible system based on the manganese starvation inducible promoter of the manganese transporter of lactobacillus plantarum (l.plantarum) NC8 described in reference 19. This system does not require the addition of an external inducer for recombinant protein production.

Duong et al (reference 20) describe expression vectors based on a wide range of pWV01 replicon lactobacilli and contain promoters from operons involved in Fructooligosaccharide (FOS), lactose or trehalose metabolism or transport or glycolysis. Such promoters can be induced by their specific carbohydrates and inhibited by glucose.

More specifically, the inducible expression system may comprise an inducible promoter involved in the production of LAB proteins, in particular bacteriocins. The activity of such a promoter can be controlled by a homologous regulatory system based on bacteriocin regulators, such as a two-component regulatory (signal transduction) system which responds to externally added activation peptides (i.e.inducers/regulatory molecules in the form of peptides) and genes encoding the histidine protein kinase and responsive regulatory factors required for activating the promoter after induction by the activation peptides.

In one embodiment, the expression system may be based on the nisin controlled expression (NICE) system, based on a combination of the nisA promoter and nisRK regulatory genes. This system is based on promoters and regulatory genes from the lactopeptin gene cluster of Lactococcus lactis (Lactococcus lactis) and has been used to develop regulatory gene expression systems for Lactococcus lactis (Lactococcus), lactobacillus and other gram-positive bacteria (briefly described in references 15 and 21). While NICE systems are highly efficient and well regulated in lactococcus lactis, these systems can exhibit significant basal activity. This can be circumvented by limiting the expression system to a specifically designed host strain by integrating histidine kinase and response regulatory genes into the chromosome.

In another embodiment, the expression system may be based on a gene and promoter involved in the production of the class II bacteriocin sakacin A (sap gene) from the sakacin A regulator or sakacin P (spp gene) from the sakacin P regulator. Such a vector is called a pSIP vector, contains a promoter element derived from a structural gene of sakacin A or sakacin P, and has an engineered NcoI site for translational fusion cloning. Various such vectors containing different promoters from regulators and/or different replicons are described in references 21 and 15, and any of these vectors can be used as the basis for the recombinant plasmids of the present invention.

In representative embodiments, the promoter may be P from sakacin A or P regulon_sapA、P_sppAOr P_orfXA promoter, and a regulatory gene related or homologous thereto.

In a particularly preferred embodiment, the plasmid contains the pSH71 replicon, P from the sakacin P regulator, based on the vector pSIP411 shown in FIG. 12 and described in reference 21_orfXPromoters and homologous regulatory genes. Plasmid pSIP411 is designated in this application as pLAB 112. The inducer used in such embodiments is preferably an activating peptide based on the peptide SppIP, e.g. having the sequence of SEQ ID NO: 19 or an amino acid sequence having at least 80% (or more particularly at least 85, 90 or 95) sequence identity thereto. In a preferred embodiment, the recombinant plasmid is derived from a plasmid having the sequence of SEQ ID NO:20, designated pllab 112.

The use of inducible promoters (or inducible expression systems) may provide the advantage of more controlled, in particular prolonged, protein expression in the wound environment, i.e. when the bacteria are administered to a subject or wound. For better efficacy in promoting wound healing, it is advantageous to express the protein at the wound site (e.g. wound surface) using bacteria for a period of time, for example at least 40, 45, 50, 55 or 60 minutes, in particular at least 1 hour or more. Thus, proteins may be expressed for a limited, defined or extended period of time. The results presented in the examples below show that with the plasmids and bacteria according to the invention, proteins can be expressed on the wound surface for a period of about 1 hour. In some embodiments, plasmids and bacteria may be optimized to allow for protein expression (e.g., in a wound) for 2, 3, or4 hours or more.

Thus, continuous expression and delivery of proteins is desirable, and this can be provided by using the transformed bacteria of the present invention. By "continuous" or "extended" is meant that there is protein expression, and thus protein delivery, over a period of time, such as over a period of at least one hour (or similarly, as described above). In particular, this allows the protein to be more effective over a period of time than if the protein was administered directly (i.e. as a protein product rather than expressed by the bacteria).

As described above, the nucleotide sequence encoding the protein may be codon optimized for expression in LAB. Thus, in a preferred embodiment, the nucleotide sequence (or insert) encoding the protein in the recombinant plasmid may be selected from the group consisting of SEQ ID NO: 1.4, 7, 10, 13 and 16, which encode murine CXCL12, human CXCL12, murine CXCL17, human CXCL17, murine Ym1 and human Ym1, respectively, or nucleotide sequences having at least 80% sequence identity thereto.

Thus, in representative embodiments, the recombinant plasmid may be selected from the group consisting of: a plasmid designated mLrCK1 comprising the sequence set forth in SEQ ID NO: 1; mlrck1.4 comprising SEQ ID NO: 1; mlrck1.7 comprising SEQ ID NO: 1; hLrCK1 comprising SEQ ID NO: 4; mLrCK2 comprising SEQ ID NO: 7; hLrCK2 comprising SEQ ID NO: 10; hLrMP1 comprising SEQ ID NO: 13, or a nucleotide sequence shown in seq id no; and mLrMP2 comprising the amino acid sequence set forth in SEQ ID NO: 16.

In some embodiments, the plasmids of the invention comprise a codon-optimized insert mLrCK1 (i.e., the nucleotide sequence of SEQ ID NO: 1), mLrCK1.4 (i.e., the nucleotide sequence of SEQ ID NO: 1), mLrCK1.7 (i.e., the nucleotide sequence of SEQ ID NO: 1), hLrCK1 (i.e., the nucleotide sequence of SEQ ID NO: 4), mLrCK2 (i.e., the nucleotide sequence of SEQ ID NO: 7), hLrCK2 (i.e., the nucleotide sequence of SEQ ID NO: 10), hLrMP1 (i.e., the nucleotide sequence of SEQ ID NO: 13), and mLMP 2 (i.e., the nucleotide sequence of SEQ ID NO: 16) having a nucleotide sequence of at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity.

The sequence identity of a nucleotide molecule can be determined by methods and software known and widely available in the art, for example by using a FASTA search with the GCG package with default values and variable pam factors (pamfactor), and a gap creation penalty set at 12.0 and a gap extension penalty set at 4.0 (window of 6 nucleotides).

Related nucleotide sequences of such sequence identity may be functionally equivalent to SEQ ID NO: 1.4, 10, 13 or 16. These nucleotide sequences may be considered functionally equivalent if they encode a polypeptide which would be considered a functional equivalent to the corresponding CXCL12, CXCL17 or Ym1 protein. Preferred functional equivalents are those which encode the preferred proteins as described above.

In another aspect, the present invention provides a bacterial strain transformed with the above recombinant plasmid. The bacterial strain is preferably a lactic acid bacterial strain such as a Lactobacillus strain or a lactococcus (e.g. lactococcus lactis) strain. More preferably, the bacterial strain is lactobacillus reuteri, such as lactobacillus reuteri R2LC or lactobacillus reuteri DSM 20016. The strains (Lactobacillus reuteri R2LC/DSM20016 and lactococcus lactis) were not found on human skin as determined by phylogenetic analysis of the forearm skin flora of six subjects (reference 13).

In addition to plasmids, expression systems, bacteria and kits, additional products of the invention include pharmaceutical compositions and medical devices comprising bacteria. Such compositions and devices may include, inter alia, wound dressings, packaging materials, swabs, implants, etc., or even any medical device, such as a wire or catheter or implant, that may be introduced or present at a wound site (e.g., at a surgical wound site), either wholly or partially inherent. Also included are probiotic products, i.e. products containing bacteria for administration to a subject, e.g. for oral administration, e.g. for consumption or ingestion, or topical application to a wound or direct application to the wound site, e.g. during surgery, or rectal, vaginal routes, etc.

Thus, the products according to the invention (e.g. plasmids, bacterial strains, probiotics, wound dressings, etc.) may be used in medical therapy, in particular for promoting wound healing in a human or animal subject. As used herein, the term "promoting wound healing" refers to enhancing, ameliorating, increasing, or inducing closure, healing, or repair of a wound. In a preferred aspect of the invention, the human or animal subject is in need of wound healing due to an underlying medical condition resulting in impaired wound healing, such as reduced peripheral blood perfusion (peripheral arterial disease), hyperglycemia or neuropathy, or the subject may be immunocompromised for any reason, such as due to an underlying disease (whether acquired or inherited) or as a therapeutic effect. In particular, the subject may have diabetes.

The wound to be healed may include any injury, trauma or injury to any part of the body of the subject. Examples of wounds that can be treated by this method include acute conditions or wounds; such as thermal (hot or cold), chemical, radiation, electrical, and burns caused by excessive exposure to ultraviolet radiation (e.g., sunburn); damage to body tissues, such as the perineum resulting from labor and childbirth; wounds inflicted during medical procedures, such as vulvotomy, traumatic injuries, including incisions, surgical incisions, abrasions; accidental injury; post-operative injuries and chronic conditions; such as pressure sores, ulcers, conditions associated with diabetes and poor circulation, and all types of acne. In addition, wounds may include dermatitis, wounds after dental surgery; periodontal disease; post-traumatic wounds; and tumor-associated wounds. Other examples are gastrointestinal tract trauma, such as occurs during gastritis or inflammatory bowel disease.

Thus, the term "wound" is used broadly herein to include any breach of the integrity of or any injury or damage to a tissue. Thus, the term includes any injury, trauma or injury to tissue or any injury, regardless (e.g., due to accidental or traumatic injury, surgery or other expected or purposeful injury or disease). The trauma may include any physical or mechanical injury or any injury caused by external agents including pathogens or biological or chemical agents. Tissue damage may also be caused by hypoxia, ischemia, or reperfusion. The wound may comprise any type of burn. The wound may be acute or chronic. A chronic wound may be described as any wound that is not arrested in the healing phase, for example, any wound that is not healing during the inflammatory phase, or for 30, 40, 50 or 60 days or more. Wounds may be present in the internal or external surfaces or tissues of the body.

In particular embodiments, the wound is on an external surface or tissue of the body, such as a skin (i.e., skin) wound or mucosal wound, particularly a wound on an external mucosal tissue or surface of the body (e.g., on the eye, ear, or nose, etc.). In another embodiment, it is a gastrointestinal tract wound. In various embodiments, it is not a gastrointestinal wound (i.e., it is a wound other than a gastrointestinal wound).

The bacteria may be administered in any convenient or desirable manner, for example orally or topically, or by direct administration to the wound site, for example by direct injection or infusion or application or introduction of a pharmaceutical composition or dressing or device containing the bacteria. In other embodiments, it may be administered orally, or intranasally or by inhalation, rectally or vaginally. Thus, bacteria may be administered to, or through, any aperture of the body. For administration to a gastrointestinal wound, the bacteria may be administered orally.

The bacteria may be formulated or prepared for administration by any of the above routes in any convenient or desirable manner, according to the protocol and using means and routes well known in the art. Thus, in addition to pharmaceutical compositions, medical devices, dressings and the like, the probiotic products of the present invention may be formulated and provided in or on a nutritional supplement or food, such as a functional food.

Administration forms for oral administration include powders, tablets, capsules, solutions and the like. For topical application, the product may be formulated as a liquid such as a suspension or spray or aerosol (powder or liquid), gel, cream, lotion, paste, ointment or salve, and the like, or as a dressing of any form, such as a bandage, plaster, pad, strip, swab, sponge, pad, and the like, with or without a solid support or substrate. In addition, bacteria can be disposed (e.g., coated) on the surface of a medical device, such as an implant (e.g., a prosthetic implant), a tube, a wire, or a catheter.

The bacteria may be provided in any convenient or desirable form, for example, as an active or growing culture or in lyophilized or freeze-dried form.

The bacterial strains according to the invention may be formulated for topical or oral administration to treat surface wounds of the skin or mucosa. Accordingly, the present invention further provides a probiotic product comprising a bacterial strain according to the present invention. The probiotic product is for example a pharmaceutical composition, preferably for oral administration. Alternatively, for topical application, the probiotic product is, for example, a lotion or a lotion soaked wound dressing comprising a bacterial strain according to the invention.

The products of the invention (i.e. pharmaceutical compositions or devices or dressings, etc.) may also contain an inducing agent (in which an inducible promoter is used). This may be provided as part of the product (e.g. incorporated into or included in the dressing) or separately, e.g. as part of a kit or combination product, as defined above.

When co-formulated in a product (e.g., a dressing or device), the bacteria and inducer can be provided in a form in which the bacteria are separated from the inducer and brought together (or brought into contact) at the time of use. For example, the bacteria and inducer may be in separate compartments and brought together (e.g., contacted or mixed) at the time of use, or may be separated by a barrier (e.g., a membrane or other partition) that may be broken or collapsed or opened at the time of use.

Alternatively, the inducer can be formulated and provided separately (e.g., in a kit that also contains the bacteria, or a product that contains the bacteria), and the inducer and the bacteria (or product that contains the bacteria) can be brought together (e.g., contacted) during use. This may be done before, during or after administration to the subject. For example, a product comprising bacteria may be administered first, and then an inducer may be added or applied to the bacteria. In another embodiment, the bacteria and the inducing agent can be pre-mixed prior to (e.g., immediately prior to or immediately prior to) or during administration.

When the bacteria are provided in lyophilized or freeze-dried form, it may be desirable to reconstitute or resuspend the bacteria prior to administration (e.g., prior to or during use). This may depend on the wound and the format of the product used. For example, in the presence of some wounds, sufficient fluid may be present to allow the bacteria to be reconstituted/resuspended and become active. However, in other embodiments, it may be desirable to provide a liquid for reconstituting (or alternatively expressed as, for suspending or resuspending) the bacteria. This may be provided in a separate vessel (vessel) or container (container), e.g. as part of a kit or combination product, or in a separate compartment of a container or vessel or device. The liquid may contain or contain the inducer, or when the inducer is present, the inducer may be provided in a separate vessel or container or compartment. The liquid may be any suitable liquid for reconstituting or suspending the freeze-dried bacteria, e.g. water or an aqueous solution, or a buffer or a growth medium or a culture medium.

Thus, as an example, a two-compartment system (e.g., in a dressing or device or container or vessel (e.g., a bottle)) may include freeze-dried bacteria in one compartment and a liquid in the other compartment. The liquid may optionally contain an inducer. In use or prior to use, the two compartments may be mixed or brought into contact and applied to the wound. In more specific embodiments, the bacteria may be applied to the wound in liquid form, and then a separate dressing may be applied. Thus, in a simple embodiment it can be seen that the kit may simply comprise a first vessel or container containing the freeze-dried bacteria and a second vessel or container containing the liquid used to reconstitute the bacteria. Optionally, the kit may also contain an inducing agent, which is also contained in the second vessel or in a separate third vessel or container.

Thus, for example, the probiotic product preferably comprises an activating peptide capable of activating the expression of the protein that is desired to be expressed in the lactic acid bacteria strain. The activating peptide is preferably the peptide SppIP (i.e., a peptide comprising the amino acid sequence of SEQ ID NO: 19 or a sequence having at least 80% sequence identity thereto).

For skin wounds, the wound dressing may comprise freeze-dried bacteria in one compartment and an activating peptide in another compartment. When applied to a wound, the two compartments are brought together to bring the bacteria into contact with the activating peptide. Alternatively, bacteria may be contained in the gel-like structure on the adhesive side of the water resistant plaster or on the side of the dressing in contact with the exudate. In use, the activated peptide is applied manually to the bacteria and the plaster or dressing is applied to the wound site.

The live bacteria may also be contained in hydrocolloids, such as natural gelatin. The bacteria can be incorporated into hydrocolloid films, such as gelatin films, by cross-linking, plasticizing and drying them, and keeping the bacteria active during storage until hydration. Live bacteria may also be encapsulated in the crosslinked electrospun hydrogel fibers. In this form, freeze drying of the bacteria is not required.

For wounds in the gastrointestinal tract, a tablet is designed comprising at least two separate compartments, wherein one compartment comprises freeze-dried bacteria and the other compartment comprises a liquid and an activating peptide. The tablets are compressed prior to ingestion to break the inner membrane separating the two compartments and mix the contents together. For wounds in the oral cavity (e.g. on the gums), the bacteria according to the invention can be applied as a highly viscous paste.

In particular, formulations for topical application to the skin may include ointments, creams, gels, and pastes, applied in a pharmaceutically acceptable carrier. Topical formulations may be prepared using oily or water-soluble ointment bases as are well known to those skilled in the art. For example, these formulations may include vegetable oils, animal fats, and more preferably semi-solid hydrocarbons obtained from petroleum. The specific ingredients employed may include white ointment, yellow ointment, acetyl ester wax, oleic acid, olive oil, paraffin, vaseline, white vaseline, spermaceti, starch glyceride, white wax, yellow wax, lanolin, anhydrous lanolin and glyceryl monostearate. Various water-soluble ointment bases may also be used, including, for example, glycol ethers and derivatives, polyethylene glycol, polyoxyethylene 40 stearate, and polysorbate.

The bacterial strains may be in and/or on a substrate, solid support and/or wound dressing to provide delivery of the active substance to the wound. The solid support or matrix may be a medical device or a part thereof. As used herein, the terms "matrix" or "solid support" and "wound dressing" refer broadly to any matrix that is prepared for a wound and applied to the wound for the purpose of protecting, absorbing, draining the wound, and the like.

In one embodiment, the invention provides a wound healing material or dressing attached to or comprising a transformed bacterial strain, i.e. the dressing is a carrier for application of the transformed bacteria of the invention. Alternatively, the carrier may be a plaster or bandage. The present invention may include any of a number of types of substrates and/or backings that are commercially available, and the choice of wound healing material will depend on the nature of the wound to be treated. The most commonly used wound dressings are briefly described below.

Transparent film dressings are made of, for example, polyurethane, polyamide or gelatin. These synthetic membranes are permeable to water vapour oxygen and other gases, but impermeable to water and bacteria, have low water absorption, are suitable for low exuding wounds, gels (hydrocolloid particles in combination with polyurethane foam), hydrocolloids (cross-linked polymers containing approximately at least 60% water, have a high absorption capacity and remove toxic components from the wound bed and maintain the moisture level and temperature at the wound site), foams (hydrophilic or hydrophobic, e.g. polymeric foam dressings made by modifying polyurethane foam, have good absorption and are permeable to water vapour), calcium alginate (non-woven fibrous composites of calcium alginate from alginate gel groups, alginate having a very high absorption capacity. They also promote autolytic debridement, as ion exchange between alginate and exudate converts insoluble calcium alginate into soluble sodium alginate, providing a moist, intact surface for the wound bed ideal for wound healing) and cellophane (cellulose and plasticizer). The shape and size of the wound may be determined from the measurements provided for the wound and the wound dressing may be customized to the exact site. Since wound sites may differ in mechanical strength, thickness, sensitivity, etc., the matrix may be molded to specifically address the mechanical and/or other needs of the site. For example, for highly innervated locations, such as fingertips, the thickness of the substrate may be minimized. Other wound sites, such as fingers, ankles, knees, elbows, etc., may be exposed to higher mechanical stresses and require multiple layers of substrates.

In another aspect, the invention provides a method for healing a wound in a human or animal subject, comprising administering to a human or animal subject in need thereof a bacterial strain according to the invention. The bacterial strain is preferably comprised in a pharmaceutical composition or wound dressing as described above. In such methods, the human or animal subject is preferably in need of wound healing due to an underlying medical condition that results in impaired wound healing, such as reduced peripheral blood perfusion (peripheral arterial disease), hyperglycemia, or neuropathy.

The results obtained and contained in the following examples demonstrate the advantages of the present invention. In particular, improved wound healing (e.g., in terms of better or faster wound closure) may be obtained by using the transformed protein-expressing bacteria of the invention compared to, for example, direct protein preparations (i.e., protein only, no bacteria) or bacteria alone (bacteria that have not been modified to express proteins, e.g., no recombinant plasmids). Furthermore, an improved effect when applying bacteria to wounds can be seen compared to applying a supernatant obtained from a transformed bacterial culture. Therefore, it is advantageous to deliver proteins to wounds by a host of lactic acid bacteria that express the proteins. It is believed that synergistic effects may be possible. In other words, there may be a synergistic effect between the effect of the bacteria on wound healing and the effect of the protein on wound healing. Thus, in some embodiments, there may be a greater cumulative effect on wound healing than transformed bacteria, relative to the effect of the corresponding untransformed bacteria (i.e. without plasmid) and the effect of the protein when provided as a protein (i.e. not expressed from the in situ bacteria).

In this regard, it is believed that the pH lowering effect of the bacteria, for example, at the wound site, may help to increase or enhance or promote the activity of the protein. While not wishing to be bound by theory, it is also believed that administration of the transformed bacteria according to the invention may have a beneficial effect in enhancing macrophage activity at the wound site. For example, the number of macrophages may be increased.

The effect of the transformed bacteria on wound healing may or may not be immediate, and may take some time to see (before improved wound healing can be observed, e.g., 1, 2, 3, 4, 5, or 6 or more hours or longer, e.g., 8, 10, 12, 15, 18, 20, or 24 hours or longer, or 1, 2, 3, 4, 5, or 6 or more days, e.g., 8, 10, 12, 15, 18, 20, or 24 or more days). For chronic wounds in elderly people it may take longer to see the difference between the treated and control groups, for example it may take about 12 weeks.

A particular and important use of the invention is in the treatment of chronic wounds, in particular ulcers, and in particular in the treatment of diabetic foot ulcers.

The prevalence rate of chronic foot ulcers in diabetic patients is about 18%. In 2013, the European population reaches 74250 ten thousand, and the number of patients with diabetes patients reaches 3270 ten thousand, wherein 290-580 ten thousand patients have chronic foot ulcers. The average duration of this type of ulcer is in the range of several months, with less than 25% of wounds healing in 12 weeks when given standard of care. The final stage in this case is amputation of the affected limb. The current treatment of persons with chronic foot ulcers is divided into primary care, home care, nursing home, relatives, self-management and visits to a hospital wound clinic. Current treatments rely on the use of surgical debridement to unload, remove dead and dead tissue, repeated wound dressing changes, systemic antibiotics, and in special cases, treatment with live larvae or collagenase, and hyperbaric oxygen therapy in several places in sweden. If the underlying cause also includes a large arterial blockage, it can be surgically corrected by bypass vein grafting. Wounds are now treated every two to three days. Treatment with the proposed modified lactic acid bacteria in any of the proposed forms or formulations does not disrupt this conventional approach. Thus, improving the healing of these wounds by the treatment of the present invention would therefore have considerable economic benefit as well as personal benefit to the patient.

The bacteria are active and produce the encoded protein in vivo and deliver it to the wound surface for a period of time (e.g., about 1 hour). They may become inactive and die. Slow or dead lactic acid bacteria can be left without risk in the wound/dressing environment until the dressing is normally replaced.

The biotherapeutic agent according to the invention will have a significantly lower production cost compared to protein drug compounds. This is because the biotherapeutic agent produces the active protein itself directly in the wound.

Open wounds such as diabetic foot ulcers and loss of foot function cause considerable discomfort and even disability to the patient and may have a significant negative impact on the quality of life, including significant risk or infection and therefore long term use of antibiotics, and eventual amputation. Thus, improved wound healing would be of great personal benefit to the patient, and also of benefit in reducing antibiotic use (and hence the spread of antibiotic resistance). It is believed that treating such chronic wounds according to the present invention can increase the endogenous alarm signal in the wound and initiate the healing process in a poorly arrested or chronic wound and accelerate the healing time.

In addition, the present invention may have the advantage of flexibility and ease of use for medical personnel.

Drawings

Representative methods and preferred embodiments according to the present invention will be further described with reference to the following non-limiting examples and the accompanying drawings, in which:

FIG. 1 shows a schematic view of aGrowth of lactococcus lactis mlrCK1 over time (A) and pH (B), lactococcus lactis mlrCK1 from a re-inoculation of overnight cultures and addition of 10 or 50ng/ml promoter activating peptide SppIP at starting OD 0.285 and 0.51.

FIG. 2Lactobacillus reuteri R2LC from revaccination of overnight cultures starting at OD 0.5 by expression of plb 112_ Luc measured in vitro by bioimaging over time in lactobacillus reuteri R2 LC. A baseline image at time 0 is acquired. Immediately thereafter, the promoter activating peptide SppIP (50ng/ml) and the substrate D-luciferin (150. mu.g/ml) were added. The plate was imaged at 5 minutes and then every 30 minutes for 1400 minutes. The medium used in all samples was MRS. The peptide is the promoter activating peptide SppIP. Each group consisted of eight samples.

FIG. 3Expression of pllab 112_ Luc in lactobacillus reuteri R2LC, reseeded from overnight culture to the starting OD 0.5 and applied to 1 day old cutaneous full-thickness wounds. In vivo expression was measured by non-invasive bioimaging over time. Baseline images at time 0 were obtained on 5 anesthetized mice with 1 day old full-thickness skin wounds. Then 25. mu.l of Lactobacillus reuteri R2LC _ pLAB112_ Luc activated with the promoter activating peptide SppIP (50ng/ml) and the substrate D-fluorescein (150. mu.g/ml) were added in between the wounds, and the mice were imaged at 5 minutes and then every 15 minutes for 270 minutes.

FIG. 4Time to wound healing in healthy mice. Time to 50% (a), 75% (B) or all (100%) (C) healing of the wound surface, all groups n-5. A. B, C, one-way analysis of variance, Bonferroni compares all columns.

FIG. 5Wound size (a) and wound exposure (B) over time in healthy mice. Wound size was measured daily from images containing a scale, all groups n-5. A, two-way ANOVA, Bonferroni compares all columns, analysis d0-d 5. Due to time and processing. R2LC _ plb 112_ lrck1.4 reduced the size of the wound compared to the control at d1 and d 2. B, one-way analysis of variance, Bonferroni compares all columns, analyzing all days. For the entire healing process, R2LC _ plb 112_ lrck1.4 reduced wound exposure.

FIG. 6Ischemia induction by wound-induced anterior femoral artery ligation, n ═ 4 in all groups. The skin blood flow was measured over time in the ischemic limb (a) and the contralateral corresponding unaffected limb (B) of anesthetized mice using laser speckle contrast analysis. Data are expressed in perfusion units (PFU). A and B, two-way ANOVA, Bonferroni compares all columns, analysis d0-d 7. No change due to time or processing was observed.

FIG. 7Wound healing time in ischemic mice at wound induction. Time to 50% (a), 75% (B) or all (100%) (C) healing of the wound surface, all groups n ═ 4. A, B, C, one-way anova, Bonferroni compares all columns.

FIG. 8Wound size and wound exposure over time of ischemic mice at wound induction time and site. Wound size was measured daily from images containing scale bars, all groups n-4. A, two-way ANOVA, Bonferroni compares all columns, analysis d0-d 7. Due to time and processing. The size of the wound becomes smaller compared to the control group at d1 and d2 by R2LC _ pllab 112_ lrck1.4. B, one-way analysis of variance, Bonferroni compares all columns, analyzing all days. For the entire healing process, R2LC _ plb 112_ lrck1.4 reduced wound exposure.

FIG. 9Body weight (a) and blood glucose (B) after induction of diabetes with a single injection of alloxan monohydrate. Diabetes control group, n-4, diabetes R2LC _ plb 112_ Luc, n-5, diabetes R2LC _ plb _ lrck1.4, n-4. A and B, two-factor ANOVA, Bonferroni comparisonAll columns, analyzed d0-d 6. No change due to time or processing was observed.

FIG. 10 shows a schematic view of aWound healing time in wound-induced diabetic mice. Time to 50% (a), 75% (B) or full (100%) (C) healing of the wound surface, diabetic control group, n-4, diabetes R2LC _ plb 112_ Luc, n-5, diabetes R2LC _ plb _ lrck1.4, n-4. A, B, C, one-way anova, Bonferroni compares all columns.

FIG. 11Wound-induced wound size and wound exposure over time in diabetic mice. Wound size was measured daily from images containing scale bar, diabetic control, n-4, diabetes R2LC _ plb 112_ Luc, n-5, diabetes R2LC _ plb _ lrck1.4, n-4. A, two-way ANOVA, Bonferroni compares all columns, analysis d0-d 6. Changes due to time. B, one-way analysis of variance, Bonferroni compares all columns, analyzing all days. There was no difference (p ═ 0.08).

FIG. 12And pSIP411 plasmid.

FIG. 13Plasmid expression (40 μ g DNA) in the dermis at the wound margin was quantified by detecting luminescence signals over 11 days (n ═ 10) by non-invasive bioimaging (IVIS Spectrum).

FIG. 14Time to wound healing in healthy mice. Time to 50% (a), 75% (B) or all (100%) (C) healing of the wound surface, (n-8 pCTR, n-9 pCXCL 12). A. B, C, student unpaired two-tailed t-test.

FIG. 15 shows a schematic view of aWound size (a) and wound exposure (B) over time in healthy mice. Wound size was measured daily from images containing a scale (n-8 pCTR, n-9 pCXCL 12). (A) Two-way analysis of variance, Bonferroni compares all columns, analysis d0-d 7. Changes due to time. (B) Student two-tailed unpaired t-test. The overall healing process pCXCL12 reduced the tendency of the wound to be exposed (p ═ 0.08).

FIG. 16Measurement of the bacterial concentration of Lactobacillus reuteri R2LC expressed in Optical Density (OD) and colony forming units/ml (CFU/ml).

FIG. 17Wound size (a) and wound exposure (B) of healthy mice treated with different concentrations of lactobacillus reuteri R2LC _ pllab 112_ lrck1.4, extrapolated over time. Wound size was measured daily from the images containing the scale. A, two-way ANOVA, Bonferroni compares all columns, analysis d0-d 2. Due to time and processing. (A) Two-way ANOVA Bonferroni compares all columns, (B) one-way ANOVA Bonferroni compares all columns (p)<0.05). Treatment with lactobacillus reuteri R2LC __ pllab 112_ lrck1.4 resulted in reduced wound exposure at OD 0.2, 0.5, 1.0 and 1.25 compared to wounds that did not receive treatment. (control, n-15; OD 0.2, n-4; 0.5, n-10, OD 1.0, n-4; OD1.25, n-5).

FIG. 18Wound size (a) and wound exposure (B) were extrapolated over time at one time point each day (for two days) in healthy mice treated with murine CXCL121 α at different concentrations. Wound size was measured daily from images containing scale. A, two-way ANOVA, Bonferroni compares all columns, analysis d0-d 2. Changes due to time. B, the first two days of wound exposure. (control group, n-15; 0.2 μ g CXCL121 α, n-4; 0.6 μ g CXCL121 α, n-5, 1.0 μ g CXCL121 α, n-4).

FIG. 19Wound size (a) and wound exposure (B) over time in healthy mice treated with 0.2 μ g of recombinant protein once every 10 minutes every day for 1 hour. Wound size was measured daily from images containing a scale. A, two-way analysis, Bonferroni compares all columns, analysis d0-d 2. Changes due to time. B, the first two days of wound exposure. (no treatment, n-15; CXCL121 α, n-6; CXCL17, n-9, Ym1, n-9).

FIG. 20Re-epithelialization measured in a human skin epidermal biopsy wound. Panel a shows the pH measured in culture medium after 24 hours of culture of round skin with epidermal wounds without or with LB _ Luc or LB _ LrCK1 treatment. Panel B shows the length of the new epidermal growth from the wound margin that fits over the exposed dermis after 14 days of culture. Difference, one-factor square differenceAnalysis, Bonferroni compares selected columns (p)<0.05)。

FIG. 21In vitro expression of pllab 112_ Luc in lactobacillus reuteri R2LC immediately after resuscitation from the freeze-dried state measured in vitro by bioimaging over time. A baseline image at time 0 is acquired. The promoter activating peptide SppIP (50ng/ml) and the substrate D-luciferin (150. mu.g/ml) were then added immediately. The plate was imaged at 5 minutes and then every 5-15 minutes for 930 minutes. The medium used in all samples was MRS. The peptide is the promoter activating peptide SppIP. Each set consisted of four samples.

FIG. 22In vivo expression of pllab 112_ Luc in lactobacillus reuteri R2LC immediately after resuscitation from a freeze-dried state and application to a 1 day old full-thickness skin wound as measured in vivo by bioimaging over time. Baseline images at time 0 were obtained on 3 anesthetized mice with two separate 1 day old full-thickness wounds in the skin. Then 25. mu.l of Lactobacillus reuteri R2LC _ pLAB112_ Luc activated with the promoter activating peptide SppIP (50ng/ml) and the substrate D-fluorescein (150. mu.g/ml) were added in between the wounds and the mice were imaged at 5 minutes and then every 15 minutes for 270 minutes.

FIG. 23 shows a schematic view of a display panelWound size (a) and wound exposure (B) over time in healthy mice treated with freeze-dried, resuscitated and induced lactobacillus reuteri R2LC _ pllab 112_ lrck1.4. Wound size was measured daily from images containing scale. (A) Two-way analysis of variance, Bonferroni compares all columns, analysis d0-d 2. Due to time and processing. (B) One-way ANOVA, Bonferroni compares all columns (p)<0.05). After treatment with lactobacillus reuteri R2LC _ plb 112_ lrck1.4, a reduction in wound size was observed compared to lactobacillus reuteri R2LC _ plb 112_ Luc when the bacteria were freeze-dried and directly resuscitated, induced and applied to the wound, (R2LC _ plb 112_ Luc, n ═ 4, R2LC _ plb 112_ lrck1.4, n ═ 5).

FIG. 24Wound size (a) and wound exposure (B) over time in healthy mice. Wound size was measured daily from images containing a scale. The change isWith time and treatment, and compared to suspensions at pH 7.35(p ═ 0.07), CXCL121 α has a tendency to decrease wound size in pH 6.35 (pH 7.35; n ═ 8, pH 6.35; n ═ 5, pH 5.35; n ═ 4). One-way anova, Bonferroni compares all columns.

FIG. 25Wound size (a) and wound exposure (B) over time in healthy mice. Wound size was measured daily from images containing a scale. The observed changes were only due to changes in time, with no difference between the two different bacterial suspensions (R2LC _ plb 112_ Luc; n ═ 4, R2LC _ plb 112_ LrCK 1; n ═ 5). Student two-tailed unpaired t-test.

FIG. 26Measurement of CXCL121 α levels in sections of dermis (a), epidermis (B) and hair follicle (C) in skin immediately adjacent to the wound two days after wound induction, wherein the wound was treated with lactobacillus reuteri R2LC _ pllab 112_ LrCK1 at OD 0.5, 1.0 and OD 1.25. One-way anova, Bonferroni compares all columns.

FIG. 27F4/80 in dermis (A) and epidermis (B) of the skin immediately adjacent to the wound 2 days after wound induction in control wounds and wounds treated with Lactobacillus reuteri R2LC _ pLAB112_ LrCK1 at OD 0.5, 1.0 and OD1.25⁺Measurement of macrophage cell density (control, n-15; 0.5, n-10, OD 1.0, n-4; OD1.25, n-5). One-way anova, Bonferroni compares all columns.

Figure 28, wound healing time in healthy mice. Wounds were treated with either pllab 112 transformed lactococcus lactis (L.L _ pllab 112_ LrCK1) or control lactococcus lactis. Time to 50% (a), 75% (B) or all (100%) (C) healing of the wound surface, two groups were 5. Student two-tailed unpaired t-test.

FIG. 29Wound size (a) and wound exposure (B) over time in healthy mice. Wound size was measured daily from images containing a scale bar, with n-5 in both groups. Due to variations in time and treatment, and L.L _ plb 112_ LrCK1 reduced the wound size at d1 to d4 compared to control lactococcus lactis. Student two-tailed unpaired t-test.

FIG. 30Time to wound healing in healthy mice treated with recombinant chemokine for 1 hour. Time to 50% (a), 75% (B) or all (100%) (C) healing of the wound surface, (control; n-11, mCXCL121 α; n-6, mCXCL 17; n-8, mYm 1; n-9). One-way anova, Bonferroni compares all columns.

FIG. 31Wound size (a) and wound exposure (B) over time in healthy mice treated with recombinant chemokine for 1 hour. Wound size was measured daily from images containing a scale (control; n-11, mCXCL121 α; n-6, mCXCL 17; n-8, mYm 1; n-9). Due to variations in time and processing. CXCL121 α, CXCL17 and Ym1 reduced the wound size compared to controls. One-way anova, Bonferroni compares all columns.

FIG. 32Wound closure during the first 24 hours of healthy mice without or with different treatments. (no treatment, n 15; 0.2 μ g CXCL121 α, n 4; 0.6 μ g CXCL121 α, n 5; 1.0 μ g CXCL121 α, n 4; 0.2 μ g CXCL121 α 1 h, n 6; 0.2 μ g CXCL 171 h, n 9, 0.2 μ g Ym 11 h, n 9; R2LC _ plga 112_ lucd 0.5, n 4; R2LC _ plga 112_ lrck 1.4.2, n 4; R2 5631 _ plga 112_ lrck1.4 OD 0.5; n 10; R2LC _ plga 112_ lrck1.4 OD 1.0, n 4; R2LC _ plga 112_ lrck1.4 OD 0.5; n 19 _ plga 2_ l 3, R2 _ ptr 2_ l 2R 4R 2R 4R 2R 4R 2R 1.4R 2R 4R 2R 1.4R 2R 4R 1.4R 2R 4R 8R 2R 4R 2R 1.4R 2R 8R 2R 4R 8R 2R 8R 4R 2R 8R 2R 1.4R 2R 8R 2R 4R 2R 1.4R 2R 8R 2R 8R 2R 1.4R 2R 1.4R 4R 8R 2R 8R 4R 2R 1.4R 8R 2R 8R 2R 1.4R 2R 1.8R 2R 8R 2R 1.8R 4R 1.8R 2R 4R 1.4R 1 h R1.8R 2R 8R 2R 4R 2R 8R 2R 8R 2R 8R 1.8R 8R 2R 8R 2R 1 h R2R 8R 4R 2. No statistical analysis was performed on this data set.

FIG. 33Evaluating DSS-induced daily disease activity (a) and total disease burden on days 1-7 (B). Treatment with lactobacillus reuteri plb 112_ Luc and plb 112_ lrck1.4(DSS + vector; n-5, DSS + R2LC _ plb 112_ Luc; n-6, DSS + R2LC _ plb 112_ lrck1.4; n-7) resulted in similar improvements in DSS-induced colitis disease activity as the vehicle-treated control group, single factor analysis of variance, Bonferroni compared all columns.

FIG. 34Evaluation of DSS-induced daily disease Activity (A) and Total days 1-8Disease burden (B). Disease activity was assessed by measuring relevant clinical symptoms as described previously (reference 16). The arrow indicates the start of the process. DSS-induced colitis disease activity was improved by treatment with lactobacillus reuteri plb 112_ lrck1.4 compared to treatment with plb 112_ Luc. (DSS + R2LC _ plb 112_ Luc; n ═ 6, DSS + R2LC _ plb 112_ lrck1.4; n ═ 6), two-tailed unpaired t-test of students.

FIG. 35 is a schematic view of aRepresentative images of induced full-thickness wounds (5mm diameter) of skin in healthy mice at time 0 and 24 hours after treatment with R2LC Luc or R2LC LrCK1 without treatment. Images containing the scale were taken in anesthetized mice.

Detailed Description

Materials and methods

Gene construct design and production

The plasmid backbone pLAB112 (equivalent to pSIP 411; references 11 and 15; Table I) is provided by professor Lars Axelsson (Norwegian food research institute). Lactococcus lactis MG1363 bacteria were transformed with pLAB112 and amplified for 24 hours. The plasmid was then purified and the DNA product verified on a gel.

Table I: the main features of pSIP411/pLAB112

Feature(s)	Position (SEQ ID NO:20)
		Replication determinants (replication sub-regions)	260-2010
ermB (erythromycin resistance marker)	2342-2840
		PsppIP (inducible promoter)	3139-3290
sppK (histidine protein kinase)	3305-4647
		sppR (response regulatory factor)	4653-5396
gusA (beta-glucuronidase)	5853-7658
		PorfX (inducible promoter)	5689-5835
Transcription terminator	129-155；5428-5460；5602-5624
		Multiple cloning site	1-35；5851-5856；7662-7673

The sequence of murine CXCL12-1 alpha was optimized for translation in Lactobacillus reuteri using DNA 2.0(Menlo Park, CA, USA) by Stefan Roos, university of agricultural Sciences (SLU). The optimized sequence (SEQ ID NO: 1) was synthesized from DNA 2.0 in plasmid vector pJ 204. Sequences of human CXCL12-1 α, murine CXCL17, human CXCL17, murine Ym1 and human Ym1 were optimized for translation in lactobacillus reuteri using GenScript (Piscataway, NJ, USA) by Stefan Roos, university of sweden agricultural Science (SLU). The optimized sequence is shown as SEQ ID NO: 4 (human CXCL12-1 α); SEQ ID NO: 7 (murine CXCL 17); SEQ ID NO: 10 (human CXCL 17); SEQ ID NO: 13 (murine Ym 1); and SEQ ID NO: 16 (human Ym 1).

Primers were designed to detect the insert (hCXCL12opt) in pllab 112, 171 bp:

5’GCAGCCTTAACAGTCGGCACCT3’(SEQ ID NO：22)；

5’ACGTGCAACAATCTGCAAAGCAC3’(SEQ ID NO：23)。

the ends of the insert were also optimized for continued molecular processing to make the insert fit into the new vector pllab 112. The optimized mCXCL12opt sequence was delivered in plasmid PJ 204. Coli PK401 was transformed with pJ 204. The plasmids (pLAB112 and pJ204) were cut with the restriction enzymes XhoI and NcoI in NEB2 buffer. The fragment mCXCL12opt was then purified on gel. The mCXCL12opt insert was then ligated into the pllab 112 vector using T4 DNA ligase to give the construct mLrCK1. The insert construct in the pllab 112 vector was verified by PCR. The construct was then verified by sequence analysis (Macrogen). Finally, lactobacillus reuteri strains R2LC and DSM20016 were transformed with mLrCK1, two R2LC clones (4 and 7) positive for the construct were collected and the plasmids mLrCK1 (now mLrCK1.4 and mLrCK1.7) from these colonies were again verified by sequence analysis (Macrogen).

Plasmids hLrCK1, mLrCK2, hLrCK2, mlrcp 1 and hlrcp 2 (see table II below) were produced in a similar manner following the same protocol and procedure.

Table II: brief description of the plasmids

Plasmids	Description of the invention
		pLAB112	Same as pSIP411 (ref 15, SEQ ID NO:20)
mLrCK1	pLAB112 with optimized mXCL 12-1 alpha insert
		mLrCK1.4	mlrCK1 from transformed Lactobacillus reuteri R2LC clone 4
mLrCK1.7	mlrCK1 from transformed Lactobacillus reuteri R2LC clone 7
		hLrCK1	pLAB112 with optimized hXCL 12-1 alpha insert
mLrCK2	pLAB112 with optimized mXCL 17 insert
		hLrCK2	pLAB112 with optimized hXCL 17 insert
hLrMP1	pLAB112 with an optimized human Ym1 insert
		mLrMP2	pLAB112 with optimized mouse Ym1 insert
pLAB112_Luc	pLAB112 with luciferase insert

In vitro analysis of plasmid expression

L.reuteri R2LC pLAB112_ Luc was cultured overnight, plated again on 96-well plates (200. mu.l/well) when cultured to OD 0.5 or immediately resuspended directly from the freeze-dried preparation. The luminescence intensity was determined by non-invasive bioimaging (IVIS Spectrum, Perkin Elmer). A baseline image at time 0 is acquired. The activated peptide SppIP (50ng/ml) and D-fluorescein (150. mu.g/ml) were then added immediately. The plate was imaged at 5 minutes and then every 30 minutes for 1400 minutes. Data were quantified using the Living Image 3.1 software (Perkin Elmer) and imaging parameters were retained for comparative analysis. The luminescence intensity is considered to be proportional to plasmid expression.

Animal(s) production

The experiments were approved by the ethical committee on laboratory animals in the area of uppsala. CX3CR1 with mouse C57B1/6(Taconic) and C57B1/6 background^+/GFP(originally from Jackson laboratories). The animals had free access to moisture and food during the experiment.

Wound induction

Mice were anesthetized (1-3% isoflurane, 200ml/min), shaved and then depilatedApplication was performed for 1 minute (washed with water) to remove hair from the hind limb. Whole-layer (epidermal, dermal and subcutaneous) wounds were induced using a sterile needle biopsy needle (5mm diameter). Topical analgesics (Embla cream) were applied daily for the first 5 days.

Topical wound treatment

Wounds were treated daily with 25 μ l saline, lactobacillus reuteri R2LC pllab 112_ Luc or R2LC pllab 112_ LrCK1. The bacteria were cultured overnight, re-inoculated and cultured to OD 0.5, pre-activated for 5 minutes before administration of the activating peptide SppIP (50ng/ml) and added locally to the middle of the wound surface. For the dose experiments, the wounds were treated daily with lactobacillus reuteri R2LC plb 112_ LrCK1 in the middle, inoculated and grown again with 25 μ Ι saline or from overnight culture to OD 0.5, pre-activated for 5 minutes before administration of the activating peptide SppIP (50ng/ml), and added locally to the wound surface at a concentration of OD 0.2, 0.5, 1.0 or 1.25. For comparative experiments with various proteins, wounds were treated daily with 10 μ l saline or murine CXCL12, CXCL17 or Ym1 (total 200ng protein in 60 μ l saline given 1 hour at 10 minute intervals). For dose escalation studies of CXCL12, 200ng, 600ng, or 1 μ g of CXCL12 in 10 μ l saline was added to the wound once daily at the same time point.

In vivo analysis of plasmid expression

L.reuteri R2LC pLAB112_ Luc was cultured overnight, re-inoculated and cultured to OD 0.5. The luminescence intensity was determined by non-invasive bioimaging (IVIS Spectrum, Perkin Elmer). A baseline image at time 0 is acquired. Then 25. mu.l of Lactobacillus reuteri R2LC pLAB112_ Luc was added in the middle of the wound. The bacteria were pre-activated for 5 minutes before administration of the activating peptides SppIP (50ng/ml) and D-fluorescein (150. mu.g/ml). Mice were imaged every 15 minutes for 270 minutes. Data were quantified using the Living Image 3.1 software (Perkin Elmer) and imaging parameters were retained for comparative analysis. The luminescence intensity is considered to be proportional to plasmid expression.

Wound size and appearance monitoring

Anesthetized mice (1-3% isoflurane, 200ml/min) were monitored daily for wound size and appearance by taking conventional photographs. A scale bar was included in the captured Image and the wound size was analyzed using Image J (NIH's free software). When size is changed<0.5mm²At the time, the wound is considered to be healed.

Skin blood flow monitoring

Blood flow in the whole hind limb with a healing wound was measured in anesthetized (1-3% isoflurane, 200ml/min) mice using non-invasive laser speckle contrast analysis and the data PIMSoft 3(Perimed) was analyzed. The limb (reading frame 1.4 x 1.4cm) was imaged at 10 images/second over two minutes, averaging 20 times. Data are expressed in perfusion units (PFU).

Reduced perfusion

Mice were anesthetized (1-3% isoflurane, 200ml/min) and hind limb ischemia was induced by ligation and excision of the femoral artery above the superficial abdominal artery branch.

Induction of hyperglycemia

A single dose of alloxan monohydrate (8mg/ml, 1. mu.l/g body weight), i.e. dissolved in sterile saline, was injected into the tail vein. Blood glucose and body weight were monitored daily throughout the experiment. Hyperglycemia is defined as blood glucose >16.7 mmol/l.

Statistical analysis

Data are presented as mean ± SEM. Post hoc tests of all columns were compared with Bonferroni using two-way anova to analyze the change in healing process over time. Post hoc tests of all columns were compared with Bonferroni using one-way anova to analyze the healing process at one time point for the group with n >2, and student unpaired two-tailed t-test was used to analyze the healing process at one time point when n-2. p <0.05 is considered statistically significant.

Example 1: growth of bacteria transformed with plasmid LrCK1

Lactococcus lactis containing mlrCK1 was cultured overnight, inoculated again and grown to OD 0.3 or 0.5, showing NO growth failure when 10 or 50ng/ml of the activating peptide SppIP (SEQ ID NO: 19) was added. During these growth experiments, the pH was measured and decreased the most during the growth phase and then stabilized around pH6.7 when grown as an intermediate medium (Mes-medium) (fig. 1). (skin pH 5.5, wound pH 7.15-8.9, where alkaline pH is associated with lower healing rates (ref. 14))

Example 2: expression of plasmid pLAB112_ Luc

In vitro expression of plasmid plb 112_ Luc in lactobacillus reuteri R2LC re-inoculated and grown for 2 hours from overnight culture was maintained for up to more than 600 minutes (10 hours). The plasmid not activated by the activation peptide SppIP did not leak/express (fig. 2).

When lactobacillus reuteri R2LC (with plb 112_ Luc) was placed in a 1-day-old full-thickness wound in anesthetized mice, re-inoculated from an overnight culture and grown for 2 hours, the bacteria were restricted to the wound site only, and plasmid expression was high at the first hour, but signals were detected over 4 hours (fig. 3).

Example 3: improved wound healing in healthy mice

The wound was monitored daily during the healing process. Healthy mice with a single daily application of lactobacillus reuteri R2LC _ pllab 112_ mlrck1.4 had reduced time to 75% closure and 100% closure to the wound surface compared to control mice with no wound applied anything and mice with daily application of the control lactobacillus reuteri R2LC (pLAB112_ Luc) (fig. 4). The first few days after wound induction, the effect of lactobacillus reuteri R2LC _ pllab 112_ mlrck1.4 on wound healing was most pronounced. The size of the wound was further reduced by daily administration (one and two days after wound induction) of lactobacillus reuteri R2LC _ pllab 112_ mlrck1.4 when compared to control mice without any substance administered to the wound. The total wound exposure, measured as the area under the curve, was also reduced in this group compared to control mice with no wound applied with any substance (fig. 5). Figure 35 shows representative images of whole skin wounds induced in healthy mice at time 0 and 24 hours post treatment with R2LC Luc or R2LC LrCK1 without treatment.

Example 4: improved wound healing in healthy mice with impaired tissue perfusion

By ligating the femoral artery of the limb where the wound was located, there was a 50% reduction in skin perfusion on the day of wound induction (figure 6 and table III). In ischemic mice, a single daily administration of lactobacillus reuteri R2LC _ pllab 112_ mlrck1.4 resulted in a reduction in time to 50% and 75% closure of the wound surface compared to control mice with no substance applied to the wound and mice with daily administration of the control lactobacillus reuteri R2LC (pllab 112_ Luc) (fig. 7). In addition, in mice with reduced skin perfusion, the effect of lactobacillus reuteri R2LC _ pllab 112_ mlrck1.4 on wound healing was most pronounced the first few days after wound induction. The size of the wound was reduced by daily administration of lactobacillus reuteri R2LC _ pllab 112_ mlrck1.4 one and two days after wound induction compared to control mice without any substance applied to the wound. The total wound exposure was also reduced in this group compared to control mice with no wound applied with any substance (fig. 8).

Table III: basal skin perfusion of anesthetized mice was measured by laser speckle contrast analysis. Data are expressed as mean ± SEM in perfusion units (PFU), n ═ 4.

	Healthy and healthy	Of ischemia	Reduction amount (%)
				Control	62.5±4.3	34.0±1.8	46
R2LC_pLAB112_Luc	57.3±2.7	31.3±1.1	46
				R2LC_pLAB112_LrCK1.4	65.0±7.2	30.8±0.4	52

Example 5: improved wound healing in hyperglycemic mice

Mice were made diabetic with alloxan, after which they remained hyperglycemic (>16.7mmol/l) during wound healing and did not lose weight (fig. 9). The time to 75% wound surface closure was reduced in diabetic mice with a single daily application of lactobacillus reuteri R2LC _ pllab 112_ mlrck1.4 compared to control mice with no wound application of anything and mice with a single daily application of the control lactobacillus reuteri R2LC (pllab 112_ Luc) (fig. 10). There was a tendency to reduce wound exposure (p 0.08) in diabetic mice administered lactobacillus reuteri R2LC _ plb 112_ mlrck1.4 daily compared to control mice administered lactobacillus reuteri R2LC containing Luc daily and without wound application of anything (fig. 11).

Example 6: CXCL12 skin overexpression in the dermis of the wound margin transfected with a plasmid encoding CXCL12

Plasmids were constructed on the pVAX1 backbone with the CMV promoter (SEQ ID NO: 24) (V260-20, Invitrogen, Waltham, MA, USA) and the insert-copGFP-T2A-Luc 2-referred to as pCTR (SEQ ID NO: 25) -or-CXCL 12-P2A-copGFP-T2A-Luc 2-referred to as pCXCL12(SEQ ID NO: 26) -was introduced as previously described (reference 18). The secretory sequence of CXCL12 was replaced with the murine IgG secretory sequence. Thus, the pCTR plasmid encodes GFP (green fluorescent protein) and luciferase, but no chemokines. The plasmid (40. mu.g in 100. mu.l total volume of saline) was injected into the dermis at four sites of the wound margin. Transgene expression was measured over time based on luciferase activity after intraperitoneal injection of D-luciferin (150mg/kg, #122796, Perkin Elmer, Waltham, MA, USA) 10 minutes before anesthesia, and image acquisition was performed using a bioimaging apparatus (IVIS Spectrum, Perkin Elmer). Data were quantified using the Living Image 3.1 software (Perkin Elmer) and imaging parameters were retained for comparative analysis. The setup of selecting the region of interest minus the contralateral reference region is also retained. The luminescence intensity is considered to be proportional to plasmid expression.

Plasmid expression from the dermis at the wound margins was measured using non-invasive bioimaging and correlated with light produced by luciferase encoded by a plasmid comparable to CXCL12 expression. Expression peaked on day 2 and then declined as the wound was closed and the dermis reconstituted (figure 13). Overexpression of CXCL12 did not result in accelerated complete wound healing compared to pCTR, but rather in a reduced time to 75% closure of the wound surface (fig. 14). Wound surface was reduced by pCXCL12 dermal expression compared to pCTR 4-6 days after wound induction and dermal transfection (figure 15). These results indicate that CXCL12 delivered to the wound using this system had no apparent effect for the first 24 hours and was less effective at later time points.

Example 7: dose effect of Lactobacillus reuteri with topical treatment with Luc and LrCK1

Lactobacillus was again inoculated from overnight cultures and grown to OD 0.5, then diluted or concentrated in MRS to OD 0.2, 0.5, 1.0 and 1.25. Diluting four different concentrations by 10 times to 10 times^-9Mu.l of each sample was plated on MRS agar containing erythromycin and incubated overnight at 37 ℃ in an anaerobic chamber with 5% carbon dioxide overnight. Colonies on the plate were counted and the concentration expressed as colony forming units per ml (CFU/ml).

For the dose experiments, the wounds were treated daily for two days with 25 μ l of saline or lactobacillus reuteri R2LC plb 112_ lcck 1.4, which lactobacillus reuteri R2LC plb 112_ lcck 1.4 was re-inoculated and cultured to OD 0.5 from an overnight culture, pre-activated for 5 minutes before administration of the activation peptide SppIP (50ng/ml) and then added locally in the middle of the wound surface at a concentration of OD 0.2, 0.5, 1.0 or 1.25. 5X 10 out of 25. mu.l OD 0.5⁷Bacteria (2X 10)⁹cfu/ml), meaning a 1000-fold dose span.

The bacterial concentration was measured by optical density and the colony forming units per ml are shown in figure 16. Minimum dose cultured and activated before application to the wound (OD 0.2 equals 2X 10)⁷Bacteria) resulted in the smallest wound size after 24 hours, all four different concentrations resulted in significantly accelerated wound closure at 24 and 48 hours post wound induction (fig. 17A), thus resulting in a reduction in the first 48 hours of wound exposure compared to wounds that received no treatment (fig. 17B). These results indicate that the initial 48 hour dose administered was the lowest dose of 10 compared to untreated wounds³Multiple (OD 1.25 equals 1X 10)¹⁰Bacteria) that produces the greatest effect and also significantly accelerates wound healing to the same extent as the dose that produces the greatest wound closure. No signs of causing inflammation or other negative side effects were observed for the wounds given the highest dose. The data show that even low doses of lactobacillus reuteri R2LC _ LrCK1 can accelerate wound healing.

Example 8: dose escalation of mCXCL121 alpha protein as a topical treatment

To study the effect of the dose of mCXCL121 a applied to the wound surface, 0.2 μ g, 0.6 μ g, or 1 μ g of mCXCL121 a (Rnd Systems) was dissolved in 10 μ l saline and delivered to the wound daily for two days. Administration is once daily.

Delivering mCXCL121 a once daily at a separate time point did not accelerate wound healing on the first two days compared to no treatment (fig. 18A, B). These data indicate that continuous delivery of CXCL121 a results in accelerated wound healing, as administration of a total of 0.2 μ g of mCXCL121 a at 10 minute intervals over one hour per day accelerates healing during the first 48 hours (fig. 18 and 19).

Example 9: re-epithelialization assay in human skin biopsies

Healthy white women who underwent conventional breast reduction at the university Hospital of Uppsala agreed to donation to obtain sterile normal human skin. The samples were overlaid with physiological DMEM supplemented with 2% calf serum (Hyclone, Hyclone Laboratories, Logan USA) and shipped to the laboratory under sterile conditions.

Subcutaneous tissue was removed and the remaining dermis and epidermis were cut using a 6mm skin biopsy punch (Integra Miltex, York, PA, USA) and sterile scissors as previously described (reference 17). At the center of each 6mm diameter circular skin, the epidermis was removed using a 3mm skin biopsy punch and sterile scissors. The samples were then individually placed in sterile 24-well plates with the epidermis facing upward. All media (DMEM) were supplemented with BSA, 2 or 10% and antibiotics (erythromycin Sigma Aldrich, Buchs, Swizerland, 10. mu.g/ml). To maintain the dermal side nutrients, i.e. the highest concentration of nutrients on the dermal side of the skin, 0.5ml of medium was added to each well and the medium was changed daily. 10 of 10. mu.l MRS were added while changing the medium⁶A single lactobacillus reuteri R2LC _ Luc or lactobacillus reuteri R2LC _ LrCK1 was placed in the middle of the epidermal wound in floating round skin. Inoculating bacteria and growing in MRS for 2-4 hr to makeIt is in the exponential phase. The samples were incubated at 37 ℃, 5% carbon dioxide and 95% humidity for 14 days.

The sample was cut in the middle, half was fixed in 4%, ph7.38 formaldehyde overnight and dehydrated through the ethanol-xylene series, and finally embedded in paraffin. A cross section (10 μm) from the central part of the sample was mounted, deparaffinized, rehydrated and stained with hematoxylin and eosin. Images were taken using a Leica Leits Dmrb with a Leica DFC 420C camera and a Plan Fluot 40 x 0.7NA objective lens. The re-epithelialization or epidermal sleeve length was measured in the images using Image J (NIH).

Lactobacillus was added to the round skin in culture, decreasing the pH of the medium when measured after 24 hours (fig. 20A). The epidermis of the wound edges induced in the round skin proliferated to cover the exposed dermis when 10% FCS was present in the culture medium, and there was almost no proliferation of the round skin in the culture after 14 days when cultured in the culture medium containing 2% FCS (fig. 20B). No macroscopic detrimental effects were detected in round skin treated with R2LC pllab 112 Luc or R2LC pllab 112_ LrCK1, and increased re-epithelialization was measured on wounds in round skin discs treated with R2LC pllab 112_ LrCK1 for 14 days (fig. 20B).

Example 10: function of bacteria after freeze drying and recovery

Different protocols and 35 different freeze-drying formulations were tested and viability was determined up to two months. In addition, a large batch of freeze-dried lactobacillus reuteri was also produced in the same set-up as for large-scale industrial production and according to good manufacturing practices. The activity of the freeze-dried samples of this batch was analyzed after storage for up to two months at a temperature range of-20 to 40 ℃. The freeze-dried bacteria were revived by adding equal volumes of water or MRS medium containing SppIP (50ng/ml) and then immediately analyzed for expression in vivo and in vitro by plating them in 96-well plates or applying them directly onto 1 day old wounds as described above.

With the most promising formulations, the activity ranges from immediately after freeze-drying to two months on storageThe measurement was stable at +4 ℃ for the sample. The activity is within the acceptable range for freeze-dried bacteria currently marketed as dietary supplements. Direct measurement of plasmid expression after resuscitation of freeze-dried lactobacillus reuteri R2LC _ plb 112_ Luc showed immediate induction of expression, which peaked and then declined after 450 minutes (fig. 21). After 24 hours (1440 minutes) there was no expression, no viable bacteria. When the freeze-dried Lactobacillus reuteri R2LC _ pLAB112_ Luc was resuscitated, it was induced with 50ng/ml (SppIP) and immediately placed on the skin wound of mice (5X 10)⁷25 μ l), expression increased directly and was high in about 1 hour (fig. 22), in a similar pattern seen when fresh growth stage bacteria were added to the solution (fig. 3).

Testing the Effect on wound healing, wherein bacteria were freeze-dried (5X 10)⁷/25 μ l) were resuscitated, induced and immediately placed on the skin wound of the mice. The wounds were monitored daily for two days and the wounds treated with lactobacillus reuteri R2LC _ pllab 112_ LrCK1 showed accelerated healing compared to the wounds treated with lactobacillus reuteri R2LC _ pllab 112_ Luc (fig. 23) using this protocol. These data show that lactobacillus reuteri R2LC _ plb 112 need not be pre-cultured to an exponential growth phase in order to produce and deliver sufficient CXCL12 to accelerate wound healing in vivo.

Example 11: pH-dependent effects of chemokine signaling

Chemokines can occur as monomers, dimers or multimers that interact with themselves or other chemokines (see reference 22). Different combinations and conformations induce different receptor signaling and therefore different cellular responses (ref. 34). This is a new and unexplored area, the combination of possibilities depending on the local tissue microenvironment. Local pH also affects local macrophage function (reference 23).

To study the pH-dependent effect of chemokine potency, 0.2 μ g CXCL121 α in 10 μ l saline at pH 7.35, 6.35 or 5.35 was applied daily to the wound for two days.

Changing the pH in the chemokine-containing buffer had an effect on the healing pattern of the treated wound, and there was a tendency for smaller wound size (p ═ 0.07) one day after wound induction when CXCL12 was suspended in saline at pH 6.35 compared to CXCL12 suspended in saline at pH 7.35 (fig. 24). These data indicate that a pH of 6.35 enhances the effect of recombinant CXCL12 applied to the wound surface in inducing accelerated wound healing.

Example 12: importance of the effectiveness of bacteria at the wound surface site for chemokine delivery

For wound treatment with fresh supernatant, lactobacillus reuteri R2LC _ plb 112_ Luc and R2LC _ plb 112_ LrCK1 were inoculated into 10ml MRS at 37 ℃, grown to OD 0.5, centrifuged (>2000rpm, 5 min), resuspended in 1ml MRS, activated (SppIP, 50ng/ml) and grown for 4 hours. The samples were then centrifuged (>2000rpm, 5 minutes) and the supernatant retained. Then 25 μ l of this supernatant was applied to the wound once daily for two days.

The importance of CXCL121 a delivery directly to wound surface bacteria by lactobacillus reuteri R2LC _ plb 112_ LrCK1 was demonstrated in a model where fresh supernatant from induced lactobacillus reuteri was added to the wound daily for two days after wound induction. There was no difference in wound size or total wound exposure (p 0.2595) treated with fresh supernatant from lactobacillus reuteri R2LC _ plb 112_ Luc or R2LC _ plb 112_ LrCK1 (fig. 25).

Example 13: lactobacillus delivered CXCL12 increases CXCL12 in periwound skin Is on the horizon of

For quantitative analysis, the skin surrounding the wound (0-100 μm from the wound) was removed on the last day of the experiment and flash frozen in liquid nitrogen and sectioned (10 μm). After fixation in ice-cold methanol (10 min) and permeabilization in 0.5% Triton-X (15 min), tissues were incubated with antibodies targeting CXCL121 α (polyclonal antibody, Abcam), washed with the macrophage cell antigen F4/80 (clone BM8, eBioscience), and incubated with matching secondary antibodies coupled to Alexa Fluor488 and Nordic Lights 557 (Invitrogen). The tissue was finally washed and mounted (fluorocount, #0100-10, Southern Biotech, Birmingham, AL, USA) before using an in-line scanning confocal microscope (Zeiss LSM 5Live, piezo-electric motor controlled WPlanApo 40 ×/1.0 with 0.5 optical zoom, Zeiss, Oberkochen, Germany). Protein levels and macrophages were quantified in the images using Image J (NIH) and IMARIS software 8.2(Bitplane, Zurich, Switzerland). The microscope settings were maintained during acquisition for comparison. CXCL121 α measurements are expressed as Mean Fluorescence Intensity (MFI).

Treatment of the wounds with different doses of lactobacillus reuteri R2LC _ plb 112_ LrCK1 once daily for two days resulted in increased skin tissue levels of CXCL121 α in the skin beside the wounds compared to the skin beside the wounds that did not receive treatment (fig. 26). This is the same in both the dermis and epidermis and in the hair follicle.

Example 14: delivered lactobacillus CXCL12 increased macrophages in the skin surrounding the wound

When applying lactobacillus reuteri R2LC _ plb 112_ LrCK1 at OD 0.2 and OD 0.5 to the wound, the wound was treated once daily with different doses of lactobacillus reuteri R2TC _ plb 112_ LrCK1 for two days compared to the dermis next to the wound not receiving treatment, resulting in F4/80 in the dermis near the wound two days after wound induction⁺The density of macrophages increased (fig. 27A). When OD1.25 of Lactobacillus reuteri R2LC _ pLAB112_ LrCK1 was applied to the wound surface, F4/80 in the epidermis beside the wound 2 days after wound induction compared to the epidermis beside the wound not receiving the treatment⁺Macrophages increased (fig. 27B).

Example 15: validation of the Effect of Using lactococcus lactis on the acceleration of wound healing

To show that local and continuous delivery of specific chemokines produced by bacteria is important for mechanisms unrelated to bacterial strains, another strain was used to produce and deliver chemokines directly to the wound surface, lactococcus lactis was transformed with pllab 112(mLrCK 1). Bacteria were applied to full-thickness wounds of healthy mice once daily according to the same protocol as treatment with lactobacillus reuteri.

There was a clear trend that mCXCL121 a delivery accelerated wound closure (fig. 28) and reduced wound size and exposure in this model (fig. 29).

Example 16: by using mCXCL12 as delivered as a recombinant protein 1 alpha, mCCCL 17 and mYm1 treatment for wound closure Moderate effect of combination over time

To demonstrate that the mode of delivery and continuous protein production of lactic acid bacteria is important for the mechanism, murine recombinant mCXCL121 α, mCXCL17, mYm1 (200 ng total in 60 μ l, all RnD systems) or saline as control (10 μ l) was delivered daily to the wound for 10 minutes each for one hour.

For mCXCL121 a, delivery of 30ng to the peritoneal cavity induced a significant increase in immune cell recruitment within 3 hours, which is delivery of 200ng to 25 μm²Is considered to be the cause of the high dose.

When chemokines are administered as recombinant proteins at a single time point, high protease activity in the wound may degrade the chemokines and thus the proteins re-produced by the bacteria are required for increased wound closure. In addition, lactic acid bacteria may also provide beneficial local environments for wound healing (fig. 1B, 4, 5, 24, 30 and 31).

Example 17: comparison of the Effect of different treatments on wound closure in healthy mice

All the different treatments performed were analyzed for wound closure in healthy mice for the first 24 hours (fig. 32). It is clear that treatment with lactobacillus reuteri R2LC _ Luc or a low single dose CXCL121 α administered to the wound at one time point can affect healing during the first 24 hours. Although CXCL121 a, CXCL17 and Ym1 delivered to the wound surface every 10 minutes over an hour had a tendency to accelerate wound closure within the first 24 hours, this effect was more pronounced when CXCL121 a was continuously delivered to the wound surface within one hour by lactobacillus reuteri R2LC _ LrCK1. CXCL12 was delivered by dermal overexpression with adverse effects on 24 hour wound closure.

Example 18: accelerated wound healing at mucosal surfaces by Lactobacillus reuteri containing pLAB112_ mLrCK1.4

To test whether the local continuous delivery of CXCL12 to the wounded surface acted via the general mechanism of skin epithelium and intestinal epithelium, two experimental protocols for DSS-induced colitis were employed. DSS (sodium dextran sulfate) is known to induce trauma at the colonic mucosal surface (reference 16).

For the first protocol, mice were treated with lactobacillus reuteri gavage (1ml OD 0.5, spun and resuspended in 0.1ml) once daily for 14 days, while DSS was given on days 7-14 in drinking water. Since this lactobacillus reuteri strain employing this protocol colonizes the colon, the objective was to assess whether the presence of lactobacillus reuteri plb 112_ mLrCK1 in the colon was beneficial compared to lactobacillus reuteri plb 112_ Luc when causing colitis.

The second regimen was aimed at treating overt colitis, with mice given DSS in 1-8 days of drinking water and receiving lactobacillus reuteri three times a day by gavage on days 5-8.

The severity of colitis was assessed based on clinical parameters including weight loss, stool consistency and blood volume and was expressed using a Disease Activity Index (DAI), a scoring method described in detail by Cooper and colleagues (reference 16).

Similar improvements in DSS-induced colitis disease activity were obtained by pretreatment with lactobacillus reuteri plb 112_ Luc and plb 112_ lrck1.4 (figure 33), indicating that the effect was due to lactobacillus reuteri only.

In contrast, when lactobacillus reuteri pllab 112_ lrck1.4 was administered to mice with colitis, the disease progression was improved, which was not observed when treated with pllab 112_ Luc, indicating the effect of the delivered chemokines.

Reference to the literature

1.Demidova-Rice TN,Hamblin MR and Herman IM.Acute and impaired wound healing: pathophysiology and current methods for drug delivery,part 1:normal and chronic wounds: biology,causes,and approaches to care.Advances in skin&wound care.2012；25:304-14.

2.Demidova-Rice TN,Hamblin MR and Herman IM.Acute and impaired wound healing: pathophysiology and current methods for drug delivery,part 2:role of growth factors in normal and pathological wound healing:therapeutic potential and methods of delivery.Advances in skin &wound care.2012；25:349-70.

3.Salcedo R,Wasserman K,Young HA,Grimm MC,Howard OMZ,Anver MR,Kleinman HK,Murphy WJ and Oppenheim JJ.Vascular Endothelial Growth Factor and Basic Fibroblast Growth Factor Induce Expression of CXCR4 on Human Endothelial Cells:In Vivo Neovascularization Induced by Stromal-Derived Factor-1α.The American Journal of Pathology. 1999；154:1125-1135.

4.Hattermann K,Sebens S,Helm O,Schmitt AD,Mentlein R,Mehdorn HM and Held-Feindt J.Chemokine expression profile of freshly isolated human glioblastoma-associated macrophages/microglia.Oncology reports.2014；32:270-6.

5.Badillo AT,Chung S,Zhang L,Zoltick P and Liechty KW.Lentiviral gene transfer of SDF-1alpha to wounds improves diabetic wound healing.The Journal of surgical research. 2007；143:35-42.

6.Lee WY,Wang CJ,Lin TY,Hsiao CL and Luo CW.CXCL17,an orphan chemokine,acts as a novel angiogenic and anti-inflammatory factor.American journal of physiology Endocrinology and metabolism.2013；304:E32-40.

7.Burkhardt AM,Tai KP,Flores-Guiterrez JP,Vilches-Cisneros N,Kamdar K, Barbosa-Quintana O,Valle-Rios R,Hevezi PA,J,Selman M,Ouellette AJ and Zlotnik A. CXCL17 Is a Mucosal Chemokine Elevated in Idiopathic Pulmonary Fibrosis That Exhibits Broad Antimicrobial Activity.The Journal of Immunology.2012；188:6399-6406.

8.Goren I,Pfeilschifter J and Frank S.Uptake of Neutrophil-Derived Ym1 Protein Distinguishes Wound Macrophages in the Absence of Interleukin-4 Signaling in Murine Wound Healing.Am J Pathol.2014.

9.Poutahidis T,Kearney SM,Levkovich T,Qi P,Varian BJ,Lakritz JR,Ibrahim YM, Chatzigiagkos A,Alm EJ and Erdman SE.Microbial symbionts accelerate wound healing via the neuropeptide hormone oxytocin.PLoS One.2013；8:e78898.

10.Ramos AN,Cabral ME,Noseda D,Bosch A,Yantorno OM and Valdez JC. Antipathogenic properties of Lactobacillus plantarum on Pseudomonas aeruginosa:the potential use of its supernatants in the treatment of infected chronic wounds.Wound repair and regeneration:official publication of the Wound Healing Society[and]the European Tissue Repair Society.2012；20:552-62.

11.E,Mathiesen G,Naterstad K,Eijsink VGH and Axelsson L.High-level,inducible gene expression in Lactobacillus sakei and Lactobacillus plantarum using versatile expression vectors.Microbiology.2005；151:2439-2449.

12.Eijsink VG,Axelsson L,Diep DB,Havarstein LS,Holo H and Nes IF.Production of class II bacteriocins by lactic acid bacteria；an example of biological warfare and communication. Antonie van Leeuwenhoek.2002；81:639-54.

13.Gao Z,Tseng C-h,Pei Z and Blaser MJ.Molecular analysis of human forearm superficial skin bacterial biota.Proceedings of the National Academy of Sciences.2007；104: 2927-2932.

14.Gethin G.The significance of surface pH in chronic wounds.Wounds UK.2007；3: 52-56.15.E,S,Naterstad K,Mathiesen G,Eijsink VG,and Axelsson L. Construction of vectors for inducible gene expression in Lactobacillus sakei and L plantarum. FEMS Microbiol Lett.2003；229(1):119-126.

15.E,S,Naterstad K,Mathiesen G,Eijsink VG,and Axelsson L. Construction of vectors for inducible gene expression in Lactobacillus sakei and L plantarum. FEMS Microbiol Lett.2003；229(1):119-126.

16.Cooper H.S.,Murthy S.N.,Shah R.S.,Sedergran D.J.Clinicopathologic study of dextran sulfate sodium experimental murine colitis.Lab.Invest.1993；69(2):238–249.

17.Nyman E,Huss F,Nyman T,Junker J,Kratz G.Hyaluronic acid,an important factor in the wound healing properties of amniotic fluid:in vitro studies of re-epithelialisation in human skin wounds.J Plast Surg Hand Surg.2013 Apr；47(2):89-92.

18.E,Christoffersson G,Waldén T,Carlsson P,Essand M,Korsgren O,and Phillipson M.Immunological shielding by induced recruitment of regulatory T lymphocytes delays rejection of islets transplanted to muscle.Cell transplantation.2015；24(2):263-76.

19.N,S and Fischer L.A novel manganese starvation-inducible expression system for Lactobacillus plantarum.FEMS Microbiol Lett 342(2013)37–44.

20.Duong,T,Miller,M.,Barrangou,R.,Azcarate-Peril A.and Klaenhammer T., Construction of vectors for inducible and constitutive gene expression in Lactobacillusmbt_200 357..Microbial Biotechnology(2010)4(3),357–367.

21.E,Mathiesen G,Naterstad K,Eijsink VG,and Axelsson L.High-level,inducible gene expression in Lactobacillus sakei and Lactobacillus plantarum using versatile expression vectors.Microbiology.2005 Jul；151(Pt 7):2439-49.

22.Nesmelova I,Sham Y,Gao J,and Mayo K.CXC and CC chemokines form mixed heterodimers association free energies from molecular dynamics simulations and experimental correlations.JBC Papers in Press,June 12,2008,DOI 10.1074/jbc.M803308200

23.Bellocq A,Suberville S,Philippe C,Bertrand F,Perez J,Fouqueray B,Cherqui G,Baud L.Low environmental pH is responsible for the induction of nitric-oxide synthase in macrophages. Evidence for involvement of nuclear factor-kappaB activation.J Biol Chem.1998 Feb 27； 273(9):5086-92.

24.Thompson J,Higgins DG,Gibson TJ.CLUSTAL W:improving the sensitivity of progressive multiple sequence alignment through sequence weighting,position-specific gap penalties and weight matrix choice.(1994)Nucleic Acids Res.,22:4673-4680.

25.Myers E and Miller W,Optimal alignments in linear space.(1988)CABIOS,4:11-17.

26.W.R.Pearson and D.J.Lipman.Improved Tools for Biological Sequence Analysis (1988)PNAS,85:2444-2448.

27.W,R.Pearson(1990),Rapid and sensitive sequence comparison with FASTP and FASTA. Methods Enzymol.,183:63-98,

28.Altschul SF,Madden TL,AA,Zhang J,Zhang Z,Miller W,Lipman DJ.(1997) Gapped BLAST and PSI-BLAST:a new generation of protein database search programs.Nucleic Acids Res.,25:3389-3402.

29.Holm L and Sander C.Protein structure comparison by alignment of distance matrices (1993)J.Mol.Biol.,233:123-38；9.

30.Holm L and Sander C.Dali:a network tool for protein structure comparison.(1995) Trends Biochem.Sci.,20:478-480.

31.Holm L and Sander C.Touring protein fold space with Dali/FSSP.(1998)Nucleic Acid Res.,26:316-9).

32.Massena S,Christoffersson G,E,Seignez C,Gustafsson K,Binet F,Herrera Hidalgo C,Giraud A,Lomei J,S,Shibuya M,Claesson-Welsh L,Gerwins P,Welsh M, Kreuger J,Phillipson M.Identification and characterization of VEGF-A-responsive neutrophils expressing CD49d,VEGFR1,and CXCR4 in mice and humans.Blood.2015 Oct 22； 126(17):2016-26.doi:10.1182/blood-2015-03-631572.Epub 2015 Aug 18.

33.Hatse S,Princen K,Liekens S,Vermeire K,De Clercq E,Schols D.Fluorescent CXCL12AF647 as a novel probe for nonradioactive CXCL12/CXCR4 cellular interaction studies. Cytometry A.2004 Oct；61(2):178-88.

34.Drury L,Ziarekb J,Gravelc,S,Veldkampb C,Takekoshif T,Hwangf S,Hevekerc N, Volkmanb B and Dwinella M.Monomeric and dimeric CXCL12 inhibit metastasis through distinct CXCR4 interactions and signaling pathways.PNAS October 25,2011,vol.108,no.43,pages 17655–17660.

Sequence table IV: summary of the sequence listing

Serial number	Description of the invention
		1.	mLrCK1_opt DNA
2.	mLrCK1_ opt protein
		3.	mXCL 12 native protein
4.	hLrCK1_opt DNA
		5.	hLrCK1_ opt protein
6.	hXCL 12 native protein
		7.	mLrCK2_opt DNA
8.	mLrCK2_ opt protein
		9.	mXCL 17 native protein
10.	hLrCK2_opt DNA
		11.	hLrCK2_ opt protein
12.	hXCL 17 native protein
		13.	mYm1_opt DNA
14.	mYm1 protein
		15.	mYm1 Natural protein
16.	hYm1_opt DNA
		17.	hYm1 protein
18.	hYm1 Natural protein
		19.	SppIP; activating peptides
20.	pSIP411 DNA
		21.	pSIP411 protein
22.	PCR primer
		23.	PCR primer
24.	pVAX1 DNA
		25.	pCTR DNA insert
26.	pCXCL12 DNA insert

Sequence listing

<110> Miyafilopson

Stevlrue

Everrinwiggergeor

<120> method for wound healing

<130> 27.34.126097

<150> 1451658-7

<151> 2014-12-23

<160> 26

<170> PatentIn version 3.5

<210> 1

<211> 299

<212> DNA

<213> mice

<220>

<221> CDS

<222> (3)..(293)

<400> 1

cc atg gca aaa ttt tgg aag aaa gca cta tta aca att gca gcc tta 47

Met Ala Lys Phe Trp Lys Lys Ala Leu Leu Thr Ile Ala Ala Leu

1 5 10 15

aca gtc ggc acc tcc gca gga att aca agc gtt tct gcc aaa ccg gta 95

Thr Val Gly Thr Ser Ala Gly Ile Thr Ser Val Ser Ala Lys Pro Val

20 25 30

agt ttg tca tat cga tgt cca tgc cgg ttt ttc gaa tct cat att gca 143

Ser Leu Ser Tyr Arg Cys Pro Cys Arg Phe Phe Glu Ser His Ile Ala

35 40 45

cgc gct aat gtc aaa cac tta aag att ctt aat act cct aat tgt gct 191

Arg Ala Asn Val Lys His Leu Lys Ile Leu Asn Thr Pro Asn Cys Ala

50 55 60

ttg cag att gtt gca cgt tta aag aat aac aat cgt caa gtt tgt atc 239

Leu Gln Ile Val Ala Arg Leu Lys Asn Asn Asn Arg Gln Val Cys Ile

65 70 75

gat cca aag ctt aaa tgg att caa gag tac tta gaa aag gcc tta aac 287

Asp Pro Lys Leu Lys Trp Ile Gln Glu Tyr Leu Glu Lys Ala Leu Asn

80 85 90 95

aaa taa ctcgag 299

Lys

<210> 2

<211> 96

<212> PRT

<213> mice

<400> 2

Met Ala Lys Phe Trp Lys Lys Ala Leu Leu Thr Ile Ala Ala Leu Thr

1 5 10 15

Val Gly Thr Ser Ala Gly Ile Thr Ser Val Ser Ala Lys Pro Val Ser

20 25 30

Leu Ser Tyr Arg Cys Pro Cys Arg Phe Phe Glu Ser His Ile Ala Arg

35 40 45

Ala Asn Val Lys His Leu Lys Ile Leu Asn Thr Pro Asn Cys Ala Leu

50 55 60

Gln Ile Val Ala Arg Leu Lys Asn Asn Asn Arg Gln Val Cys Ile Asp

65 70 75 80

Pro Lys Leu Lys Trp Ile Gln Glu Tyr Leu Glu Lys Ala Leu Asn Lys

85 90 95

<210> 3

<211> 89

<212> PRT

<213> mice

<400> 3

Met Asp Ala Lys Val Val Ala Val Leu Ala Leu Val Leu Ala Ala Leu

1 5 10 15

Cys Ile Ser Asp Gly Lys Pro Val Ser Leu Ser Tyr Arg Cys Pro Cys

20 25 30

Arg Phe Phe Glu Ser His Ile Ala Arg Ala Asn Val Lys His Leu Lys

35 40 45

Ile Leu Asn Thr Pro Asn Cys Ala Leu Gln Ile Val Ala Arg Leu Lys

50 55 60

Asn Asn Asn Arg Gln Val Cys Ile Asp Pro Lys Leu Lys Trp Ile Gln

65 70 75 80

Glu Tyr Leu Glu Lys Ala Leu Asn Lys

85

<210> 4

<211> 299

<212> DNA

<213> Intelligent people

<220>

<221> CDS

<222> (3)..(293)

<400> 4

cc atg gca aaa ttt tgg aag aaa gca cta tta aca att gca gcc tta 47

Met Ala Lys Phe Trp Lys Lys Ala Leu Leu Thr Ile Ala Ala Leu

1 5 10 15

aca gtc ggc acc tcc gca gga att aca agc gtt tct gcc aaa ccg gta 95

Thr Val Gly Thr Ser Ala Gly Ile Thr Ser Val Ser Ala Lys Pro Val

20 25 30

agt ttg tca tat cga tgt cca tgc cgg ttt ttc gaa tct cat gtt gca 143

Ser Leu Ser Tyr Arg Cys Pro Cys Arg Phe Phe Glu Ser His Val Ala

35 40 45

cgc gct aat gtc aaa cac tta aag att ctt aat act cct aat tgt gct 191

Arg Ala Asn Val Lys His Leu Lys Ile Leu Asn Thr Pro Asn Cys Ala

50 55 60

ttg cag att gtt gca cgt tta aag aat aac aat cgt caa gtt tgt atc 239

Leu Gln Ile Val Ala Arg Leu Lys Asn Asn Asn Arg Gln Val Cys Ile

65 70 75

gat cca aag ctt aaa tgg att caa gag tac tta gaa aag gcc tta aac 287

Asp Pro Lys Leu Lys Trp Ile Gln Glu Tyr Leu Glu Lys Ala Leu Asn

80 85 90 95

aaa taa ctcgag 299

Lys

<210> 5

<211> 96

<212> PRT

<213> Intelligent people

<400> 5

Met Ala Lys Phe Trp Lys Lys Ala Leu Leu Thr Ile Ala Ala Leu Thr

1 5 10 15

Val Gly Thr Ser Ala Gly Ile Thr Ser Val Ser Ala Lys Pro Val Ser

20 25 30

Leu Ser Tyr Arg Cys Pro Cys Arg Phe Phe Glu Ser His Val Ala Arg

35 40 45

Ala Asn Val Lys His Leu Lys Ile Leu Asn Thr Pro Asn Cys Ala Leu

50 55 60

Gln Ile Val Ala Arg Leu Lys Asn Asn Asn Arg Gln Val Cys Ile Asp

65 70 75 80

Pro Lys Leu Lys Trp Ile Gln Glu Tyr Leu Glu Lys Ala Leu Asn Lys

85 90 95

<210> 6

<211> 89

<212> PRT

<213> Intelligent people

<400> 6

Met Asn Ala Lys Val Val Val Val Leu Val Leu Val Leu Thr Ala Leu

1 5 10 15

Cys Leu Ser Asp Gly Lys Pro Val Ser Leu Ser Tyr Arg Cys Pro Cys

20 25 30

Arg Phe Phe Glu Ser His Val Ala Arg Ala Asn Val Lys His Leu Lys

35 40 45

Ile Leu Asn Thr Pro Asn Cys Ala Leu Gln Ile Val Ala Arg Leu Lys

50 55 60

Asn Asn Asn Arg Gln Val Cys Ile Asp Pro Lys Leu Lys Trp Ile Gln

65 70 75 80

Glu Tyr Leu Glu Lys Ala Leu Asn Lys

85

<210> 7

<211> 386

<212> DNA

<213> mice

<220>

<221> CDS

<222> (3)..(380)

<400> 7

cc atg gca aaa ttt tgg aag aaa gca cta tta aca att gca gcc tta 47

Met Ala Lys Phe Trp Lys Lys Ala Leu Leu Thr Ile Ala Ala Leu

1 5 10 15

aca gtc ggc acc tcc gca gga att aca agc gtt tct gcc agc cca aat 95

Thr Val Gly Thr Ser Ala Gly Ile Thr Ser Val Ser Ala Ser Pro Asn

20 25 30

cca ggg gtc gcc aga tct cac ggc gac cag cac ctg gct cct agg aga 143

Pro Gly Val Ala Arg Ser His Gly Asp Gln His Leu Ala Pro Arg Arg

35 40 45

tgg ctc ctg gaa ggc ggc caa gaa tgt gag tgc aaa gat tgg ttc ctg 191

Trp Leu Leu Glu Gly Gly Gln Glu Cys Glu Cys Lys Asp Trp Phe Leu

50 55 60

caa gcc ccg aag aga aaa gcc aca gct gtg ctg ggg cca cca aga aag 239

Gln Ala Pro Lys Arg Lys Ala Thr Ala Val Leu Gly Pro Pro Arg Lys

65 70 75

cag tgc ccc tgt gat cat gtg aag ggc aga gaa aag aaa aat aga cac 287

Gln Cys Pro Cys Asp His Val Lys Gly Arg Glu Lys Lys Asn Arg His

80 85 90 95

caa aag cac cac aga aag agc caa aga ccc tcc aga gcc tgc cag caa 335

Gln Lys His His Arg Lys Ser Gln Arg Pro Ser Arg Ala Cys Gln Gln

100 105 110

ttt ctc aaa agg tgt cac cta gcc agc ttt gct ctg cct ttg tag 380

Phe Leu Lys Arg Cys His Leu Ala Ser Phe Ala Leu Pro Leu

115 120 125

ctcgag 386

<210> 8

<211> 125

<212> PRT

<213> mice

<400> 8

Met Ala Lys Phe Trp Lys Lys Ala Leu Leu Thr Ile Ala Ala Leu Thr

1 5 10 15

Val Gly Thr Ser Ala Gly Ile Thr Ser Val Ser Ala Ser Pro Asn Pro

20 25 30

Gly Val Ala Arg Ser His Gly Asp Gln His Leu Ala Pro Arg Arg Trp

35 40 45

Leu Leu Glu Gly Gly Gln Glu Cys Glu Cys Lys Asp Trp Phe Leu Gln

50 55 60

Ala Pro Lys Arg Lys Ala Thr Ala Val Leu Gly Pro Pro Arg Lys Gln

65 70 75 80

Cys Pro Cys Asp His Val Lys Gly Arg Glu Lys Lys Asn Arg His Gln

85 90 95

Lys His His Arg Lys Ser Gln Arg Pro Ser Arg Ala Cys Gln Gln Phe

100 105 110

Leu Lys Arg Cys His Leu Ala Ser Phe Ala Leu Pro Leu

115 120 125

<210> 9

<211> 119

<212> PRT

<213> mice

<400> 9

Met Lys Leu Leu Ala Ser Pro Phe Leu Leu Leu Leu Pro Val Met Leu

1 5 10 15

Met Ser Met Val Phe Ser Ser Pro Asn Pro Gly Val Ala Arg Ser His

20 25 30

Gly Asp Gln His Leu Ala Pro Arg Arg Trp Leu Leu Glu Gly Gly Gln

35 40 45

Glu Cys Glu Cys Lys Asp Trp Phe Leu Gln Ala Pro Lys Arg Lys Ala

50 55 60

Thr Ala Val Leu Gly Pro Pro Arg Lys Gln Cys Pro Cys Asp His Val

65 70 75 80

Lys Gly Arg Glu Lys Lys Asn Arg His Gln Lys His His Arg Lys Ser

85 90 95

Gln Arg Pro Ser Arg Ala Cys Gln Gln Phe Leu Lys Arg Cys His Leu

100 105 110

Ala Ser Phe Ala Leu Pro Leu

115

<210> 10

<211> 386

<212> DNA

<213> Intelligent people

<220>

<221> CDS

<222> (3)..(380)

<400> 10

cc atg gca aaa ttt tgg aag aaa gca cta tta aca att gca gcc tta 47

Met Ala Lys Phe Trp Lys Lys Ala Leu Leu Thr Ile Ala Ala Leu

1 5 10 15

aca gtc ggc acc tcc gca gga att aca agc gtt tct gcc tca tta aat 95

Thr Val Gly Thr Ser Ala Gly Ile Thr Ser Val Ser Ala Ser Leu Asn

20 25 30

cca gga gta gca cgg ggt cat cga gat cgg gga caa gca agt cgg cgt 143

Pro Gly Val Ala Arg Gly His Arg Asp Arg Gly Gln Ala Ser Arg Arg

35 40 45

tgg tta caa gaa ggt ggt caa gaa tgt gaa tgt aaa gat tgg ttt tta 191

Trp Leu Gln Glu Gly Gly Gln Glu Cys Glu Cys Lys Asp Trp Phe Leu

50 55 60

cgt gct cca cgt cgg aag ttt atg act gtt agt ggt ctt cca aag aaa 239

Arg Ala Pro Arg Arg Lys Phe Met Thr Val Ser Gly Leu Pro Lys Lys

65 70 75

caa tgt cct tgt gat cat ttt aag gga aat gtt aag aaa act cga cac 287

Gln Cys Pro Cys Asp His Phe Lys Gly Asn Val Lys Lys Thr Arg His

80 85 90 95

caa cgt cat cac cgg aaa cct aat aag cat tca cgg gca tgt caa caa 335

Gln Arg His His Arg Lys Pro Asn Lys His Ser Arg Ala Cys Gln Gln

100 105 110

ttt ctt aaa caa tgt caa ctt cgt tct ttt gct ctt cct ctt taa 380

Phe Leu Lys Gln Cys Gln Leu Arg Ser Phe Ala Leu Pro Leu

115 120 125

ctcgag 386

<210> 11

<211> 125

<212> PRT

<213> Intelligent people

<400> 11

Met Ala Lys Phe Trp Lys Lys Ala Leu Leu Thr Ile Ala Ala Leu Thr

1 5 10 15

Val Gly Thr Ser Ala Gly Ile Thr Ser Val Ser Ala Ser Leu Asn Pro

20 25 30

Gly Val Ala Arg Gly His Arg Asp Arg Gly Gln Ala Ser Arg Arg Trp

35 40 45

Leu Gln Glu Gly Gly Gln Glu Cys Glu Cys Lys Asp Trp Phe Leu Arg

50 55 60

Ala Pro Arg Arg Lys Phe Met Thr Val Ser Gly Leu Pro Lys Lys Gln

65 70 75 80

Cys Pro Cys Asp His Phe Lys Gly Asn Val Lys Lys Thr Arg His Gln

85 90 95

Arg His His Arg Lys Pro Asn Lys His Ser Arg Ala Cys Gln Gln Phe

100 105 110

Leu Lys Gln Cys Gln Leu Arg Ser Phe Ala Leu Pro Leu

115 120 125

<210> 12

<211> 119

<212> PRT

<213> Intelligent people

<400> 12

Met Lys Val Leu Ile Ser Ser Leu Leu Leu Leu Leu Pro Leu Met Leu

1 5 10 15

Met Ser Met Val Ser Ser Ser Leu Asn Pro Gly Val Ala Arg Gly His

20 25 30

Arg Asp Arg Gly Gln Ala Ser Arg Arg Trp Leu Gln Glu Gly Gly Gln

35 40 45

Glu Cys Glu Cys Lys Asp Trp Phe Leu Arg Ala Pro Arg Arg Lys Phe

50 55 60

Met Thr Val Ser Gly Leu Pro Lys Lys Gln Cys Pro Cys Asp His Phe

65 70 75 80

Lys Gly Asn Val Lys Lys Thr Arg His Gln Arg His His Arg Lys Pro

85 90 95

Asn Lys His Ser Arg Ala Cys Gln Gln Phe Leu Lys Gln Cys Gln Leu

100 105 110

Arg Ser Phe Ala Leu Pro Leu

115

<210> 13

<211> 1226

<212> DNA

<213> mice

<220>

<221> CDS

<222> (3)..(1220)

<400> 13

cc atg gca aaa ttt tgg aag aaa gca cta tta aca att gca gcc tta 47

Met Ala Lys Phe Trp Lys Lys Ala Leu Leu Thr Ile Ala Ala Leu

1 5 10 15

aca gtc ggc acc tcc gca gga att aca agc gtt tct gcc tac caa ctt 95

Thr Val Gly Thr Ser Ala Gly Ile Thr Ser Val Ser Ala Tyr Gln Leu

20 25 30

atg tgt tac tac act tca tgg gct aaa gat cgt cca att gaa ggt tct 143

Met Cys Tyr Tyr Thr Ser Trp Ala Lys Asp Arg Pro Ile Glu Gly Ser

35 40 45

ttt aag cca gga aat att gat cct tgt ctt tgt aca cat ctt att tac 191

Phe Lys Pro Gly Asn Ile Asp Pro Cys Leu Cys Thr His Leu Ile Tyr

50 55 60

gct ttt gct ggt atg caa aat aat gaa att act tac aca cac gaa caa 239

Ala Phe Ala Gly Met Gln Asn Asn Glu Ile Thr Tyr Thr His Glu Gln

65 70 75

gat tta cgt gat tac gaa gct ctt aat ggt ctt aag gat aag aat act 287

Asp Leu Arg Asp Tyr Glu Ala Leu Asn Gly Leu Lys Asp Lys Asn Thr

80 85 90 95

gaa ctt aag aca ctt ctt gca att ggt gga tgg aag ttt gga cca gct 335

Glu Leu Lys Thr Leu Leu Ala Ile Gly Gly Trp Lys Phe Gly Pro Ala

100 105 110

cct ttt agt gca atg gtt tca act cca caa aat cgg caa att ttt att 383

Pro Phe Ser Ala Met Val Ser Thr Pro Gln Asn Arg Gln Ile Phe Ile

115 120 125

caa agt gta att cgg ttt tta cgg caa tac aat ttt gat gga ctt aat 431

Gln Ser Val Ile Arg Phe Leu Arg Gln Tyr Asn Phe Asp Gly Leu Asn

130 135 140

ctt gat tgg caa tac cca ggt agt cga gga tca cca cct aag gat aag 479

Leu Asp Trp Gln Tyr Pro Gly Ser Arg Gly Ser Pro Pro Lys Asp Lys

145 150 155

cat tta ttt agt gtt ctt gta aaa gaa atg cga aag gct ttt gaa gaa 527

His Leu Phe Ser Val Leu Val Lys Glu Met Arg Lys Ala Phe Glu Glu

160 165 170 175

gaa agt gtt gaa aag gat att cca cgt ctt ctt ctt act agt aca ggt 575

Glu Ser Val Glu Lys Asp Ile Pro Arg Leu Leu Leu Thr Ser Thr Gly

180 185 190

gca gga att att gat gta att aag tca ggt tac aag att cca gaa ctt 623

Ala Gly Ile Ile Asp Val Ile Lys Ser Gly Tyr Lys Ile Pro Glu Leu

195 200 205

agt caa tca ctt gat tac att caa gtt atg act tac gat tta cac gat 671

Ser Gln Ser Leu Asp Tyr Ile Gln Val Met Thr Tyr Asp Leu His Asp

210 215 220

cct aag gat ggt tac aca gga gaa aat tct cca ctt tac aag agt cct 719

Pro Lys Asp Gly Tyr Thr Gly Glu Asn Ser Pro Leu Tyr Lys Ser Pro

225 230 235

tac gat att gga aag agt gct gat ctt aat gtt gat tct att att agt 767

Tyr Asp Ile Gly Lys Ser Ala Asp Leu Asn Val Asp Ser Ile Ile Ser

240 245 250 255

tac tgg aaa gat cat gga gct gca tca gaa aag ctt att gtt ggt ttt 815

Tyr Trp Lys Asp His Gly Ala Ala Ser Glu Lys Leu Ile Val Gly Phe

260 265 270

cca gct tac gga cac act ttt att ctt tca gat cca tct aag aca ggt 863

Pro Ala Tyr Gly His Thr Phe Ile Leu Ser Asp Pro Ser Lys Thr Gly

275 280 285

att gga gca cct act att tct aca ggt cca cct gga aag tat act gat 911

Ile Gly Ala Pro Thr Ile Ser Thr Gly Pro Pro Gly Lys Tyr Thr Asp

290 295 300

gaa agt ggt ctt tta gct tac tac gaa gtt tgt aca ttt tta aat gaa 959

Glu Ser Gly Leu Leu Ala Tyr Tyr Glu Val Cys Thr Phe Leu Asn Glu

305 310 315

gga gct aca gaa gtt tgg gat gca cca caa gaa gta cct tat gca tac 1007

Gly Ala Thr Glu Val Trp Asp Ala Pro Gln Glu Val Pro Tyr Ala Tyr

320 325 330 335

cag ggt aat gaa tgg gtt gga tac gat aat gta cgt agt ttt aag ctt 1055

Gln Gly Asn Glu Trp Val Gly Tyr Asp Asn Val Arg Ser Phe Lys Leu

340 345 350

aag gct caa tgg ctt aag gat aat aat tta ggt gga gca gtt gta tgg 1103

Lys Ala Gln Trp Leu Lys Asp Asn Asn Leu Gly Gly Ala Val Val Trp

355 360 365

cca ctt gat atg gat gat ttt tct ggt agt ttt tgt cat caa cgg cac 1151

Pro Leu Asp Met Asp Asp Phe Ser Gly Ser Phe Cys His Gln Arg His

370 375 380

ttt cct ctt act tca aca ctt aag ggt gat ctt aat att cat tca gca 1199

Phe Pro Leu Thr Ser Thr Leu Lys Gly Asp Leu Asn Ile His Ser Ala

385 390 395

tct tgt aag gga cca tat taa ctcgag 1226

Ser Cys Lys Gly Pro Tyr

400 405

<210> 14

<211> 405

<212> PRT

<213> mice

<400> 14

Met Ala Lys Phe Trp Lys Lys Ala Leu Leu Thr Ile Ala Ala Leu Thr

1 5 10 15

Val Gly Thr Ser Ala Gly Ile Thr Ser Val Ser Ala Tyr Gln Leu Met

20 25 30

Cys Tyr Tyr Thr Ser Trp Ala Lys Asp Arg Pro Ile Glu Gly Ser Phe

35 40 45

Lys Pro Gly Asn Ile Asp Pro Cys Leu Cys Thr His Leu Ile Tyr Ala

50 55 60

Phe Ala Gly Met Gln Asn Asn Glu Ile Thr Tyr Thr His Glu Gln Asp

65 70 75 80

Leu Arg Asp Tyr Glu Ala Leu Asn Gly Leu Lys Asp Lys Asn Thr Glu

85 90 95

Leu Lys Thr Leu Leu Ala Ile Gly Gly Trp Lys Phe Gly Pro Ala Pro

100 105 110

Phe Ser Ala Met Val Ser Thr Pro Gln Asn Arg Gln Ile Phe Ile Gln

115 120 125

Ser Val Ile Arg Phe Leu Arg Gln Tyr Asn Phe Asp Gly Leu Asn Leu

130 135 140

Asp Trp Gln Tyr Pro Gly Ser Arg Gly Ser Pro Pro Lys Asp Lys His

145 150 155 160

Leu Phe Ser Val Leu Val Lys Glu Met Arg Lys Ala Phe Glu Glu Glu

165 170 175

Ser Val Glu Lys Asp Ile Pro Arg Leu Leu Leu Thr Ser Thr Gly Ala

180 185 190

Gly Ile Ile Asp Val Ile Lys Ser Gly Tyr Lys Ile Pro Glu Leu Ser

195 200 205

Gln Ser Leu Asp Tyr Ile Gln Val Met Thr Tyr Asp Leu His Asp Pro

210 215 220

Lys Asp Gly Tyr Thr Gly Glu Asn Ser Pro Leu Tyr Lys Ser Pro Tyr

225 230 235 240

Asp Ile Gly Lys Ser Ala Asp Leu Asn Val Asp Ser Ile Ile Ser Tyr

245 250 255

Trp Lys Asp His Gly Ala Ala Ser Glu Lys Leu Ile Val Gly Phe Pro

260 265 270

Ala Tyr Gly His Thr Phe Ile Leu Ser Asp Pro Ser Lys Thr Gly Ile

275 280 285

Gly Ala Pro Thr Ile Ser Thr Gly Pro Pro Gly Lys Tyr Thr Asp Glu

290 295 300

Ser Gly Leu Leu Ala Tyr Tyr Glu Val Cys Thr Phe Leu Asn Glu Gly

305 310 315 320

Ala Thr Glu Val Trp Asp Ala Pro Gln Glu Val Pro Tyr Ala Tyr Gln

325 330 335

Gly Asn Glu Trp Val Gly Tyr Asp Asn Val Arg Ser Phe Lys Leu Lys

340 345 350

Ala Gln Trp Leu Lys Asp Asn Asn Leu Gly Gly Ala Val Val Trp Pro

355 360 365

Leu Asp Met Asp Asp Phe Ser Gly Ser Phe Cys His Gln Arg His Phe

370 375 380

Pro Leu Thr Ser Thr Leu Lys Gly Asp Leu Asn Ile His Ser Ala Ser

385 390 395 400

Cys Lys Gly Pro Tyr

405

<210> 15

<211> 398

<212> PRT

<213> mice

<400> 15

Met Ala Lys Leu Ile Leu Val Thr Gly Leu Ala Ile Leu Leu Asn Val

1 5 10 15

Gln Leu Gly Ser Ser Tyr Gln Leu Met Cys Tyr Tyr Thr Ser Trp Ala

20 25 30

Lys Asp Arg Pro Ile Glu Gly Ser Phe Lys Pro Gly Asn Ile Asp Pro

35 40 45

Cys Leu Cys Thr His Leu Ile Tyr Ala Phe Ala Gly Met Gln Asn Asn

50 55 60

Glu Ile Thr Tyr Thr His Glu Gln Asp Leu Arg Asp Tyr Glu Ala Leu

65 70 75 80

Asn Gly Leu Lys Asp Lys Asn Thr Glu Leu Lys Thr Leu Leu Ala Ile

85 90 95

Gly Gly Trp Lys Phe Gly Pro Ala Pro Phe Ser Ala Met Val Ser Thr

100 105 110

Pro Gln Asn Arg Gln Ile Phe Ile Gln Ser Val Ile Arg Phe Leu Arg

115 120 125

Gln Tyr Asn Phe Asp Gly Leu Asn Leu Asp Trp Gln Tyr Pro Gly Ser

130 135 140

Arg Gly Ser Pro Pro Lys Asp Lys His Leu Phe Ser Val Leu Val Lys

145 150 155 160

Glu Met Arg Lys Ala Phe Glu Glu Glu Ser Val Glu Lys Asp Ile Pro

165 170 175

Arg Leu Leu Leu Thr Ser Thr Gly Ala Gly Ile Ile Asp Val Ile Lys

180 185 190

Ser Gly Tyr Lys Ile Pro Glu Leu Ser Gln Ser Leu Asp Tyr Ile Gln

195 200 205

Val Met Thr Tyr Asp Leu His Asp Pro Lys Asp Gly Tyr Thr Gly Glu

210 215 220

Asn Ser Pro Leu Tyr Lys Ser Pro Tyr Asp Ile Gly Lys Ser Ala Asp

225 230 235 240

Leu Asn Val Asp Ser Ile Ile Ser Tyr Trp Lys Asp His Gly Ala Ala

245 250 255

Ser Glu Lys Leu Ile Val Gly Phe Pro Ala Tyr Gly His Thr Phe Ile

260 265 270

Leu Ser Asp Pro Ser Lys Thr Gly Ile Gly Ala Pro Thr Ile Ser Thr

275 280 285

Gly Pro Pro Gly Lys Tyr Thr Asp Glu Ser Gly Leu Leu Ala Tyr Tyr

290 295 300

Glu Val Cys Thr Phe Leu Asn Glu Gly Ala Thr Glu Val Trp Asp Ala

305 310 315 320

Pro Gln Glu Val Pro Tyr Ala Tyr Gln Gly Asn Glu Trp Val Gly Tyr

325 330 335

Asp Asn Val Arg Ser Phe Lys Leu Lys Ala Gln Trp Leu Lys Asp Asn

340 345 350

Asn Leu Gly Gly Ala Val Val Trp Pro Leu Asp Met Asp Asp Phe Ser

355 360 365

Gly Ser Phe Cys His Gln Arg His Phe Pro Leu Thr Ser Thr Leu Lys

370 375 380

Gly Asp Leu Asn Ile His Ser Ala Ser Cys Lys Gly Pro Tyr

385 390 395

<210> 16

<211> 1181

<212> DNA

<213> Intelligent people

<220>

<221> CDS

<222> (3)..(1175)

<400> 16

cc atg gca aaa ttt tgg aag aaa gca cta tta aca att gca gcc tta 47

Met Ala Lys Phe Trp Lys Lys Ala Leu Leu Thr Ile Ala Ala Leu

1 5 10 15

aca gtc ggc acc tcc gca gga att aca agc gtt tct gcc tac aag ctt 95

Thr Val Gly Thr Ser Ala Gly Ile Thr Ser Val Ser Ala Tyr Lys Leu

20 25 30

gtt tgt tac tac act tca tgg tct caa tac cga gaa ggt gat gga agt 143

Val Cys Tyr Tyr Thr Ser Trp Ser Gln Tyr Arg Glu Gly Asp Gly Ser

35 40 45

tgt ttt cca gat gct ctt gat cgg ttt tta tgt aca cat att att tac 191

Cys Phe Pro Asp Ala Leu Asp Arg Phe Leu Cys Thr His Ile Ile Tyr

50 55 60

tct ttt gca aat att agt aat gat cac att gat aca tgg gaa tgg aat 239

Ser Phe Ala Asn Ile Ser Asn Asp His Ile Asp Thr Trp Glu Trp Asn

65 70 75

gat gtt act ctt tac ggt atg ctt aat aca ctt aag aat cgt aat cca 287

Asp Val Thr Leu Tyr Gly Met Leu Asn Thr Leu Lys Asn Arg Asn Pro

80 85 90 95

aat tta aag act tta ctt agt gta ggt gga tgg aat ttt ggt tct caa 335

Asn Leu Lys Thr Leu Leu Ser Val Gly Gly Trp Asn Phe Gly Ser Gln

100 105 110

cgg ttt agt aag att gct tca aat act caa tct cgt cgg aca ttt att 383

Arg Phe Ser Lys Ile Ala Ser Asn Thr Gln Ser Arg Arg Thr Phe Ile

115 120 125

aaa agt gtt cca cca ttt tta cgt act cat ggt ttt gat gga ctt gat 431

Lys Ser Val Pro Pro Phe Leu Arg Thr His Gly Phe Asp Gly Leu Asp

130 135 140

tta gca tgg ctt tat cca ggt cga cgt gat aag caa cac ttt act aca 479

Leu Ala Trp Leu Tyr Pro Gly Arg Arg Asp Lys Gln His Phe Thr Thr

145 150 155

ctt att aaa gaa atg aag gct gaa ttt att aag gaa gca caa cct ggt 527

Leu Ile Lys Glu Met Lys Ala Glu Phe Ile Lys Glu Ala Gln Pro Gly

160 165 170 175

aaa aag caa ctt ctt ctt agt gct gca tta tca gct gga aag gtt act 575

Lys Lys Gln Leu Leu Leu Ser Ala Ala Leu Ser Ala Gly Lys Val Thr

180 185 190

att gat agt tca tac gat att gca aag att agt caa cat ctt gat ttt 623

Ile Asp Ser Ser Tyr Asp Ile Ala Lys Ile Ser Gln His Leu Asp Phe

195 200 205

att tca att atg aca tac gat ttt cac ggt gct tgg cgg ggt act aca 671

Ile Ser Ile Met Thr Tyr Asp Phe His Gly Ala Trp Arg Gly Thr Thr

210 215 220

gga cat cac agt cca tta ttt cgt gga caa gaa gat gct tca cct gat 719

Gly His His Ser Pro Leu Phe Arg Gly Gln Glu Asp Ala Ser Pro Asp

225 230 235

cgg ttt tct aat act gat tat gca gtt ggt tac atg ctt cgg tta gga 767

Arg Phe Ser Asn Thr Asp Tyr Ala Val Gly Tyr Met Leu Arg Leu Gly

240 245 250 255

gct cca gca tct aaa ctt gta atg ggt att cct act ttt gga cga tca 815

Ala Pro Ala Ser Lys Leu Val Met Gly Ile Pro Thr Phe Gly Arg Ser

260 265 270

ttt aca tta gct tct agt gaa act ggt gtt gga gca cca att tca ggt 863

Phe Thr Leu Ala Ser Ser Glu Thr Gly Val Gly Ala Pro Ile Ser Gly

275 280 285

cca gga att cct ggt cgt ttt act aag gaa gct gga aca ctt gca tac 911

Pro Gly Ile Pro Gly Arg Phe Thr Lys Glu Ala Gly Thr Leu Ala Tyr

290 295 300

tac gaa att tgt gat ttt ctt cgg ggt gct act gtt cat cga aca ctt 959

Tyr Glu Ile Cys Asp Phe Leu Arg Gly Ala Thr Val His Arg Thr Leu

305 310 315

gga caa caa gta cct tat gca act aaa ggt aat caa tgg gtt gga tac 1007

Gly Gln Gln Val Pro Tyr Ala Thr Lys Gly Asn Gln Trp Val Gly Tyr

320 325 330 335

gat gat caa gaa agt gtt aag tca aag gta caa tac ctt aag gat cga 1055

Asp Asp Gln Glu Ser Val Lys Ser Lys Val Gln Tyr Leu Lys Asp Arg

340 345 350

caa tta gct ggt gca atg gta tgg gct ctt gat ctt gat gat ttt caa 1103

Gln Leu Ala Gly Ala Met Val Trp Ala Leu Asp Leu Asp Asp Phe Gln

355 360 365

ggt agt ttt tgt gga caa gat ctt cgt ttt cca ctt act aat gct att 1151

Gly Ser Phe Cys Gly Gln Asp Leu Arg Phe Pro Leu Thr Asn Ala Ile

370 375 380

aag gat gca tta gct gca aca taa ctcgag 1181

Lys Asp Ala Leu Ala Ala Thr

385 390

<210> 17

<211> 390

<212> PRT

<213> Intelligent people

<400> 17

Met Ala Lys Phe Trp Lys Lys Ala Leu Leu Thr Ile Ala Ala Leu Thr

1 5 10 15

Val Gly Thr Ser Ala Gly Ile Thr Ser Val Ser Ala Tyr Lys Leu Val

20 25 30

Cys Tyr Tyr Thr Ser Trp Ser Gln Tyr Arg Glu Gly Asp Gly Ser Cys

35 40 45

Phe Pro Asp Ala Leu Asp Arg Phe Leu Cys Thr His Ile Ile Tyr Ser

50 55 60

Phe Ala Asn Ile Ser Asn Asp His Ile Asp Thr Trp Glu Trp Asn Asp

65 70 75 80

Val Thr Leu Tyr Gly Met Leu Asn Thr Leu Lys Asn Arg Asn Pro Asn

85 90 95

Leu Lys Thr Leu Leu Ser Val Gly Gly Trp Asn Phe Gly Ser Gln Arg

100 105 110

Phe Ser Lys Ile Ala Ser Asn Thr Gln Ser Arg Arg Thr Phe Ile Lys

115 120 125

Ser Val Pro Pro Phe Leu Arg Thr His Gly Phe Asp Gly Leu Asp Leu

130 135 140

Ala Trp Leu Tyr Pro Gly Arg Arg Asp Lys Gln His Phe Thr Thr Leu

145 150 155 160

Ile Lys Glu Met Lys Ala Glu Phe Ile Lys Glu Ala Gln Pro Gly Lys

165 170 175

Lys Gln Leu Leu Leu Ser Ala Ala Leu Ser Ala Gly Lys Val Thr Ile

180 185 190

Asp Ser Ser Tyr Asp Ile Ala Lys Ile Ser Gln His Leu Asp Phe Ile

195 200 205

Ser Ile Met Thr Tyr Asp Phe His Gly Ala Trp Arg Gly Thr Thr Gly

210 215 220

His His Ser Pro Leu Phe Arg Gly Gln Glu Asp Ala Ser Pro Asp Arg

225 230 235 240

Phe Ser Asn Thr Asp Tyr Ala Val Gly Tyr Met Leu Arg Leu Gly Ala

245 250 255

Pro Ala Ser Lys Leu Val Met Gly Ile Pro Thr Phe Gly Arg Ser Phe

260 265 270

Thr Leu Ala Ser Ser Glu Thr Gly Val Gly Ala Pro Ile Ser Gly Pro

275 280 285

Gly Ile Pro Gly Arg Phe Thr Lys Glu Ala Gly Thr Leu Ala Tyr Tyr

290 295 300

Glu Ile Cys Asp Phe Leu Arg Gly Ala Thr Val His Arg Thr Leu Gly

305 310 315 320

Gln Gln Val Pro Tyr Ala Thr Lys Gly Asn Gln Trp Val Gly Tyr Asp

325 330 335

Asp Gln Glu Ser Val Lys Ser Lys Val Gln Tyr Leu Lys Asp Arg Gln

340 345 350

Leu Ala Gly Ala Met Val Trp Ala Leu Asp Leu Asp Asp Phe Gln Gly

355 360 365

Ser Phe Cys Gly Gln Asp Leu Arg Phe Pro Leu Thr Asn Ala Ile Lys

370 375 380

Asp Ala Leu Ala Ala Thr

385 390

<210> 18

<211> 383

<212> PRT

<213> Intelligent people

<400> 18

Met Gly Val Lys Ala Ser Gln Thr Gly Phe Val Val Leu Val Leu Leu

1 5 10 15

Gln Cys Cys Ser Ala Tyr Lys Leu Val Cys Tyr Tyr Thr Ser Trp Ser

20 25 30

Gln Tyr Arg Glu Gly Asp Gly Ser Cys Phe Pro Asp Ala Leu Asp Arg

35 40 45

Phe Leu Cys Thr His Ile Ile Tyr Ser Phe Ala Asn Ile Ser Asn Asp

50 55 60

His Ile Asp Thr Trp Glu Trp Asn Asp Val Thr Leu Tyr Gly Met Leu

65 70 75 80

Asn Thr Leu Lys Asn Arg Asn Pro Asn Leu Lys Thr Leu Leu Ser Val

85 90 95

Gly Gly Trp Asn Phe Gly Ser Gln Arg Phe Ser Lys Ile Ala Ser Asn

100 105 110

Thr Gln Ser Arg Arg Thr Phe Ile Lys Ser Val Pro Pro Phe Leu Arg

115 120 125

Thr His Gly Phe Asp Gly Leu Asp Leu Ala Trp Leu Tyr Pro Gly Arg

130 135 140

Arg Asp Lys Gln His Phe Thr Thr Leu Ile Lys Glu Met Lys Ala Glu

145 150 155 160

Phe Ile Lys Glu Ala Gln Pro Gly Lys Lys Gln Leu Leu Leu Ser Ala

165 170 175

Ala Leu Ser Ala Gly Lys Val Thr Ile Asp Ser Ser Tyr Asp Ile Ala

180 185 190

Lys Ile Ser Gln His Leu Asp Phe Ile Ser Ile Met Thr Tyr Asp Phe

195 200 205

His Gly Ala Trp Arg Gly Thr Thr Gly His His Ser Pro Leu Phe Arg

210 215 220

Gly Gln Glu Asp Ala Ser Pro Asp Arg Phe Ser Asn Thr Asp Tyr Ala

225 230 235 240

Val Gly Tyr Met Leu Arg Leu Gly Ala Pro Ala Ser Lys Leu Val Met

245 250 255

Gly Ile Pro Thr Phe Gly Arg Ser Phe Thr Leu Ala Ser Ser Glu Thr

260 265 270

Gly Val Gly Ala Pro Ile Ser Gly Pro Gly Ile Pro Gly Arg Phe Thr

275 280 285

Lys Glu Ala Gly Thr Leu Ala Tyr Tyr Glu Ile Cys Asp Phe Leu Arg

290 295 300

Gly Ala Thr Val His Arg Thr Leu Gly Gln Gln Val Pro Tyr Ala Thr

305 310 315 320

Lys Gly Asn Gln Trp Val Gly Tyr Asp Asp Gln Glu Ser Val Lys Ser

325 330 335

Lys Val Gln Tyr Leu Lys Asp Arg Gln Leu Ala Gly Ala Met Val Trp

340 345 350

Ala Leu Asp Leu Asp Asp Phe Gln Gly Ser Phe Cys Gly Gln Asp Leu

355 360 365

Arg Phe Pro Leu Thr Asn Ala Ile Lys Asp Ala Leu Ala Ala Thr

370 375 380

<210> 19

<211> 20

<212> PRT

<213> Lactobacillus

<400> 19

Met Ala Gly Asn Ser Ser Asn Phe Ile His Lys Ile Ile Lys Gln Ile

1 5 10 15

Phe Thr His Arg

20

<210> 20

<211> 7673

<212> DNA

<213> Artificial

<220>

<223> recombinant plasmid

<220>

<221> CDS

<222> (5853)..(7658)

<400> 20

gaattcggta ccccgggttc gaaggcgcca agcttcaaat tacagcacgt gttgctttga 60

ttgatagcca aaaagcagca gttgataaag caattactga tattgctgaa aaattgtaat 120

ttataaataa aaatcacctt ttagaggtgg tttttttatt tataaattat tcgtttgatt 180

tcgctttcga tagaacaatc aaagcgagaa taaggaagat aaatcccata agggcgggag 240

cagaatgtcc gagactaatt catgagatcg attttttatt aaaacgtctc aaaatcgttt 300

ctgagacgtt ttagcgttta tttcgtttag ttatcggcat aatcgttaaa acaggcgtta 360

tcgtagcgta aaagcccttg agcgtagcgt gctttgcagc gaagatgttg tctgttagat 420

tatgaaagcc gatgactgaa tgaaataata agcgcagcgt ccttctattt cggttggagg 480

aggctcaagg gagtttgagg gaatgaaatt ccctcatggg tttgatttta aaaattgctt 540

gcaattttgc cgagcggtag cgctggaaaa atttttgaaa aaaatttgga atttggaaaa 600

aaatgggggg aaaggaagcg aattttgctt ccgtactacg accccccatt aagtgccgag 660

tgccaatttt tgtgccaaaa acgctctatc ccaactggct caagggtttg aggggttttt 720

caatcgccaa cgaatcgcca acgttttcgc caacgttttt tataaatcta tatttaagta 780

gctttattgt tgtttttatg attacaaagt gatacactaa ttttataaaa ttatttgatt 840

ggagtttttt aaatggtgat ttcagaatcg aaaaaaagag ttatgatttc tctgacaaaa 900

gagcaagata aaaaattaac agatatggcg aaacaaaaag gtttttcaaa atctgcggtt 960

gcggcgttag ctatagaaga atatgcaaga aaggaatcag aataaaaaaa ataagcgaaa 1020

gctcgcgttt ttagaaggat acgagttttc gctacttgtt tttgataagg taatatatca 1080

tggctattaa atactaaagc tagaaatttt ggatttttat tatatcctga ctcaattcct 1140

aatgattgga aagaaaaatt agagagtttg ggcgtatcta tggctgtcag tcctttacac 1200

gatatggacg aaaaaaaaga taaagataca tggaatagta gtgatgttat acgaaatgga 1260

aagcactata aaaaaccaca ctatcacgtt atatatattg cacgaaatcc tgtaacaata 1320

gaaagcgtta ggaacaagat taagcgaaaa ttggggaata gttcagttgc tcatgttgag 1380

atacttgatt atatcaaagg ttcatatgaa tatttgactc atgaatcaaa ggacgctatt 1440

gctaagaata aacatatata cgacaaaaaa gatattttga acattaatga ttttgatatt 1500

gaccgctata taacacttga tgaaagccaa aaaagagaat tgaagaattt acttttagat 1560

atagtggatg actataattt ggtaaataca aaagatttaa tggcttttat tcgccttagg 1620

ggagcggagt ttggaatttt aaatacgaat gatgtaaaag atattgtttc aacaaactct 1680

agcgccttta gattatggtt tgagggcaat tatcagtgtg gatatagagc aagttatgca 1740

aaggttcttg atgctgaaac gggggaaata aaatgacaaa caaagaaaaa gagttatttg 1800

ctgaaaatga ggaattaaaa aaagaaatta aggacttaaa agagcgtatt gaaagataca 1860

gagaaatgga agttgaatta agtacaacaa tagatttatt gagaggaggg attattgaat 1920

aaataaaagc ccccctgacg aaagtcgaag ggggctttta ttttggtttg atgttgcgat 1980

taatagcaat acgattgcaa taaacaaaat gatcccctta gaagcaaact taagagtgtg 2040

ttgatagtgc attatcttaa aattttgtat aataggaatt gaagttaaat tagatgctaa 2100

aaataggaat tgaagttaaa ttagatgcta aaaatttgta attaagaagg agggattcgt 2160

catgttggta ttccaaatgc gtaatgtaga taaaacatct actgttttga aacagactaa 2220

aaacagtgat tacgcagata aataaatacg ttagattaat tcctaccagt gactaatctt 2280

atgacttttt aaacagataa ctaaaattac aaacaaatcg tttaacttca ggagagatta 2340

catgaacaaa aatataaata tctcaaactt tttaacgagt gaaaaagtac tcaaccaaat 2400

aataaaacaa ttgaatttaa aagaaaccga taccgtttac gaaattggaa caggtaaagg 2460

gcatttaacg acgaaactgg ctaaaataag taaacaggta acgtctattg aattagacag 2520

tcatctattc aacttatcgt cagaaaaatt aaaactgaat actcgtgtca ctttaattca 2580

ccaagatatt ctacagtttc aattccctaa caaacagagg tataaaattg ttgggaatat 2640

tccttacaat ttaagcacac aaattattaa aaaagtggtt tttgaaagcc gtgcgtctga 2700

catctatctg actgttgaag aaggattcta caagcgtacc ttggatattc accgaacact 2760

agggttgctc ttgcacactc aagtctcgat tcagcaattg cttaagctgc cagcggaatg 2820

ctttcatcct aaaccaaaag taaacagtgt cttaataaaa cttacccgcc ataccacaga 2880

tgttccagat aaatattgga agctatataa gtactttgtt tcaaaatggg tcaatcgaga 2940

atatcgtcaa ctgtttacta aaaatcagtt tcgtcaagca atgaaacacg ccaaagtaaa 3000

caatttaagt accattactt atgagcaagt attgtctatt tttaatagtt atctattatt 3060

taacgggagg aaataattct atgagtcgct tttttaaatt tggaaagtta cacgttacta 3120

aagggaatgg agaccggggt cgacccttca atagagttct taacgttaat ccgaaaaaaa 3180

ctaacgttaa tattaaaaaa taagatccgc ttgtgaatta tgtataattt gattagacta 3240

aagaatagga gaaagtatga tgatatttaa aaaactttct cgttaagata ggttgttggt 3300

gagcatgtta tatacggatg tatcggtttc cttaatgcaa aattttgttg ctatcttatt 3360

aatttttcta ttatatagat atattcaaag aaagataaca tttaaacgga tcatattaga 3420

tattttaata gcgattattt tttcaatatt atatctgttt atttcagatg cgtcattact 3480

tgtaatggta ttaatgcgat tagggtggca ttttcatcaa caaaaagaaa ataagataaa 3540

aacgactgat acagctaatt taattctaat tatcgtgatc cagttattgt tagttgcggt 3600

tgggactatt attagtcagt ttaccatatc gattatcaaa agtgatttca gccaaaatat 3660

attgaacaat agtgcaacag atataacttt attaggtatt ttctttgctg ttttatttga 3720

cggcttgttc tttatattat tgaagaataa gcggactgaa ttacaacatt taaatcaaga 3780

aatcattgaa ttttcgttag aaaaacaata ttttatattt atatttattt tatttatagt 3840

aatagaaatt attttagcag ttgggaatct tcaaggagta acagccacga tattattaac 3900

cattatcatt attttttgtg tccttatcgg gatgactttt tggcaagtga tgcttttttt 3960

gaaggcttat tcgattcgcc aagaagccaa tgaccaattg gtccggaatc aacaacttca 4020

agattatcta gtcaatatcg aacagcagta caccgaatta cggcgattta agcatgatta 4080

tcaaaacatc ttattatcgt tggagagttt tgccgaaaag ggcgatcagc aacagtttaa 4140

ggcgtattac caagaattat tagcacaacg gccaattcaa agtgaaatcc aaggggcagt 4200

cattgcacaa ctcgactact tgaaaaatga tcctattcga ggattagtca ttcaaaagtt 4260

tttggcagcc aaacaggctg gtgttacttt aaaattcgaa atgaccgaac caatcgaatt 4320

agcaaccgct aatctattaa cggttattcg gattatcggt attttattag acaatgcgat 4380

tgaacaagcc gttcaagaaa ccgatcaatt ggtgagttgt gctttcttac aatctgatgg 4440

tttaatcgaa attacgattg aaaatacggc cagtcaagtt aagaatctcc aagcattttc 4500

agagttaggc tattcaacga aaggcgctgg tcgggggact ggtttagcta atgtgcagga 4560

tttgattgcc aaacaaacca atttattctt agaaacacag attgaaaata gaaagttacg 4620

acagacattg atgattacgg aggaaactta atttgtatcc cgtttattta ttagaggatg 4680

atttacagca acaagcgatt tatcagcaaa ttatcgcgaa tacgattatg attaacgaat 4740

ttgcaatgac tttaacatgc gctgccagtg atactgagac attgttggcg gcaattaagg 4800

atcagcaacg aggtttattc tttttggata tggaaattga ggataaccgc caagccggtt 4860

tagaagtggc aactaagatt cggcagatga tgccgtttgc gcaaattgtc ttcattacaa 4920

cccacgagga actgacatta ttaacgttag aacgaaaaat agcgccttta gattacattc 4980

tcaaggacca aacaatggct gaaatcaaaa ggcaattgat tgatgatcta ttgttagctg 5040

agaagcaaaa cgaggcggca gcgtatcacc gagaaaattt atttagttat aaaataggtc 5100

ctcgcttttt ctcattacca ttaaaggaag ttgtttattt atatactgaa aaagaaaatc 5160

cgggtcatat taatttgtta gccgttacca gaaaggttac ttttccagga aatttaaatg 5220

cgctggaagc ccaatatcca atgctctttc ggtgtgataa aagttactta gttaacctat 5280

ctaatattgc caattatgac agtaaaacac ggagtttaaa atttgtagat ggcagtgagg 5340

caaaagtctc gttccggaaa tcacgggaac tagtggccaa attaaaacaa atgatgtagc 5400

gcctgcaggc acgccaaatg atcccagtaa aaagccaccc gcatggcggg tggcttttta 5460

ttagccctag aagggcttcc cacacgcatt tcagcgcctt agtgccttag tttgtgaatc 5520

ataggtggta tagtcccgaa atacccgtct aaggaattgt cagataggcc taatgactgg 5580

cttttataat atgagataat gccgactgta ctttttacag tcggttttct aatgtcacta 5640

acctgccccg ttagttgaag aaggttttta tattacagct ccagatctac cggtttaatt 5700

tgaaaattga tattagcgtt taacagttaa attaatacgt taataatttt tttgtcttta 5760

aatagggatt tgaagcataa tggtgttata gcgtacttag ctggccagca tatatgtatt 5820

ctataaaata ctattacaag gagattttag cc atg gta cgt cct gta gaa acc 5873

Met Val Arg Pro Val Glu Thr

1 5

cca acc cgt gaa atc aaa aaa ctc gac ggc ctg tgg gca ttc agt ctg 5921

Pro Thr Arg Glu Ile Lys Lys Leu Asp Gly Leu Trp Ala Phe Ser Leu

10 15 20

gat cgc gaa aac tgt gga att gat cag cgt tgg tgg gaa agc gcg tta 5969

Asp Arg Glu Asn Cys Gly Ile Asp Gln Arg Trp Trp Glu Ser Ala Leu

25 30 35

caa gaa agc cgg gca att gct gtg cca ggc agt ttt aac gat cag ttc 6017

Gln Glu Ser Arg Ala Ile Ala Val Pro Gly Ser Phe Asn Asp Gln Phe

40 45 50 55

gcc gat gca gat att cgt aat tat gcg ggc aac gtc tgg tat cag cgc 6065

Ala Asp Ala Asp Ile Arg Asn Tyr Ala Gly Asn Val Trp Tyr Gln Arg

60 65 70

gaa gtc ttt ata ccg aaa ggt tgg gca ggc cag cgt atc gtg ctg cgt 6113

Glu Val Phe Ile Pro Lys Gly Trp Ala Gly Gln Arg Ile Val Leu Arg

75 80 85

ttc gat gcg gtc act cat tac ggc aaa gtg tgg gtc aat aat cag gaa 6161

Phe Asp Ala Val Thr His Tyr Gly Lys Val Trp Val Asn Asn Gln Glu

90 95 100

gtg atg gag cat cag ggc ggc tat acg cca ttt gaa gcc gat gtc acg 6209

Val Met Glu His Gln Gly Gly Tyr Thr Pro Phe Glu Ala Asp Val Thr

105 110 115

ccg tat gtt att gcc ggg aaa agt gta cgt atc acc gtt tgt gtg aac 6257

Pro Tyr Val Ile Ala Gly Lys Ser Val Arg Ile Thr Val Cys Val Asn

120 125 130 135

aac gaa ctg aac tgg cag act atc ccg ccg gga atg gtg att acc gac 6305

Asn Glu Leu Asn Trp Gln Thr Ile Pro Pro Gly Met Val Ile Thr Asp

140 145 150

gaa aac ggc aag aaa aag cag tct tac ttc cat gat ttc ttt aac tat 6353

Glu Asn Gly Lys Lys Lys Gln Ser Tyr Phe His Asp Phe Phe Asn Tyr

155 160 165

gcc gga atc cat cgc agc gta atg ctc tac acc acg ccg aac acc tgg 6401

Ala Gly Ile His Arg Ser Val Met Leu Tyr Thr Thr Pro Asn Thr Trp

170 175 180

gtg gac gat atc acc gtg gtg acg cat gtc gcg caa gac tgt aac cac 6449

Val Asp Asp Ile Thr Val Val Thr His Val Ala Gln Asp Cys Asn His

185 190 195

gcg tct gtt gac tgg cag gtg gtg gcc aat ggt gat gtc agc gtt gaa 6497

Ala Ser Val Asp Trp Gln Val Val Ala Asn Gly Asp Val Ser Val Glu

200 205 210 215

ctg cgt gat gcg gat caa cag gtg gtt gca act gga caa ggc act agc 6545

Leu Arg Asp Ala Asp Gln Gln Val Val Ala Thr Gly Gln Gly Thr Ser

220 225 230

ggg act ttg caa gtg gtg aat ccg cac ctc tgg caa ccg ggt gaa ggt 6593

Gly Thr Leu Gln Val Val Asn Pro His Leu Trp Gln Pro Gly Glu Gly

235 240 245

tat ctc tat gaa ctg tgc gtc aca gcc aaa agc cag aca gag tgt gat 6641

Tyr Leu Tyr Glu Leu Cys Val Thr Ala Lys Ser Gln Thr Glu Cys Asp

250 255 260

atc tac ccg ctt cgc gtc ggc atc cgg tca gtg gca gtg aag ggc gaa 6689

Ile Tyr Pro Leu Arg Val Gly Ile Arg Ser Val Ala Val Lys Gly Glu

265 270 275

cag ttc ctg att aac cac aaa ccg ttc tac ttt act ggc ttt ggt cgt 6737

Gln Phe Leu Ile Asn His Lys Pro Phe Tyr Phe Thr Gly Phe Gly Arg

280 285 290 295

cat gaa gat gcg gac ttg cgt ggc aaa gga ttc gat aac gtg ctg atg 6785

His Glu Asp Ala Asp Leu Arg Gly Lys Gly Phe Asp Asn Val Leu Met

300 305 310

gtg cac gac cac gca tta atg gac tgg att ggg gcc aac tcc tac cgt 6833

Val His Asp His Ala Leu Met Asp Trp Ile Gly Ala Asn Ser Tyr Arg

315 320 325

acc tcg cat tac cct tac gct gaa gag atg ctc gac tgg gca gat gaa 6881

Thr Ser His Tyr Pro Tyr Ala Glu Glu Met Leu Asp Trp Ala Asp Glu

330 335 340

cat ggc atc gtg gtg att gat gaa act gct gct gtc ggc ttt aac ctc 6929

His Gly Ile Val Val Ile Asp Glu Thr Ala Ala Val Gly Phe Asn Leu

345 350 355

tct tta ggc att ggt ttc gaa gcg ggc aac aag ccg aaa gaa ctg tac 6977

Ser Leu Gly Ile Gly Phe Glu Ala Gly Asn Lys Pro Lys Glu Leu Tyr

360 365 370 375

agc gaa gag gca gtc aac ggg gaa act cag caa gcg cac tta cag gcg 7025

Ser Glu Glu Ala Val Asn Gly Glu Thr Gln Gln Ala His Leu Gln Ala

380 385 390

att aaa gag ctg ata gcg cgt gac aaa aac cac cca agc gtg gtg atg 7073

Ile Lys Glu Leu Ile Ala Arg Asp Lys Asn His Pro Ser Val Val Met

395 400 405

tgg agt att gcc aac gaa ccg gat acc cgt ccg caa ggt gca cgg gaa 7121

Trp Ser Ile Ala Asn Glu Pro Asp Thr Arg Pro Gln Gly Ala Arg Glu

410 415 420

tat ttc gcg cca ctg gcg gaa gca acg cgt aaa ctc gac ccg acg cgt 7169

Tyr Phe Ala Pro Leu Ala Glu Ala Thr Arg Lys Leu Asp Pro Thr Arg

425 430 435

ccg atc acc tgc gtc aat gta atg ttc tgc gac gct cac acc gat acc 7217

Pro Ile Thr Cys Val Asn Val Met Phe Cys Asp Ala His Thr Asp Thr

440 445 450 455

atc agc gat ctc ttt gat gtg ctg tgc ctg aac cgt tat tac gga tgg 7265

Ile Ser Asp Leu Phe Asp Val Leu Cys Leu Asn Arg Tyr Tyr Gly Trp

460 465 470

tat gtc caa agc ggc gat ttg gaa acg gca gag aag gta ctg gaa aaa 7313

Tyr Val Gln Ser Gly Asp Leu Glu Thr Ala Glu Lys Val Leu Glu Lys

475 480 485

gaa ctt ctg gcc tgg cag gag aaa ctg cat cag ccg att atc atc acc 7361

Glu Leu Leu Ala Trp Gln Glu Lys Leu His Gln Pro Ile Ile Ile Thr

490 495 500

gaa tac ggc gtg gat acg tta gcc ggg ctg cac tca atg tac acc gac 7409

Glu Tyr Gly Val Asp Thr Leu Ala Gly Leu His Ser Met Tyr Thr Asp

505 510 515

atg tgg agt gaa gag tat cag tgt gca tgg ctg gat atg tat cac cgc 7457

Met Trp Ser Glu Glu Tyr Gln Cys Ala Trp Leu Asp Met Tyr His Arg

520 525 530 535

gtc ttt gat cgc gtc agc gcc gtc gtc ggt gaa cag gta tgg aat ttc 7505

Val Phe Asp Arg Val Ser Ala Val Val Gly Glu Gln Val Trp Asn Phe

540 545 550

gcc gat ttt gcg acc tcg caa ggc ata ttg cgc gtt ggc ggt aac aag 7553

Ala Asp Phe Ala Thr Ser Gln Gly Ile Leu Arg Val Gly Gly Asn Lys

555 560 565

aaa ggg atc ttc act cgc gac cgc aaa ccg aag tcg gcg gct ttt ctg 7601

Lys Gly Ile Phe Thr Arg Asp Arg Lys Pro Lys Ser Ala Ala Phe Leu

570 575 580

ctg caa aaa cgc tgg act ggc atg aac ttc ggt gaa aaa ccg cag gga 7649

Leu Gln Lys Arg Trp Thr Gly Met Asn Phe Gly Glu Lys Pro Gln Gly

585 590 595

ggc aaa caa tgatctagac tcgag 7673

Gly Lys Gln

600

<210> 21

<211> 602

<212> PRT

<213> Artificial

<220>

<223> synthetic constructs

<400> 21

Met Val Arg Pro Val Glu Thr Pro Thr Arg Glu Ile Lys Lys Leu Asp

1 5 10 15

Gly Leu Trp Ala Phe Ser Leu Asp Arg Glu Asn Cys Gly Ile Asp Gln

20 25 30

Arg Trp Trp Glu Ser Ala Leu Gln Glu Ser Arg Ala Ile Ala Val Pro

35 40 45

Gly Ser Phe Asn Asp Gln Phe Ala Asp Ala Asp Ile Arg Asn Tyr Ala

50 55 60

Gly Asn Val Trp Tyr Gln Arg Glu Val Phe Ile Pro Lys Gly Trp Ala

65 70 75 80

Gly Gln Arg Ile Val Leu Arg Phe Asp Ala Val Thr His Tyr Gly Lys

85 90 95

Val Trp Val Asn Asn Gln Glu Val Met Glu His Gln Gly Gly Tyr Thr

100 105 110

Pro Phe Glu Ala Asp Val Thr Pro Tyr Val Ile Ala Gly Lys Ser Val

115 120 125

Arg Ile Thr Val Cys Val Asn Asn Glu Leu Asn Trp Gln Thr Ile Pro

130 135 140

Pro Gly Met Val Ile Thr Asp Glu Asn Gly Lys Lys Lys Gln Ser Tyr

145 150 155 160

Phe His Asp Phe Phe Asn Tyr Ala Gly Ile His Arg Ser Val Met Leu

165 170 175

Tyr Thr Thr Pro Asn Thr Trp Val Asp Asp Ile Thr Val Val Thr His

180 185 190

Val Ala Gln Asp Cys Asn His Ala Ser Val Asp Trp Gln Val Val Ala

195 200 205

Asn Gly Asp Val Ser Val Glu Leu Arg Asp Ala Asp Gln Gln Val Val

210 215 220

Ala Thr Gly Gln Gly Thr Ser Gly Thr Leu Gln Val Val Asn Pro His

225 230 235 240

Leu Trp Gln Pro Gly Glu Gly Tyr Leu Tyr Glu Leu Cys Val Thr Ala

245 250 255

Lys Ser Gln Thr Glu Cys Asp Ile Tyr Pro Leu Arg Val Gly Ile Arg

260 265 270

Ser Val Ala Val Lys Gly Glu Gln Phe Leu Ile Asn His Lys Pro Phe

275 280 285

Tyr Phe Thr Gly Phe Gly Arg His Glu Asp Ala Asp Leu Arg Gly Lys

290 295 300

Gly Phe Asp Asn Val Leu Met Val His Asp His Ala Leu Met Asp Trp

305 310 315 320

Ile Gly Ala Asn Ser Tyr Arg Thr Ser His Tyr Pro Tyr Ala Glu Glu

325 330 335

Met Leu Asp Trp Ala Asp Glu His Gly Ile Val Val Ile Asp Glu Thr

340 345 350

Ala Ala Val Gly Phe Asn Leu Ser Leu Gly Ile Gly Phe Glu Ala Gly

355 360 365

Asn Lys Pro Lys Glu Leu Tyr Ser Glu Glu Ala Val Asn Gly Glu Thr

370 375 380

Gln Gln Ala His Leu Gln Ala Ile Lys Glu Leu Ile Ala Arg Asp Lys

385 390 395 400

Asn His Pro Ser Val Val Met Trp Ser Ile Ala Asn Glu Pro Asp Thr

405 410 415

Arg Pro Gln Gly Ala Arg Glu Tyr Phe Ala Pro Leu Ala Glu Ala Thr

420 425 430

Arg Lys Leu Asp Pro Thr Arg Pro Ile Thr Cys Val Asn Val Met Phe

435 440 445

Cys Asp Ala His Thr Asp Thr Ile Ser Asp Leu Phe Asp Val Leu Cys

450 455 460

Leu Asn Arg Tyr Tyr Gly Trp Tyr Val Gln Ser Gly Asp Leu Glu Thr

465 470 475 480

Ala Glu Lys Val Leu Glu Lys Glu Leu Leu Ala Trp Gln Glu Lys Leu

485 490 495

His Gln Pro Ile Ile Ile Thr Glu Tyr Gly Val Asp Thr Leu Ala Gly

500 505 510

Leu His Ser Met Tyr Thr Asp Met Trp Ser Glu Glu Tyr Gln Cys Ala

515 520 525

Trp Leu Asp Met Tyr His Arg Val Phe Asp Arg Val Ser Ala Val Val

530 535 540

Gly Glu Gln Val Trp Asn Phe Ala Asp Phe Ala Thr Ser Gln Gly Ile

545 550 555 560

Leu Arg Val Gly Gly Asn Lys Lys Gly Ile Phe Thr Arg Asp Arg Lys

565 570 575

Pro Lys Ser Ala Ala Phe Leu Leu Gln Lys Arg Trp Thr Gly Met Asn

580 585 590

Phe Gly Glu Lys Pro Gln Gly Gly Lys Gln

595 600

<210> 22

<211> 22

<212> DNA

<213> Artificial

<220>

<223> PCR primer

<400> 22

gcagccttaa cagtcggcac ct 22

<210> 23

<211> 23

<212> DNA

<213> Artificial

<220>

<223> PCR primer

<400> 23

acgtgcaaca atctgcaaag cac 23

<210> 24

<211> 2999

<212> DNA

<213> Artificial

<220>

<223> pVAX vector

<400> 24

gactcttcgc gatgtacggg ccagatatac gcgttgacat tgattattga ctagttatta 60

atagtaatca attacggggt cattagttca tagcccatat atggagttcc gcgttacata 120

acttacggta aatggcccgc ctggctgacc gcccaacgac ccccgcccat tgacgtcaat 180

aatgacgtat gttcccatag taacgccaat agggactttc cattgacgtc aatgggtgga 240

ctatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc caagtacgcc 300

ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tatgcccagt acatgacctt 360

atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta ccatggtgat 420

gcggttttgg cagtacatca atgggcgtgg atagcggttt gactcacggg gatttccaag 480

tctccacccc attgacgtca atgggagttt gttttggcac caaaatcaac gggactttcc 540

aaaatgtcgt aacaactccg ccccattgac gcaaatgggc ggtaggcgtg tacggtggga 600

ggtctatata agcagagctc tctggctaac tagagaaccc actgcttact ggcttatcga 660

aattaatacg actcactata gggagaccca agctggctag cgtttaaact taagcttggt 720

accgagctcg gatccactag tccagtgtgg tggaattctg cagatatcca gcacagtggc 780

ggccgctcga gtctagaggg cccgtttaaa cccgctgatc agcctcgact gtgccttcta 840

gttgccagcc atctgttgtt tgcccctccc ccgtgccttc cttgaccctg gaaggtgcca 900

ctcccactgt cctttcctaa taaaatgagg aaattgcatc gcattgtctg agtaggtgtc 960

attctattct ggggggtggg gtggggcagg acagcaaggg ggaggattgg gaagacaata 1020

gcaggcatgc tggggatgcg gtgggctcta tggcttctac tgggcggttt tatggacagc 1080

aagcgaaccg gaattgccag ctggggcgcc ctctggtaag gttgggaagc cctgcaaagt 1140

aaactggatg gctttctcgc cgccaaggat ctgatggcgc aggggatcaa gctctgatca 1200

agagacagga tgaggatcgt ttcgcatgat tgaacaagat ggattgcacg caggttctcc 1260

ggccgcttgg gtggagaggc tattcggcta tgactgggca caacagacaa tcggctgctc 1320

tgatgccgcc gtgttccggc tgtcagcgca ggggcgcccg gttctttttg tcaagaccga 1380

cctgtccggt gccctgaatg aactgcaaga cgaggcagcg cggctatcgt ggctggccac 1440

gacgggcgtt ccttgcgcag ctgtgctcga cgttgtcact gaagcgggaa gggactggct 1500

gctattgggc gaagtgccgg ggcaggatct cctgtcatct caccttgctc ctgccgagaa 1560

agtatccatc atggctgatg caatgcggcg gctgcatacg cttgatccgg ctacctgccc 1620

attcgaccac caagcgaaac atcgcatcga gcgagcacgt actcggatgg aagccggtct 1680

tgtcgatcag gatgatctgg acgaagagca tcaggggctc gcgccagccg aactgttcgc 1740

caggctcaag gcgagcatgc ccgacggcga ggatctcgtc gtgacccatg gcgatgcctg 1800

cttgccgaat atcatggtgg aaaatggccg cttttctgga ttcatcgact gtggccggct 1860

gggtgtggcg gaccgctatc aggacatagc gttggctacc cgtgatattg ctgaagagct 1920

tggcggcgaa tgggctgacc gcttcctcgt gctttacggt atcgccgctc ccgattcgca 1980

gcgcatcgcc ttctatcgcc ttcttgacga gttcttctga attattaacg cttacaattt 2040

cctgatgcgg tattttctcc ttacgcatct gtgcggtatt tcacaccgca tacaggtggc 2100

acttttcggg gaaatgtgcg cggaacccct atttgtttat ttttctaaat acattcaaat 2160

atgtatccgc tcatgagaca ataaccctga taaatgcttc aataatagca cgtgctaaaa 2220

cttcattttt aatttaaaag gatctaggtg aagatccttt ttgataatct catgaccaaa 2280

atcccttaac gtgagttttc gttccactga gcgtcagacc ccgtagaaaa gatcaaagga 2340

tcttcttgag atcctttttt tctgcgcgta atctgctgct tgcaaacaaa aaaaccaccg 2400

ctaccagcgg tggtttgttt gccggatcaa gagctaccaa ctctttttcc gaaggtaact 2460

ggcttcagca gagcgcagat accaaatact gtccttctag tgtagccgta gttaggccac 2520

cacttcaaga actctgtagc accgcctaca tacctcgctc tgctaatcct gttaccagtg 2580

gctgctgcca gtggcgataa gtcgtgtctt accgggttgg actcaagacg atagttaccg 2640

gataaggcgc agcggtcggg ctgaacgggg ggttcgtgca cacagcccag cttggagcga 2700

acgacctaca ccgaactgag atacctacag cgtgagctat gagaaagcgc cacgcttccc 2760

gaagggagaa aggcggacag gtatccggta agcggcaggg tcggaacagg agagcgcacg 2820

agggagcttc cagggggaaa cgcctggtat ctttatagtc ctgtcgggtt tcgccacctc 2880

tgacttgagc gtcgattttt gtgatgctcg tcaggggggc ggagcctatg gaaaaacgcc 2940

agcaacgcgg cctttttacg gttcctgggc ttttgctggc cttttgctca catgttctt 2999

<210> 25

<211> 347

<212> DNA

<213> Artificial

<220>

<223> insert fragment

<400> 25

gctagcatgg acgccaaggt cgtcgccgtg ctggccctgg tgctggccgc gctctgcatc 60

agtgacggta aaccagtcag cctgagctac cgatgcccct gccggttctt cgagagccac 120

atcgccagag ccaacgtcaa gcatctgaaa atcctcaaca ctccaaactg tgcccttcag 180

attgttgcac ggctgaagaa caacaacaga caagtgtgca ttgacccgaa attaaagtgg 240

atccaagagt acctggagaa agccttaaac aagggatcag gtgccacgaa cttctctctg 300

ttaaagcaag caggagacgt ggaagaaaac cccggtccca aaagctt 347

<210> 26

<211> 5395

<212> DNA

<213> Artificial

<220>

<223> vector

<400> 26

gactcttcgc gatgtacggg ccagatatac gcgttgacat tgattattga ctagttatta 60

atagtaatca attacggggt cattagttca tagcccatat atggagttcc gcgttacata 120

acttacggta aatggcccgc ctggctgacc gcccaacgac ccccgcccat tgacgtcaat 180

aatgacgtat gttcccatag taacgccaat agggactttc cattgacgtc aatgggtgga 240

ctatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc caagtacgcc 300

ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tatgcccagt acatgacctt 360

atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta ccatggtgat 420

gcggttttgg cagtacatca atgggcgtgg atagcggttt gactcacggg gatttccaag 480

tctccacccc attgacgtca atgggagttt gttttggcac caaaatcaac gggactttcc 540

aaaatgtcgt aacaactccg ccccattgac gcaaatgggc ggtaggcgtg tacggtggga 600

ggtctatata agcagagctc tctggctaac tagagaaccc actgcttact ggcttatcga 660

aattaatacg actcactata gggagaccca agctggctag cgtttaaact taagcttcgc 720

caccatggag agcgacgaga gcggcctgcc cgccatggag atcgagtgcc gcatcaccgg 780

caccctgaac ggcgtggagt tcgagctggt gggcggcgga gagggcaccc ccaagcaggg 840

ccgcatgacc aacaagatga agagcaccaa aggcgccctg accttcagcc cctacctgct 900

gagccacgtg atgggctacg gcttctacca cttcggcacc taccccagcg gctacgagaa 960

ccccttcctg cacgccatca acaacggcgg ctacaccaac acccgcatcg agaagtacga 1020

ggacggcggc gtgctgcacg tgagcttcag ctaccgctgc gaggccggcc gcgtgatcgg 1080

cgacttcaag gtggtgggca ccggcttccc cgaggacagc gtgatcttca ccgacaagat 1140

catccgcagc aacgccaccg tggagcacct gcaccccatg ggcgataacg tgctggtggg 1200

cagcttcgcc cgcaccttca gcctgcgcga cggcggctac cacagcttcg tggtggacaa 1260

ccacatgcac ttcaagagcg ccatccaccc cagcatcctg cagaacgggg gccccatgtt 1320

cgccttccgc cgcgtggagg agctgcacag caacaccgag ctgggcatcg tggagtacca 1380

gcacgccttc aagaccccca tcgccttcgc cagatcccgc gctcagtcgt ccaattctgc 1440

cgtggacggc accgccggac ccggctccac cggatctcgc gagggcagag gaagtcttct 1500

aacatgcggt gacgtggagg agaatcccgg ccctatggaa gatgccaaaa acattaagaa 1560

gggcccagcg ccattctacc cactcgaaga cgggaccgcc ggcgagcagc tgcacaaagc 1620

catgaagcgc tacgccctgg tgcccggcac catcgccttt accgacgcac atatcgaggt 1680

ggacattacc tacgccgagt acttcgagat gagcgttcgg ctggcagaag ctatgaagcg 1740

ctatgggctg aatacaaacc atcggatcgt ggtgtgcagc gagaatagct tgcagttctt 1800

catgcccgtg ttgggtgccc tgttcatcgg tgtggctgtg gccccagcta acgacatcta 1860

caacgagcgc gagctgctga acagcatggg catcagccag cccaccgtcg tattcgtgag 1920

caagaaaggg ctgcaaaaga tcctcaacgt gcaaaagaag ctaccgatca tacaaaagat 1980

catcatcatg gatagcaaga ccgactacca gggcttccaa agcatgtaca ccttcgtgac 2040

ttcccatttg ccacccggct tcaacgagta cgacttcgtg cccgagagct tcgaccggga 2100

caaaaccatc gccctgatca tgaacagtag tggcagtacc ggattgccca agggcgtagc 2160

cctaccgcac cgcaccgctt gtgtccgatt cagtcatgcc cgcgacccca tcttcggcaa 2220

ccagatcatc cccgacaccg ctatcctcag cgtggtgcca tttcaccacg gcttcggcat 2280

gttcaccacg ctgggctact tgatctgcgg ctttcgggtc gtgctcatgt accgcttcga 2340

ggaggagcta ttcttgcgca gcttgcaaga ctataagatt caatctgccc tgctggtgcc 2400

cacactattt agcttcttcg ctaagagcac tctcatcgac aagtacgacc taagcaactt 2460

gcacgagatc gccagcggcg gggcgccgct cagcaaggag gtaggtgagg ccgtggccaa 2520

acgcttccac ctaccaggca tccgccaggg ctacggcctg acagaaacaa ccagcgccat 2580

tctgatcacc cccgaagggg acgacaagcc tggcgcagta ggcaaggtgg tgcccttctt 2640

cgaggctaag gtggtggact tggacaccgg taagacactg ggtgtgaacc agcgcggcga 2700

gctgtgcgtc cgtggcccca tgatcatgag cggctacgtt aacaaccccg aggctacaaa 2760

cgctctcatc gacaaggacg gctggctgca cagcggcgac atcgcctact gggacgagga 2820

cgagcacttc ttcatcgtgg accggctgaa gagcctgatc aaatacaagg gctaccaggt 2880

agccccagcc gaactggaga gcatcctgct gcaacacccc aacatcttcg acgccggggt 2940

cgccggcctg cccgacgacg atgccggcga gctgcccgcc gcagtcgtcg tgctggaaca 3000

cggtaaaacc atgaccgaga aggagatcgt ggactatgtg gccagccagg ttacaaccgc 3060

caagaagctg cgcggtggtg ttgtgttcgt ggacgaggtg cctaaaggac tgaccggcaa 3120

gttggacgcc cgcaagatcc gcgagattct cattaaggcc aagaagggcg gcaagatcgc 3180

cgtgtaatct agagggcccg tttaaacccg ctgatcagcc tcgactgtgc cttctagttg 3240

ccagccatct gttgtttgcc cctcccccgt gccttccttg accctggaag gtgccactcc 3300

cactgtcctt tcctaataaa atgaggaaat tgcatcgcat tgtctgagta ggtgtcattc 3360

tattctgggg ggtggggtgg ggcaggacag caagggggag gattgggaag acaatagcag 3420

gcatgctggg gatgcggtgg gctctatggc ttctactggg cggttttatg gacagcaagc 3480

gaaccggaat tgccagctgg ggcgccctct ggtaaggttg ggaagccctg caaagtaaac 3540

tggatggctt tctcgccgcc aaggatctga tggcgcaggg gatcaagctc tgatcaagag 3600

acaggatgag gatcgtttcg catgattgaa caagatggat tgcacgcagg ttctccggcc 3660

gcttgggtgg agaggctatt cggctatgac tgggcacaac agacaatcgg ctgctctgat 3720

gccgccgtgt tccggctgtc agcgcagggg cgcccggttc tttttgtcaa gaccgacctg 3780

tccggtgccc tgaatgaact gcaagacgag gcagcgcggc tatcgtggct ggccacgacg 3840

ggcgttcctt gcgcagctgt gctcgacgtt gtcactgaag cgggaaggga ctggctgcta 3900

ttgggcgaag tgccggggca ggatctcctg tcatctcacc ttgctcctgc cgagaaagta 3960

tccatcatgg ctgatgcaat gcggcggctg catacgcttg atccggctac ctgcccattc 4020

gaccaccaag cgaaacatcg catcgagcga gcacgtactc ggatggaagc cggtcttgtc 4080

gatcaggatg atctggacga agagcatcag gggctcgcgc cagccgaact gttcgccagg 4140

ctcaaggcga gcatgcccga cggcgaggat ctcgtcgtga cccatggcga tgcctgcttg 4200

ccgaatatca tggtggaaaa tggccgcttt tctggattca tcgactgtgg ccggctgggt 4260

gtggcggacc gctatcagga catagcgttg gctacccgtg atattgctga agagcttggc 4320

ggcgaatggg ctgaccgctt cctcgtgctt tacggtatcg ccgctcccga ttcgcagcgc 4380

atcgccttct atcgccttct tgacgagttc ttctgaatta ttaacgctta caatttcctg 4440

atgcggtatt ttctccttac gcatctgtgc ggtatttcac accgcataca ggtggcactt 4500

ttcggggaaa tgtgcgcgga acccctattt gtttattttt ctaaatacat tcaaatatgt 4560

atccgctcat gagacaataa ccctgataaa tgcttcaata atagcacgtg ctaaaacttc 4620

atttttaatt taaaaggatc taggtgaaga tcctttttga taatctcatg accaaaatcc 4680

cttaacgtga gttttcgttc cactgagcgt cagaccccgt agaaaagatc aaaggatctt 4740

cttgagatcc tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa ccaccgctac 4800

cagcggtggt ttgtttgccg gatcaagagc taccaactct ttttccgaag gtaactggct 4860

tcagcagagc gcagatacca aatactgtcc ttctagtgta gccgtagtta ggccaccact 4920

tcaagaactc tgtagcaccg cctacatacc tcgctctgct aatcctgtta ccagtggctg 4980

ctgccagtgg cgataagtcg tgtcttaccg ggttggactc aagacgatag ttaccggata 5040

aggcgcagcg gtcgggctga acggggggtt cgtgcacaca gcccagcttg gagcgaacga 5100

cctacaccga actgagatac ctacagcgtg agctatgaga aagcgccacg cttcccgaag 5160

ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg aacaggagag cgcacgaggg 5220

agcttccagg gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc cacctctgac 5280

ttgagcgtcg atttttgtga tgctcgtcag gggggcggag cctatggaaa aacgccagca 5340

acgcggcctt tttacggttc ctgggctttt gctggccttt tgctcacatg ttctt 5395