1. A kit for detecting avian infectious laryngotracheitis virus is characterized by comprising AILTV-reaction liquid, DNase mixed liquid, AILTV-internal standard, AILTV-positive control and AILTV-negative control;

the AILTV-reaction solution comprises PCR-Buffer, dNTP, a primer probe, an internal standard primer and an internal standard probe;

the dNTPs include dATP, dUTP, dGTP and dCTP;

the primer comprises:

the sequence of the upstream primer is 5'-CATCAACTTGAACGCCACT-3';

the sequence of the downstream primer is 5'-CCAGTATCTCTGAGTTCCTCG-3';

the primer probe is 5 '-Fam-ATACTTCGACGGGCACAAAGTCC-BHQ 1-3', Fam is a reporter fluorophore, and BHQ1 is a quenching fluorophore;

the internal standard primer comprises:

an internal standard upstream primer with the sequence of 5'-CATAGTTGGACCGCTAGGA-3',

an internal standard downstream primer with the sequence of 5'-GAAAGGTCCCGCAAAGAGT-3',

the internal standard probe is 5 '-Hex-CCGGTGATAAACCTTTGGACCCT-BHQ 1-3', Hex is a report fluorescent group, and BHQ1 is a quenching fluorescent group.

2. The kit for detecting avian infectious laryngotracheitis virus of claim 1, wherein the dnase mixed solution comprises enzyme diluent, hot start Taq enzyme and UNG enzyme.

3. The kit for detecting avian infectious laryngotracheitis virus of claim 1, wherein said AILTV-internal standard is a recombinant plasmid linked with a random internal standard nucleotide sequence at a concentration of 1.0 x 10³～2.0×10³copies/. mu.L, random internal standard nucleotide sequence:

CTGGAGACTGAGGGTTGACGCGCATTCGTCATTGAACGCAGACACGGCTGAGAGAACATGGAGCGACTGCACTGCACTTGGTCGATCTGATTAGGAGTGGGGTTTATGCCCGCGGCTTATCCCCCTATCCTTGCGACACGGGAGAAGACAGATTGTCATCGATTTCGCAAGCCATGATATGTTTGGCCCGACCAACCGCGTTTTTCTCGCGCTTGGATAACGACCTATGGTGTGGACAGTGGCTTAGAGGACATGACACGACGGGCTGAAAGTATGTGGTGCTGGGGCCCTTAGATAGCTGCATAGTTGGACCGCTAGGAATTATATCAATTCGAGATCTCCAGCCGACAAAGTAGGCTCCTAACTAACAGGGTCCAAAGGTTTATCACCGGTCCTTACTCTTTGCGGGACCTTTCTACCCATACAATATCGTCCTCCGATGATGGATCACGGAG。

4. the kit for detecting the avian infectious laryngotracheitis virus of claim 1, wherein the AILTV-positive control is a recombinant plasmid connected with a target nucleotide sequence, the Ct value is 17.0-41.0, and the target nucleotide sequence is: CATCAACTTGAACGCCACTATACTAGAAGATTTGGACTTTGTGCCCGTCGAAGTATACACTCGCGAGGAACTCAGAGATACTGG are provided.

5. The kit for detecting avian infectious laryngotracheitis virus of claim 1, wherein the AILTV-negative control is DEPC H₂TE buffer prepared from O.

6. The kit for detecting the avian infectious laryngotracheitis virus of claim 1, wherein the contents of the components are as follows:

7. a detection method for detecting avian infectious laryngotracheitis virus is characterized by comprising the following steps,

(1) collecting a sample;

(2) sample pretreatment;

(3) preparing an amplification reagent: taking out the components except the DNA enzyme mixed solution, standing at room temperature, and shaking and mixing uniformly for later use after the components are completely dissolved; taking corresponding amount of reagent according to a proportion, fully and uniformly mixing the reagent into PCR-Mix, and centrifuging;

(4) sample adding: adding PCR mix and a sample into each reaction tube, centrifuging, and transferring to an amplification area;

(5) performing amplification on the machine: placing the PCR reaction tube into a sample groove of an amplification instrument, and arranging a negative control, a positive control and a sample to be detected in a corresponding sequence; selecting a FAM channel to detect avian infectious laryngotracheitis virus nucleic acid; selecting an HEX channel detection internal standard; the cycle parameters were set as follows:

(6) analyzing and judging results: after the reaction procedure is completed, recording the Ct value and the amplification curve of the sample; the Ct value of the AILTV-negative control HEX channel is less than or equal to 35, and the FAM channel does not report the Ct value; the Ct value of the AILTV-positive control HEX channel is less than or equal to 35, and the Ct value of the FAM channel is less than or equal to 35; the HEX channel Ct value is less than or equal to 35 and the FAM channel Ct value is less than or equal to 35 in the detection result of the detected sample, and the result is reported as positive AILTV nucleic acid; the HEX channel Ct value in the detection result of the detected sample is less than or equal to 35, the FAM channel Ct value is greater than 40 or no report Ct value, and the report is AILTV nucleic acid negative; the HEX channel Ct value is less than or equal to 35 and the FAM channel Ct value is less than or equal to 40 in the detection result of the detected sample, the report is suspicious, and the detection is carried out again, if the Ct value is not detected again, the report reports that the nucleic acid detection of AILTV is negative, otherwise, the detection is positive; and if the FAM channel Ct value in the detection result of the detected sample is greater than 40 or no report Ct value and the HEX channel Ct value is greater than 35, the detection result of the sample is invalid, the reason should be searched and eliminated, and the sample is subjected to repeated experiments.

Background

Avian Infectious Laryngotracheitis (AILT) is an acute and highly infectious viral disease which seriously affects the poultry industry worldwide and is caused by Avian infectious laryngotracheitis virus (AILTV) infection, the morbidity can reach 90-100 percent, and the mortality rate is 5-50 percent. The disease was originally reported in the united states in 1925 and veterinarians originally named this disease as avian diphtheria, with the name of AILT adopted in 1931 by the american veterinary association poultry disease special committee.

AILT is a highly contagious upper respiratory disease of chickens, AILTV is also called avian herpes virus type I ((GaHV-1)), and belongs to the genus Iltovirus, the alphaherpesviridae subfamily of herpesviridae. The genome of AILTV comprises a linear double-stranded DNA of 150-155kb encoding a unique long sequence (UL), a unique short sequence (US) and two Inverted Repeats (IR). AILTV appears under electron microscopy as a typical herpes virus particle, spherical in shape and with icosahedral stereosymmetry, with a DNA core within an icosahedral capsid surrounded by a coat layer and an outer envelope glycoprotein. The diameter of the viral capsid is about 100nm, and the diameter of the complete virus is within the range of 200-350 nm. The AILTV genome consists of 80 Open Reading Frames (ORFs). Of these, 65 are located in the UL region, 9 are located in the US region, and 6 are located in the IR region. The AILTV envelope glycoproteins gB, gC, gD, gE, gG, gH, gI, gJ, gK, gL and gM are encoded by the highly conserved ORFs UL27, UL44, US6, US8, US4, UL22, US7, US5, UL53, UL1 and UL10, respectively. In 2001, the Roizman and Pellett studies revealed that viral glycoproteins were of great significance for AILTV replication and induction of host humoral and cellular immune responses. In 2017, Nadimpalli and its group designed the AILTV strain with UL (-1) gene deletion, replaced UL (-1) with the gene coding Green Fluorescent Protein (GFP) and the main immediate promoter element of cytomegalovirus, found that the AILTV strain with UL (-1) gene deletion lost the replication ability in host cells, and revealed that the UL gene plays an important role in AILTV replication. Like other alphaherpesviruses, the AILTV genome contains three DNA origins of replication, one OriL in the UL region and two OriS in the Internal Repeat (IR) and Terminal Repeat (TR) regions. Replication and recombination of the virus are almost inseparable, and 11 SNPs located in the AILTV UL (-1), US5, US6, US7, US8 and US9 genes and two SNPs located in the UL43 and UL47 genes have high recombination rates based on TaqMan SNP genotyping assay.

Upon infection of the host with AILTV, replication of the genome, viral packaging, acquisition of virulence and subsequent pathogenesis are performed and a potential infection is established. AILTV can establish latency in the trigeminal ganglia, and when an infected individual is stimulated, such as by vaccination, metastasis, and egg production, the virus is reactivated. Replication of AILTV occurs in the first week of infection, and conjunctival and tracheal mucosa are the primary sites of AILTV replication, leading to inflammation, serous or mucous discharge, and respiratory distress. Since AILTV interacts first with cells in the nasal cavity, conjunctival mucosa and the Hader gland, these tissues play a key role in early viral replication and determine the course of infection. In addition to the detection of AILTV in the respiratory organs, AILTV may also be detected in other organs, such as the brain, tongue, tonsil, thymus, heart, anterior capsule, pancreas, duodenum, small intestine, large intestine, cecum, liver, spleen, and kidney. Viral DNA is replicated during the infection with AILTV, gradually accumulates in the host cell, and subsequently is integrated into newly formed viral particles located in the host cell nucleus, resulting in the formation of basophilic nuclear inclusion bodies, detectable around 12 hours after infection.

The incubation period for AILTV ranges from 6 to 14 days, with a course varying from 11 days to 6 weeks. Clinically, the disease is characterized by conjunctivitis, nasosinusitis, orbital secretions, respiratory distress, blood mucus, orbital sinus swelling, high morbidity, quite high mortality, reduced egg production and the like. The main natural host for AILTV is chicken, but has also been reported in peacocks, pheasants, turkeys and guinea pigs. Other domesticated and wild birds, such as quail, pigeon, guinea fowl, sparrow, and crow, may be resistant to AILTV. AILTV is shed from the respiratory secretions 10 days after infection of birds, and the shed virus again enters the host via respiratory, ocular and oral routes leading to spread of the infection.

CEO and TCO have been in the history for decades as live attenuated vaccines with protective effect on AILTV, chick embryo live attenuated vaccine being the first commercially used vaccine to enter the market in the early 50 and 60 of the 20 th century. However, live attenuated vaccines present an inverse strong risk in the host and may spontaneously recombine between different live attenuated vaccines to form new strains of AILTV. In 2020, garcia and Spatz comparisons of the genomic levels of wild strains of AILTV from different countries with commercial vaccine strains showed that only a few amino acids in the genome of the wild strains are similar to the vaccine strains, indicating that the wild strains may be derived from the vaccine strains. The widespread use of live attenuated vaccines has led to outbreaks of AILTV in many parts of the world. Subsequently, recombinant vector vaccines expressing different AILTV glycoproteins, such as BACDMEQ-gB, BACDMEQ-gJ, ILT-HVT and rHVT-LT; and gene deletion vaccines, such as TK gene deletion strains, and the implementation of combined immunization, and the like, have better protection effect on the prevention and treatment of AILTV. Nevertheless, further research is needed before its commercial introduction into the poultry industry, such as the development of new methods independent of the host immune system, higher levels of biosafety, exploration of genetic resistance of the host, etc., to further improve new vaccines.

The fluorescence PCR detection method is a better method for detecting AILT virus, but the current PCR method has insufficient sensitivity and specificity due to primers and the like, and sometimes the false positive and false negative phenomena occur, thus influencing the use of the fluorescence PCR detection kit.

Disclosure of Invention

The invention aims to solve the technical problem of providing a kit and a detection method for detecting avian infectious laryngotracheitis virus, which have high sensitivity and specificity, effectively reduce the probability of false positive and false negative, and can realize the rapid and reliable detection of a sample by a one-step method.

The invention relates to a kit for detecting avian infectious laryngotracheitis virus, which comprises AILTV-reaction liquid, DNase mixed liquid, AILTV-internal standard, AILTV-positive control and AILTV-negative control;

the AILTV-reaction solution comprises PCR-Buffer, dNTP, a primer probe, an internal standard primer and an internal standard probe;

the dNTPs include dATP, dUTP, dGTP and dCTP; dUTP was used instead of dTTP which is generally used, so that the amplified band was DNA with U bases. This double-stranded structure is hydrolyzed in the presence of UNG enzyme, and thus residual contamination of the amplification product (a major contamination source for PCR) can be reduced.

The primer comprises:

the sequence of the upstream primer (RD-ILV02F01) is 5'-CATCAACTTGAACGCCACT-3' (SEQ ID NO: 1);

the sequence of the downstream primer (RD-ILV02R01) is 5'-CCAGTATCTCTGAGTTCCTCG-3' (SEQ ID NO: 2);

the primer probe (RD-ILVP02) is 5 '-Fam-ATACTTCGACGGGCACAAAGTCC-BHQ 1-3' (SEQ ID NO:3), Fam is a reporter fluorophore, and BHQ1 is a quenching fluorophore; the length of the amplification product is 84bp, and the nucleotide sequence is as follows:

CATCAACTTGAACGCCACTATACTAGAAGATTTGGACTTTGTGCCCGTCGAAGTATACACTCGCGAGGAACTCAGAGATACTGG(SEQ ID NO:4)。

the concentration of the primer is 200-300 nM, and the concentration of the primer probe is 100-200 nM.

The internal standard primer comprises:

an internal standard upstream primer (IPC05F01) with the sequence of 5'-CATAGTTGGACCGCTAGGA-3' (SEQ ID NO:5),

an internal standard downstream primer (IPC05R01) with the sequence of 5'-GAAAGGTCCCGCAAAGAGT-3' (SEQ ID NO:6),

the internal standard probe (IPC05P) is 5 '-Hex-CCGGTGATAAACCTTTGGACCCT-BHQ 1-3' (SEQ ID NO:7), Hex is a reporter fluorophore, and BHQ1 is a quenching fluorophore.

The concentration of the internal standard primer is 100-200 nM, and the concentration of the internal standard probe is 100-200 nM.

Preferably, the DNA enzyme mixed solution comprises an enzyme diluent, a hot start Taq enzyme and UNG enzyme; wherein the final concentration of the hot start Taq enzyme in the DNA enzyme mixed solution is 1-2U/mu L, and the enzyme can perform amplification activity only after being activated at 95 ℃ per month; UNG enzyme is named uracil-N-glycosylase, can selectively hydrolyze and break uracil glycosidic bonds in DNA containing U basic groups, further eliminates amplification product residues, aerosol pollution and the like, has the optimal active temperature of 50 ℃ and inactivation at 95 ℃, and achieves the effect of inhibiting false positive together with hot start Taq enzyme.

Preferably, the AILTV-internal standard is a recombinant plasmid linked to a random internal standard nucleotide sequence at a concentration of 1.0X 10³～2.0×10³copies/. mu.L, random internal standard nucleotide sequence:

CTGGAGACTGAGGGTTGACGCGCATTCGTCATTGAACGCAGACACGGCTGAGAGAACATGGAGCGACTGCACTGCACTTGGTCGATCTGATTAGGAGTGGGGTTTATGCCCGCGGCTTATCCCCCTATCCTTGCGACACGGGAGAAGACAGATTGTCATCGATTTCGCAAGCCATGATATGTTTGGCCCGACCAACCGCGTTTTTCTCGCGCTTGGATAACGACCTATGGTGTGGACAGTGGCTTAGAGGACATGACACGACGGGCTGAAAGTATGTGGTGCTGGGGCCCTTAGATAGCTGCATAGTTGGACCGCTAGGAATTATATCAATTCGAGATCTCCAGCCGACAAAGTAGGCTCCTAACTAACAGGGTCCAAAGGTTTATCACCGGTCCTTACTCTTTGCGGGACCTTTCTACCCATACAATATCGTCCTCCGATGATGGATCACGGAG(SEQ ID NO:8)。

preferably, the AILTV-positive control is a recombinant plasmid connected with a target nucleotide sequence, the Ct value is 17.0-41.0, the diluent is TE solution, and the target nucleotide sequence is SEQ ID NO:4 sequence, namely:

CATCAACTTGAACGCCACTATACTAGAAGATTTGGACTTTGTGCCCGTCGAAGTATACACTCGCGAGGAACTCAGAGATACTGG。

preferably, the AILTV-negative control is performed with DEPC H₂TE buffer prepared from O.

Preferably, the content of each component is as follows:

the invention provides a fluorescence PCR detection method for detecting avian infectious laryngotracheitis virus, which comprises the following steps,

(1) collecting samples: avian nasopharyngeal swab, lung, trachea and laryngeal tissue;

(2) sample pretreatment: because the tracheal tissue is very difficult to be broken, about 1g of tissue disease material is taken, ground in a grinding tool after being cut into pieces, added with 1.2mL of normal saline to be ground into homogenate, transferred to a 1.5mL centrifuge tube, centrifuged for 5 minutes at 8000g, and the supernatant is taken for detection;

(3) preparing an amplification reagent: taking out the components in the packaging box except the DNA enzyme mixed solution, standing at room temperature, and shaking and mixing uniformly for later use after the components are completely dissolved; taking corresponding amount of reagent according to the proportion (43 mu L/one part of AILTV-reaction liquid, 2 mu L/one part of DNase mixed liquid and 0.5 mu L/one part of AILTV-internal reference), fully mixing the reagent into PCR-Mix, and performing instantaneous centrifugation;

(4) sample adding: adding 45 mu L of PCR mix and 5 mu L of sample into each reaction tube, covering a tube cover, centrifuging for a short time, and transferring to an amplification area;

(5) performing amplification on the machine: placing the PCR reaction tube into a sample groove of an amplification instrument, and setting negative control, positive control and the name of a sample to be detected in a corresponding sequence; selecting a FAM channel to detect avian infectious laryngotracheitis virus nucleic acid; selecting an HEX channel detection internal standard; setting the reaction system to be 50 mu L; the cycle parameters were set as follows:

and after the setting is finished, saving the file and operating the reaction program.

(6) Analyzing and judging results: after the reaction procedure is completed, recording the Ct value and the amplification curve of the sample; the Ct value of the AILTV-negative control HEX channel is less than or equal to 35, and the FAM channel does not report the Ct value; the Ct value of the AILTV-positive control HEX channel is less than or equal to 35, and the Ct value of the FAM channel is less than or equal to 35; the HEX channel Ct value is less than or equal to 35 and the FAM channel Ct value is less than or equal to 35 in the detection result of the detected sample, and the result is reported as positive AILTV nucleic acid; the HEX channel Ct value in the detection result of the detected sample is less than or equal to 35, the FAM channel Ct value is greater than 40 or no report Ct value, and the report is AILTV nucleic acid negative; the HEX channel Ct value is less than or equal to 35 and the FAM channel Ct value is less than or equal to 40 in the detection result of the detected sample, the report is suspicious, and the detection is carried out again, if the Ct value is not detected again, the report reports that the nucleic acid detection of AILTV is negative, otherwise, the detection is positive; and if the FAM channel Ct value in the detection result of the detected sample is greater than 40 or no report Ct value and the HEX channel Ct value is greater than 35, the detection result of the sample is invalid, the reason should be searched and eliminated, and the sample is subjected to repeated experiments.

The kit has the beneficial effects of strong specificity, high sensitivity and pollution resistance, and can be used for early, rapid and accurate detection of AILTV recessive infection, low-load infection and the like in clinic.

The invention can be used for the following purposes:

(1) laboratory confirmation tests for suspected cases;

(2) early diagnosis before onset or in the early stages of onset (no overt symptoms);

(3) "physical examination" of healthy flocks of chickens to see if there is recessive infection with AILTV;

(4) detection of AILTV pathogen in the process of introduction, especially accurate detection of introduction from foreign epidemic areas;

(5) AILTV pathogen detection of imported meat products, in particular accurate detection of imported meat products from foreign epidemic areas;

(6) the detection technology is convenient for on-site instant detection;

(7) used for basic research of AILTV pathogenic mechanism, epidemiology and the like.

The invention has the following advantages:

1. higher sensitivity and specificity: specific primers and probes were screened and optimized based on the highly conserved gB gene sequence in the AILTV genome. Through bioinformatics prediction and experimental verification, the primer probe optimized by the technical scheme has high sensitivity and specificity, and can avoid missed detection caused by mismatching of the primer probe.

2. The use of internal standards avoids false negatives: the detection result may be false negative due to factors such as complexity, improper storage, wrong reagent preparation, and wrong sample addition of clinical samples. The kit in the technical scheme can be used for monitoring whether the whole PCR reaction system is normal or not by adding the internal standard, so that the wrong judgment result caused by improper use is avoided.

The UNG enzyme system can reduce false positives: the most common pollution in a PCR amplification laboratory is amplification product pollution, the cleaning is troublesome, and aerosol is formed or surface residues have great influence on high-sensitivity and common PCR detection. To prevent or reduce this, the action of UNG enzyme is not limited.

Drawings

FIG. 1 is a graph showing the amplification of primer probes of group 1, designated by the reference numeral 1.

FIG. 2 is a graph showing the amplification of primer probes of group 2, designated by the reference numeral 2.

FIG. 3 is a graph of internal standard fluorescent amplification of IPC01, accession number 1.

FIG. 4 is a graph of internal standard fluorescent amplification of IPC01, accession number 2.

FIG. 5 is a graph of internal standard fluorescent amplification of IPC01, accession number 3.

Wherein the lower right line of FIGS. 3-5 is an internal standard amplification curve.

FIG. 6 is a graph of fluorescence amplification without internal standard.

FIG. 7 is an amplification diagram of the kit.

FIG. 8 is a standard curve of kit amplification results.

Figure 9 is the precision test curve chart of the kit.

FIG. 10 is a graph showing the minimum detection limit of the kit.

Detailed Description

EXAMPLE 1AILTV primer Probe sequence screening

Through bioinformatics analysis and comparison of gB gene sequence information of 85 AILTV genomes logged in NCBI, a specific primer and a probe sequence are designed by selecting a sequence of a highly conserved region of the gene. The sequences and related information for each primer probe set are shown in the following table.

TABLE 1AILTV primer and Probe sequence information

And performing amplification comparison tests on the primer probes in each group, and verifying the amplification efficiency of the primers, the signal-to-noise ratio of the probes, the amplification curve form and the like. Finally, 2 nd group primer probes are screened for the production of the kit.

The amplification profiles of the primer probes of groups 1 and 2 are shown in FIGS. 1-2. The amplification curve pattern and sensitivity in group 2 were better than those in group 1.

Example 2 internal standard System screening

And (3) using a random sequence internal standard to perform the internal standard function to monitor false negative, and simultaneously, not causing any influence on the amplification of the target gene.

(1) Construction of an internal standard plasmid: the nucleotide sequence was randomly generated, 455bp in length, and sequence synthesis was performed by Shanghai Biotech. The nucleotide fragment synthesized was ligated to pUC57 vector, and the recombinant plasmid was numbered pUC-ipc. The internal standard nucleotide sequence is:

CTGGAGACTGAGGGTTGACGCGCATTCGTCATTGAACGCAGACACGGCTGAGAGAACATGGAGCGACTGCACTGCACTTGGTCGATCTGATTAGGAGTGGGGTTTATGCCCGCGGCTTATCCCCCTATCCTTGCGACACGGGAGAAGACAGATTGTCATCGATTTCGCAAGCCATGATATGTTTGGCCCGACCAACCGCGTTTTTCTCGCGCTTGGATAACGACCTATGGTGTGGACAGTGGCTTAGAGGACATGACACGACGGGCTGAAAGTATGTGGTGCTGGGGCCCTTAGATAGCTGCATAGTTGGACCGCTAGGAATTATATCAATTCGAGATCTCCAGCCGACAAAGTAGGCTCCTAACTAACAGGGTCCAAAGGTTTATCACCGGTCCTTACTCTTTGCGGGACCTTTCTACCCATACAATATCGTCCTCCGATGATGGATCACGGAG。

(2) quantification of the internal standard plasmid: the concentration of the recombinant plasmid pUC-ipc was quantified using a protein nucleic acid analyzer, and the recombinant plasmid was diluted with TE solution. Wherein: based on the actual concentration measurement, pUC-ipc was diluted to 1.0X 10³～2.0×10³copies/. mu.L as internal standard.

(3) 3 sets of primer probes are designed according to the internal standard sequence, wherein the 5' end of the probe is uniformly marked with a Hex fluorescent group. The sequence of the index probes in 3 sets is shown in the table below.

TABLE 2 internal standard primer and Probe sequence information Table

(4) Respectively adding the 3 sets of internal standard systems into an AILTV detection system to form a dual amplification system, adding a template for amplification, comparing the amplification result with indexes such as a fluorescence curve, a Ct value and the like of an AILTV single amplification system without the internal standard system, and screening an internal standard primer probe which has no interference on the AILTV detection system as a preferred internal standard system.

The results of the amplification experiments (FIGS. 3-6) show that: the addition of the 3 groups of internal index probes has no great influence on the original AILTV detection system, and the amplification Ct value and the amplification curve of AILTV have no obvious change. According to the amplification condition of the internal standard system (green curve), the IPC01 primer and probe combination is the best internal standard system.

Example 3 kit composition

According to the experimental results, the fluorescence PCR detection kit for the avian infectious laryngotracheitis virus comprises the following components: AILTV-reaction solution, DNase mixture, AILTV-internal standard, AILTV-positive control, and AILTV-negative control. The preparation method of each component is as follows:

(1) the AILTV-reaction solution comprises PCR-Buffer, dNTP, the AILTV primer probe and the internal standard primer probe. Wherein the final concentration range of the AILTV primer RD-ILV02F01 and RD-ILV02R01 in the reaction liquid is 200-300 nM, and the concentration range of the AILTV probe RD-ILVP02 in the reaction liquid is 100-200 nM; the final concentration range of the internal standard primers IPC05F01 and IPC05R01 in the reaction liquid is 100-200 nM, and the final concentration range of the internal standard probe IPC05P in the reaction liquid is 100-200 nM; dNTPs include four deoxyribonucleosides, dATP, dUTP, dGTP and dCTP, in which dUTP is used instead of dTTP which is generally used, and thus the band is amplified as DNA having U bases. This double-stranded structure is hydrolyzed in the presence of UNG enzyme, and thus residual contamination of the amplification product (a major contamination source for PCR) can be reduced. Particularly, the PCR-Buffer in the reaction solution is different from the common Buffer, wherein the concentration of Tris-HCl is 125-200 mM and is higher than the common concentration of 10mM, so that the PCR reaction is not influenced by an alkaline nucleic acid releasing agent, and the core content of the detection of the kit is realized.

(2) The DNA enzyme mixed solution comprises enzyme diluent, hot start Taq enzyme and UNG enzyme. Wherein the final concentration of the hot start Taq enzyme in the DNA enzyme mixed solution is 1-2U/mu L, and the enzyme can perform amplification activity only after being activated at 95 ℃ per month; UNG enzyme is named uracil-N-glycosylase, can selectively hydrolyze and break uracil glycosidic bonds in DNA containing U basic groups, further eliminates amplification product residues, aerosol pollution and the like, has the optimal active temperature of 50 ℃ and inactivation at 95 ℃, and achieves the effect of inhibiting false positive together with hot start Taq enzyme.

(3) AILTV-internal standard: the concentration of the recombinant plasmid pUC-ipc was quantified using a protein nucleic acid analyzer, and the recombinant plasmid was diluted with TE solution. Based on the actual concentration measurement, pUC-ipc was diluted to 1.0X 10³～2.0×10³copies/. mu.L as internal standard.

(4) The concentration of the recombinant plasmid pUC-p72 was quantified using a protein nucleic acid analyzer, and the recombinant plasmid was diluted with TE solution. Wherein: based on the actual concentration measurement, pUC-p72 was dilutedTo 1.0X 10⁴～5.0×10⁴copies/. mu.L, as a positive control.

(5) AILTV-negative control was with DEPC H₂And (3) preparing TE solution from O.

(6) The kit (calculated by 50T) comprises the following components in parts by weight:

example 4 Linear Range and amplification efficiency assays

Quantitative recombinant plasmid pUC-p72 was serially diluted in 10-fold gradients to obtain copy number ranges: 10⁷About.1 copies/. mu.l, real-time fluorescence PCR was performed using each gradient as a template, and a calibration curve was prepared from the amplification results.

As shown in fig. 7-8. The AILTV kit pair 10⁷Amplification of 1 copies/. mu.l gradient template was normal, linear amplification, correlation coefficient R²0.99; in this linear amplification range, the amplification efficiency of the kit was 94%. According to the results, the kit can be used for qualitative determination of AILTV and meets the requirements of quantitative determination.

Example 5 determination of precision

The concentration of recombinant plasmid pUC-p72 was adjusted to 10 copies/. mu.l and used as an amplification template for precision determination. The Coefficient of Variation (CV) of the Ct value was calculated for 8 replicates of this concentration template, generally the precision CV of fluorescence PCR should be < 10% and the lower the reproducibility the better.

The precision test results show (table 3) that the kit has 0.79% precision for low-concentration template amplification, good repeatability and good repeatability of the amplification curve morphology (as shown in fig. 9).

TABLE 3 precision test results of AILTV kit

Numbering	Target gene Ct
		1	34.20
2	34.55
		3	34.31
4	34.34
		5	34.04
6	34.39
		7	34.07
8	34.36
		CV(％)	0.50

Example 6 the kit use method comprises the following steps:

(1) collecting samples: avian nasopharyngeal swab, lung, trachea and laryngeal tissue.

(2) Sample pretreatment: because the trachea tissue is very difficult to break, about 1g of tissue disease material is taken, ground in a grinding tool after being cut into pieces, added with 1.2mL of normal saline to be ground into homogenate, transferred to a 1.5mL centrifuge tube, centrifuged for 5 minutes at 8000g, and the supernatant is taken for detection.

(3) Preparing an amplification reagent: taking out the components in the packaging box except the DNA enzyme mixed solution, standing at room temperature, and shaking and mixing uniformly for later use after the components are completely dissolved; corresponding amount of reagent was taken in proportion (AILTV-reaction solution 43. mu.L/aliquot + DNase mixture 2. mu.L/aliquot + AILTV-internal reference 0.5. mu.L/aliquot), mixed well to PCR-Mix, and centrifuged instantaneously.

(4) Sample adding: to each reaction tube, 45. mu.L of PCR mix and 5. mu.L of sample were added, capped, centrifuged briefly, and transferred to the amplification zone.

(5) Performing amplification on the machine: placing the PCR reaction tube into a sample groove of an amplification instrument, and setting negative control, positive control and the name of a sample to be detected in a corresponding sequence; selecting a FAM channel to detect avian infectious laryngotracheitis virus nucleic acid; selecting an HEX channel detection internal standard; setting the reaction system to be 50 mu L; the cycle parameters were set as follows:

and after the setting is finished, saving the file and operating the reaction program.

(6) Analyzing and judging results: and after the reaction procedure is finished, recording the Ct value and the amplification curve of the sample. The Ct value of the AILTV-negative control HEX channel is less than or equal to 35, and the FAM channel does not report the Ct value; the Ct value of the AILTV-positive control HEX channel is less than or equal to 35, and the Ct value of the FAM channel is less than or equal to 35; the HEX channel Ct value is less than or equal to 35 and the FAM channel Ct value is less than or equal to 35 in the detection result of the detected sample, and the result is reported as positive AILTV nucleic acid; the HEX channel Ct value in the detection result of the detected sample is less than or equal to 35, the FAM channel Ct value is greater than 40 or no report Ct value, and the report is AILTV nucleic acid negative; the HEX channel Ct value is less than or equal to 35 and the FAM channel Ct value is less than or equal to 40 in the detection result of the detected sample, the report is suspicious, and the detection is carried out again, if the Ct value is not detected again, the report reports that the nucleic acid detection of AILTV is negative, otherwise, the detection is positive; and if the Ct value of the FAM channel in the detection result of the detected sample is greater than 40 or the Ct value of the unreported sample and the Ct value of the HEX channel (internal standard) is greater than 35, the detection result of the sample is invalid, the reason should be searched and eliminated, and the sample is subjected to repeated experiments.

Example 7 minimum detection Limit determination

The concentration of recombinant plasmid pUC-p72 was adjusted to 1 copies/. mu.l and used as an amplification template for detection limit determination. For this concentration template 8 replicates were amplified and all were detected.

The results are shown in FIG. 10, and all the samples were positive by repeating the test 8 times for 1 copies/. mu.l of template. Based on this result, the minimum detection limit of the AILTV kit was set to 1000 copies/mL.

Example 8 specific assay

In order to detect the specificity of the kit, the kit provided by the invention is used for detecting common avian disease pathogens, including chicken Marek's disease virus, avian bronchitis virus, avian infectious bursal disease virus, Newcastle disease virus, negative serum samples and pathological tissue samples to carry out specificity tests.

The results of the tests showed (table 4): the kit only amplifies the target gene gB of AILTV, does not have cross reaction with other pathogens, normal negative blood and nucleic acid of a tissue sample, and has good specificity.

TABLE 4AILTV kit specificity test results

Detecting items

AILTV

MDV

IBV

IBDV

NDV

Serum

Tissue of

AILTV(Fam)

26.50

No Ct

No Ct

No Ct

No Ct

No Ct

No Ct

Internal standard (hex)

28.65

28.71

28.76

28.54

28.74

28.58

28.47

Those of ordinary skill in the art will understand that: the discussion of any embodiment above is meant to be exemplary only, and is not intended to intimate that the scope of the disclosure, including the claims, is limited to these examples; within the spirit of the present disclosure, features from the above embodiments or from different embodiments may also be combined, steps may be implemented in any order, and there are many other variations of different aspects of one or more embodiments in this application as described above, which are not provided in detail for the sake of brevity.

It is intended that the one or more embodiments of the present application embrace all such alternatives, modifications and variations as fall within the broad scope of the appended claims. Therefore, any omissions, modifications, substitutions, improvements, and the like that may be made without departing from the spirit and principles of one or more embodiments of the present disclosure are intended to be included within the scope of the present disclosure.

<110> Hunan national survey Biotechnology Co., Ltd

<120> kit and detection method for detecting avian infectious laryngotracheitis virus

<160>8

<210>1

<211>19

<212>DNA

<213> Artificial sequence

<400>1

catcaacttg aacgccact 19

<210>2

<211>21

<212>DNA

<213> Artificial sequence

<400>2

ccagtatctc tgagttcctc g 21

<210>3

<211>23

<212>DNA

<213> Artificial sequence

<400>3

atacttcgac gggcacaaag tcc 23

<210>4

<211>84

<212>DNA

<213> Artificial sequence

<400>4

catcaacttg aacgccacta tactagaaga tttggacttt gtgcccgtcg aagtatacac 60

tcgcgaggaa ctcagagata ctgg 84

<210>5

<211>19

<212>DNA

<213> Artificial sequence

<400>5

catagttgga ccgctagga 19

<210>6

<211>19

<212>DNA

<213> Artificial sequence

<400>6

gaaaggtccc gcaaagagt 19

<210>7

<211>23

<212>DNA

<213> Artificial sequence

<400>7

ccggtgataa acctttggac cct 23

<210>8

<211>455

<212>DNA

<213> Artificial sequence

<400>8

ctggagactg agggttgacg cgcattcgtc attgaacgca gacacggctg agagaacatg 60

gagcgactgc actgcacttg gtcgatctga ttaggagtgg ggtttatgcc cgcggcttat 120

ccccctatcc ttgcgacacg ggagaagaca gattgtcatc gatttcgcaa gccatgatat 180

gtttggcccg accaaccgcg tttttctcgc gcttggataa cgacctatgg tgtggacagt 240

ggcttagagg acatgacacg acgggctgaa agtatgtggt gctggggccc ttagatagct 300

gcatagttgg accgctagga attatatcaa ttcgagatct ccagccgaca aagtaggctc 360

ctaactaaca gggtccaaag gtttatcacc ggtccttact ctttgcggga cctttctacc 420

catacaatat cgtcctccga tgatggatca cggag 455