检测1型、3型鸭甲型肝炎病毒和鸭坦布苏病毒的引物及应用

Primer for detecting 1 type and 3 type duck hepatitis A virus and duck tembusu virus and application

文档序号：3430 发布日期：2021-09-17 浏览：31次中文

1. A primer for detecting type 1 and type 3 duck hepatitis A virus and duck tembusu virus is characterized in that the primer sequence is as follows:

DHAV-1 F GGTGCAAGGGACCAGAAG，SEQ ID NO.1；

DHAV-1 R GTACCTGCGGACCAACAG，SEQ ID NO.2；

DHAV-3 F AAGGAAGTTCTTGAAGGCAA，SEQ ID NO.3；

DHAV-3 R CGAAAGTGGAGATTAGGTGT，EQ ID NO.4；

DTMUV F TTGCTGCCATTTTCATAGGC，SEQ ID NO.5；

DTMUV R ACCCCTGTCCACAAAATCTT，SEQ ID NO.6。

2. the kit for detecting the duck hepatitis A virus type 1 and 3 and the duck Tembusu virus primer according to claim 1, wherein the kit comprises:

The PCR reaction solution contains 10 XPCR buffer, 10mM dNTPs, rTaq DNA polymerase and reaction primers: DHAV-1F, DHAV-1R, DHAV-3F, DHAV-3R, DTMUV F, DTMUV R;

DHAV-1+ DHAV-3+ DTMUV template; ddH₂O。

3. A detection method based on the kit of claim 2, which comprises the following steps:

(1) the cDNA template reverse transcribed in the step (1) is amplified by DHAV-1F, DHAV-1R, DHAV-3F, DHAV-3R, DTMUV F and DTMUV R primers, DHAV-1+ DHAV-3+ DTMUV positive template is amplified as a positive control, ddH is used as a positive control₂O template as negative control;

(2) after the PCR product is subjected to electrophoresis, the condition that the sample carries the virus is judged through a specific amplification band.

4. The detection method of the kit according to claim 3, wherein the reaction system is: 50 μ L, 10 XPCR buffer4 μ L, dNTPs 3.5 μ L (10mM), rTaq DNA polymerase

mu.L (200U/. mu.L), reaction primers DHAV-1F, DHAV-1R, DHAV-3F, DHAV-3R, DTMUV F and DTMUV R all at a final concentration of 1. mu.M/mL, and templates each at 1. mu.L (10 ng/. mu.L).

5. The detection method of the kit according to claim 3, wherein the amplification reaction conditions are: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 40s, annealing at 54-56 ℃ for 40s, extension at 72 ℃ for 60s, and 35 cycles; final extension at 72 ℃ for 10min and storage at 4 ℃.

Background

Duck Viral Hepatitis (DVH) is an acute, highly contagious, lethal infectious disease of duckling-is virus (DHV) caused by Duckling Hepatitis Virus (DHV) in 3 weeks of age. At present, the main pathogens which have been identified to cause duck hepatitis are Duck Hepatitis A Virus (DHAV) and duck astrovirus (DAstV). DHAV is divided into 3 types, DHAV 1 (DHAV-1), DHAV 2 (DHAV-2), and DHAV 3 (DHAV-3). Wherein DHAV-1 and DHAV-3 are prevalent in the mainland China and can be used for singly or mixedly infecting ducklings.

Duck tembusu virus (DTMUV), also called duck flavivirus, is a new acute infectious disease of ducks which successively outbreaks in Fujian, Shandong, Zhejiang, Shanghai, Jiangsu, Guangxi and other places in main breeding ducks and laying duck breeding areas in China since 4 months in 2010 and has the main clinical characteristics of sudden and large reduction of egg laying of laying ducks and breeding ducks and the main pathological change characteristics of hemorrhagic ovaritis. As the disease is a new infectious disease, the disease still is an important epidemic disease which endangers the duck breeding industry at present.

DTMUV can infect poultry and other birds, the virus-infected duckling presents some clinical symptoms and pathological changes similar to DVH, when the 2 or more than 2 viruses are mixed to infect, accurate judgment is difficult to make in clinical diagnosis, the conventional diagnosis method (such as pathogen separation identification, serological test and the like) is complex in operation, time-consuming and labor-consuming, differential diagnosis is difficult to carry out, single heavy molecule detection is difficult, and when the number of samples is large, the operation is complex and error is easy to make; however, the multiplex molecular detection is easy to interfere with each other among different primers.

Therefore, how to provide a method for rapidly and sensitively detecting the duck hepatitis A virus 1 and the duck Tembusu virus 3 and the duck Tembusu virus is a problem to be solved in the field.

Disclosure of Invention

The invention discloses a primer for detecting duck hepatitis A virus type 1 and duck Tembusu virus type 3 and application thereof.

In order to achieve the purpose, the invention adopts the following technical scheme:

a primer for detecting duck hepatitis A virus type 1 and duck Tembusu virus type 3 has the following sequences:

DHAV-1 F GGTGCAAGGGACCAGAAG，SEQ ID NO.1；

DHAV-1 R GTACCTGCGGACCAACAG，SEQ ID NO.2；

DHAV-3 F AAGGAAGTTCTTGAAGGCAA，SEQ ID NO.3；

DHAV-3 R CGAAAGTGGAGATTAGGTGT，EQ ID NO.4；

DTMUV F TTGCTGCCATTTTCATAGGC，SEQ ID NO.5；

DTMUV R ACCCCTGTCCACAAAATCTT，SEQ ID NO.6；

a kit based on duck hepatitis A virus type 1 and duck Tembusu virus type 3 primers comprises:

the PCR reaction solution contains 10 XPCR buffer, 10mM dNTPs, rTaq DNA polymerase and reaction primers: DHAV-1F, DHAV-1R, DHAV-3F, DHAV-3R, DTMUV F, DTMUV R;

DHAV-1+ DHAV-3+ DTMUV template; ddH₂O

A detection method of a kit based on duck hepatitis A virus 1 and duck Tembusu virus 3 primers comprises the following steps:

(1) the cDNA template reverse transcribed in the step (1) is amplified by DHAV-1F, DHAV-1R, DHAV-3F, DHAV-3R, DTMUV F and DTMUV R primers, DHAV-1+ DHAV-3+ DTMUV template is used as a positive control, ddH is used as a positive control₂O template as negative control;

(2) after the PCR product is subjected to electrophoresis, the condition that the sample carries the virus is judged through a specific amplification band.

The reaction system is as follows: 50 uL, wherein the final concentration of 10 XPCR buffer is 4 uL, dNTPs is 3.5 uL (10mM), rTaq DNA polymerase is 0.8 uL (200U/. mu.L), reaction primers DHAV-1F, DHAV-1R, DHAV-3F, DHAV-3R, DTMUV F and DTMUV R are all 1 uM/mL, and the template;

Preferably, the concentration of dNTPs is 0.7 mM;

preferably, rTaq DNA polymerase is 0.8. mu.L;

the amplification reaction conditions are as follows: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 40s, annealing at 54-56 ℃ for 40s, extension at 72 ℃ for 60s, and 35 cycles; final extension at 72 ℃ for 10min and storage at 4 ℃.

Preferably, the annealing temperature is 55 ℃.

In conclusion, aiming at the lack of a reliable technology for simultaneously detecting the duck hepatitis A virus type 1 and the duck Tembusu virus type 3 and the duck Tembusu virus, the inventor researches and designs three pairs of specific primers, establishes a triple RT-PCR detection method for the duck hepatitis A virus type 1 and the duck Tembusu virus type 3 and the duck Tembusu virus, can be used for detecting the pollution conditions of the duck hepatitis A virus type 1 and the duck Tembusu virus type 3 and the duck Tembusu virus in a sample, and prepares a corresponding detection kit. The invention has the advantages of simple operation, high sensitivity, strong specificity and good repeatability, and overcomes the mutual interference between multiple PCR pairs of primers.

Drawings

FIG. 1: triple PCR primer concentration optimization test results electropherogram, M: marker I600 bp; 1-4: DHAV-1/DHAV-3/DTMUV primers 0.25. mu.L, 0.5. mu.L, 0.75. mu.L, 1. mu.L; NC: negative control;

FIG. 2: triple PCR rTaq DNA polymerase concentration optimization assay results electropherogram, M: marker I600 bp; 1-5: rTaq 0.2. mu.L, 0.4. mu.L, 0.6. mu.L, 0.8. mu.L, 1.0. mu.L; NC: negative control;

FIG. 3: electrophoresis chart of triple PCR dNTPS concentration optimization test result, M: marker I600 bp; 1-4: dNTPS 1.5. mu.L, 2.5. mu.L, 3.5. mu.L, 4.5. mu.L; NC: negative control;

FIG. 4: triple PCR annealing temperature optimization test results electropherogram, M: marker I600 bp; 1: 51 ℃; 2: 52 ℃; 3: at 53 ℃; 4: at 54 ℃; 5: 55 ℃; 6: 56 ℃; 7: 57 ℃; 7: at 58 ℃; NC: negative control;

FIG. 5: results of triple PCR specificity experiments electrophorogram, M: marker I600 bp; 1: type 3 duck hepatitis A virus cDNA; 2: type 1 duck hepatitis a virus cDNA; 3: duck tembusu virus cDNA; 4: type 3 duck hepatitis A virus cDNA + type 1 duck hepatitis A virus cDNA + duck Tembusu virus cDNA; 5: newcastle disease virus cDNA; 6: avian influenza virus cDNA; 7: reovirus cDNA; 8: e.coli DNA; NC: negative control;

FIG. 6: results of triple PCR sensitivity experiments electrophoretogram, M: marker I600 bp; 1-8:

10ng, 1ng, 100pg, 10pg, 1pg, 100fg, 10fg, 1fg of cDNA of DHAV-1/DHAV-3/DTMUV; NC: negative control;

FIG. 7: electrophoresis chart of detection result of artificial mixed infection separated disease sample, M: DL2000 Marker; 1: DHAV-3+ DTMUV; 2: DHAV-1+ DTMUV; 3: DHAV-1+ DHAV-3; 4: DHAV-1+ DHAV-3+ DTMUV; NC: negative control;

Detailed Description

The technical solutions in the embodiments of the present invention are clearly and completely described below, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Example 1

Extraction of nucleic acid and reverse transcription of RNA

Extracting RNA of duck hepatitis A virus type 1 (DHAV-1, GX050028), duck hepatitis A virus type 3 (DHAV-3, GXNN201201), duck tembusu virus (DTMUV, GXD0915), duck paramyxovirus (NDV), Avian Influenza Virus (AIV) and Avian Reovirus (ARV) according to an operation instruction method of an RNA extraction kit (purchased from Beijing Tiangen Biochemical Co., Ltd.), carrying out Reverse transcription according to a Reverse transcriptase M-ML V (RNaseH-) [ purchased from Bao bioengineering (Dalian) Co., Ltd.) Reverse transcription instruction to obtain cDNA of the viruses, wherein the volume is 25 mu L, and the reaction system is as follows: 5 XBuffer 5 uL, dNTP (10mM)2 uL, random Primer (Randon Primer)1 uL, reverse transcriptase (M-MLV, 200U/. mu.L) 1 uL, Inhibitor (RNase Inhibitor)0.5 uL, and RNA extract 15.5 uL. Placing the system in a water bath kettle at 42 deg.C for 70min to obtain cDNA, and storing at-20 deg.C. And extracting the Escherichia coli DNA according to the operation instruction of the DNA extraction kit for later use.

Example 2

Establishment of one-and three-fold RT-PCR amplification system

1. Optimization of reaction systems

Concentration gradients (as shown in table 1) are set for the primer concentration, rTaq DNA polymerase concentration and dNTPs concentration in the reaction system respectively, and a PCR instrument program gradient is used for optimization and searching for the optimal ratio.

TABLE 1

Finally determining the reaction system of the triple RT-PCR to be 50 mu L: 10 XPCR buffer 4. mu.L, 10mM dNTPs 3.5. mu.L, rTaq DNA polymerase 0.8. mu.L (200U/. mu.L), DHAV-1 upstream and downstream primers 1. mu.L each (primer concentration is 50. mu.M/mL, final concentration in the reaction system is 1. mu.M/mL), DHAV-3 upstream and downstream primers 1. mu.L each (primer concentration is 50. mu.M/mL, final concentration in the reaction system is 1. mu.M/mL), and DTMUV upstream and downstream primersmu.L each (primer concentration 50. mu.M/mL, final concentration in the reaction system 1. mu.M/mL), plus ddH₂O to 50. mu.L. The optimization results of the primers, rTaq DNA polymerase and dNTPs are respectively shown in figure 1, figure 2 and figure 3, and finally the optimal primer content, the optimal rTaq DNA polymerase content and the optimal dNTPs (10mM) content of the system are all determined to be 1 muL, 0.8 muL and 3.5 muL respectively.

2. Optimization of reaction conditions

According to the reaction system, a single-factor test is carried out at annealing temperatures with gradient (51 ℃, 52 ℃, 53 ℃, 54 ℃, 55 ℃, 56 ℃, 57 ℃ and 58 ℃) to search for the optimal annealing temperature, the template is a mixture of cDNA of type 1 duck hepatitis A virus, cDNA of type 3 duck hepatitis A virus and cDNA of duck Tembusu virus with equal volume, the annealing temperatures are sequentially increased by 51.0-58.0 ℃ and repeated for 3 times. As a result, as shown in FIG. 4, it can be seen that the optimum annealing temperature was 55.0 ℃. Determining the optimal reaction conditions: 4min at 94 ℃; annealing at 94 ℃ for 40s and 55 ℃ for 40s and at 72 ℃ for 1min for 35 cycles; preserving at 72 deg.C for 10min and 4 deg.C.

3. Preparation of detection kit

Preparing a detection kit according to an optimized experiment result:

solution A: the PCR reaction solution contained 10 XPCR buffer 4. mu. L, dNTPs 3.5.5. mu.L (10mM), rTaq DNA polymerase 0.8. mu.L (200U/. mu.L), 1. mu.L each of DHAV-1 upstream and downstream primers (the concentrations of the primers were 50. mu.M/mL, the final concentrations in the reaction system were 1. mu.M/mL), 1. mu.L each of DHAV-3 upstream and downstream primers (the concentrations of the primers were 50. mu.M/mL, the final concentrations in the reaction system were 1. mu.M/mL), 1. mu.L each of DTMUV upstream and downstream primers (the concentrations of the primers were 50. mu.M/mL, the final concentrations in the reaction system were 1. mu.M/mL), and ddH₂O 35.7μL；

And B, liquid B: DHAV-1+ DHAV-3+ DTMUV template as positive control;

and C, liquid C: ddH₂O, as a negative control.

Two and three RT-PCR specificity test

Using the detection kit, triple PCR amplification was performed on different templates respectively [ template: type 3 duck hepatitis A virus cDNA, type 1 duck hepatitis A virus cDNA, duck tembusu virus cDNA, type 3 duck hepatitis A virus cDNA + type 1 duck hepatitis A virus cDNA + duck tembusu virus cDNA (mixed with equal volume), Newcastle disease virus cDNA, avian influenza virus cDNA, reovirus cDNA, Escherichia coli DNA, negative control ]. As a result, as shown in FIG. 5, it was found that 1-4 had 523bp, 395bp, and 201bp of the target fragment, and the rest had no target fragment. The primers and the method have high specificity, and can be used for identifying whether an unknown sample is infected with the type 3 duck hepatitis A virus, the type 1 duck hepatitis A virus and the duck Tembusu virus: if a 523bp band appears, the sample contains the type 3 duck hepatitis A virus, otherwise, the sample does not contain the type 3 duck hepatitis A virus; if the 395bp band appears, the sample contains duck tembusu virus, otherwise, the sample does not contain duck tembusu virus; if the 201bp band appears, the sample contains the duck hepatitis A virus type 1, otherwise, the sample does not contain the duck hepatitis A virus type 1. For mixed infections, judgment can be made according to the target band as well.

Three, three-fold RT-PCR sensitivity test

The concentrations of nucleic acids of type 1 duck hepatitis A virus, type 3 duck hepatitis A virus and duck Tembusu virus are measured by a DU800 ultraviolet spectrophotometer, and then are respectively diluted by 10 times of gradient to obtain DHAV-1/DHAV-3/DTMUV cDNA of 10ng, 1ng, 100pg, 10pg, 1pg, 100fg, 10fg and 1fg, and the sample is subjected to triple amplification by using a detection kit. As shown in FIG. 6, it was found that 1 to 5 target fragments were amplified, the detection limit of the kit for DHAV-3 nucleic acid was 10pg, the detection limit for DTMUV nucleic acid was 10pg, and the detection limit for DHAV-1 nucleic acid was 100 pg.

Example 4

Triple RT-PCR detection of virus infection samples

4 artificial virus infection samples are respectively as follows: type 3 duck hepatitis A virus + duck Tembusu virus, type 1 duck hepatitis A virus + duck Tembusu virus, type 3 duck hepatitis A virus + type 1 duck hepatitis A virus, type 1 duck hepatitis A virus + type 3 duck hepatitis A virus + duck Tembusu virus. Respectively treating virus samples obtained from the pathological materials, extracting total RNA of respective viruses, performing reverse transcription to form a cDNA template, and performing amplification operation by using the kit, wherein the amplification result is shown in FIG. 7, and expected amplification bands can be detected.

The embodiments in the present description are described in a progressive manner, each embodiment focuses on differences from other embodiments, and the same and similar parts among the embodiments are referred to each other.

The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to the above-described embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Sequence listing

<110> Guangxi university

Liuzhou Liubei District Animal Disease Prevention and Control Center

<120> primers for detecting Duck Hepatitis A Virus (DHAV) 1 and duck Tembusu virus (DHAV) 3 and application thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 18

<212> DNA