The CsERF3 gene is characterized in that the nucleotide sequence is shown as SEQ ID NO. 1.

2. The protein encoded by the CsERF3 gene of claim 1.

3. An expression vector comprising the CsERF3 gene of claim 1.

4. A host cell comprising the expression vector of CsERF3 gene according to claim 3.

5. The use of the CsERF3 gene of claim 1 for modulating plant type.

6. The use of claim 5, wherein the CsERF3 gene is overexpressed in promoting dwarfing of plants.

7. The use of claim 5, wherein the plant is Camellia sinensis or tobacco.

8. The use of the CsERF3 gene of claim 1 for modulating plant stress resistance.

9. The use of claim 8, wherein the CsERF3 gene is overexpressed in enhancing salt tolerance in plants.

10. The use of claim 8, wherein the plant is tea tree or tobacco.

Background

Tea trees (Camellia sinensis (L.) O.Kuntze) are one of important economic crops in China and are also important characteristic agricultural prop industries in China. The total production amount of tea in China in 2017 reaches 260.9 ten thousand tons, the export amount is 35.53 ten thousand tons, and the tea is the first in the world. Tea trees are typical agricultural crops which are favored by acid soil, the pH value of the optimal soil is 4.5-5.5, and the tea trees are difficult to grow or cannot form effective economic yield in weak alkaline or even neutral soil (luoying et al, 2008). Soil salinization is one of the main factors influencing crop yield and quality, and is a worldwide ecological problem and a resource problem. The total land area affected by salt damage in the world is about 11.25 hundred million hectares, wherein the soil close to 1.8 hundred million hectares in the middle east region is affected by salt damage to different degrees, and the land area affected by salt damage in China exceeds 1 hundred million hectares and occupies about 11 percent of the land area in China (Hossain 2019). In recent years, soil salinization is increasingly intensified, the influence of salt stress on the growth and development of tea trees is increasingly serious, and the development of the tea tree industry is greatly restricted. Therefore, the improvement of the salt stress resistance of tea tree varieties is a difficult and urgent task to be solved in the present tea tree breeding workers.

At present, the salt stress tolerance of tea trees is improved mainly by traditional field measures such as strengthening field management, improving cultivation conditions, artificial compensation and the like, but the uncertainty of adversity stress often causes that defense response is not timely and accurate, so that serious economic loss is caused. Therefore, the breeding of salt stress tolerant varieties is a fundamental approach for solving the heat resistance problem of tea trees, but the traditional breeding methods of tea trees, such as natural hybridization, artificial hybridization, bud mutation seed selection, tissue culture and the like, have long breeding period and difficult variety identification, so that the genetic improvement work of tea trees is slow. With the rapid development of biotechnology, molecular breeding technology based on cell engineering and transgenic engineering is mature day by day, and becomes an important means for breeding new plant varieties, and target characters of plants are endowed or improved in a targeted manner and original excellent characters are reserved through introduction or silencing of exogenous or endogenous genes, so that a brand new thought and means are provided for tea tree resistance breeding work.

In order to cope with biotic or abiotic stress, plant bodies have evolved over a long period of time to form complex mechanisms for sensing stress signals. Common hormones such as ABA, ETH, GA and the like are used as signal molecules to participate in biological processes such as regulation of plant growth and development, stress regulation and the like (Gao Chunyan et al, 2017). Some transcription factor-dependent hormone-mediated signal pathways are involved in regulation of plant abiotic stress responses, and some hormone-independent signal pathways are involved in regulation, and analysis of transcription factor functions can better understand the molecular mechanism of plants in coping with abiotic stress (Kavas et al 2015). AP2/ERF is one of transcription factor families specific to plants, plays an important role in the aspects of plant response to various abiotic stresses such as low temperature, drought, high salt and the like (especially members of ERF subfamily), and can participate in various hormone signal pathways to influence plant adverse environment response (Tao et al, 2015). Therefore, the new ERF transcription factor gene and the biological characteristics and functions thereof are developed in tea trees, so that a theoretical basis can be provided for the whole plant stress-resistant gene regulation network and a stress response reaction mechanism, and a certain material basis is provided for improving the stress resistance of plants.

Disclosure of Invention

The invention aims to provide a tea tree CsERF3 gene and application thereof.

The invention provides a CsERF3 gene for coding a tea tree ERF transcription factor and application thereof, wherein the nucleotide sequence of the CsERF3 gene for coding the tea tree ERF transcription factor is shown as SEQ ID NO.1 and consists of 594 basic groups. The invention separates the complete cDNA of the coding CsERF3 gene from the tea tree, connects the complete cDNA to the plant expression vector, transforms the plant by using the agrobacterium infection method to obtain the transgenic plant, analyzes the stress resistance of the transgenic plant, and the result shows that the tea tree ERF transcription factor CsERF3 can respond the stress signal, positively regulates the high salt stress resistance of the plant, and the transgenic plant becomes short.

The first purpose of the invention is to provide a CsERF3 gene, the nucleotide sequence of which is shown as SEQ ID NO. 1.

The second purpose of the invention is to provide the protein coded by the CsERF3 gene.

The third purpose of the invention is to provide an expression vector containing the CsERF3 gene.

The fourth purpose of the invention is to provide a host cell containing the expression vector of the CsERF3 gene.

The fifth purpose of the invention is to provide the application of the CsERF3 gene in regulation and control of plant types of plants.

Preferably, the application is the application of the over-expressed CsERF3 gene in promoting plant dwarfing.

The sixth purpose of the invention is to provide the application of the CsERF3 gene in regulation and control of plant stress resistance.

Preferably, the application is the application of the over-expressed CsERF3 gene in enhancing the salt tolerance of plants.

Preferably, the plant is tea tree or tobacco.

The invention has the advantages that:

the invention separates the complete cDNA of the coding ERF transcription factor CsERF3 gene from the tea tree, connects the cDNA to the plant expression vector, transforms the plant by using the agrobacterium infection method, obtains the transgenic plant, analyzes the stress resistance of the transgenic plant, and the result shows that the CsERF3 gene can respond the stress signal, positively regulates the high salt stress resistance and other capabilities of the plant, and promotes the dwarfing of the plant. Therefore, the gene can be applied to genetic improvement of plants.

Drawings

FIG. 1 is a graph of the expression profile of CsERF3, wherein Panel A is the expression level of CsERF3 in different tissues; panel B shows the expression level of CsERF3 under abiotic stress.

FIG. 2 is a PCR analysis of different CsERF3 transgenic tobacco lines, wherein panel A is the PCR detection of different transgenic tobacco; FIG. B shows RT-PCR detection of different transgenic tobacco; WT: a wild type; L1-L3: and (4) transgenic lines.

FIG. 3 is a phenotypic observation of wild type and transgenic CsERF3 plants after three weeks of culture under NaCl stress at different concentrations; WT: wild type, L2, L3: transgenic lines overexpressing CsERF 3.

FIG. 4 is a graph showing the results of the effect of overexpression of CsERF3 gene on tobacco development; comparing tobacco overexpressing CsERF3 to control plants; WT: wild type, L2, L3: transgenic lines overexpressing CsERF 3.

Detailed Description

The following examples are further illustrative of the present invention and are not intended to be limiting thereof.

Example 1

The ERF transcription factor CsERF3 gene sequence in the tea tree is obtained as follows:

the biennial cutting seedlings of the 'Fuding white tea' are taken as test materials and planted in natural environment. Selecting disease-free plants, picking young leaves, and culturing according to RNA prep Pure Plant Kit (Polysaccharides)&Polyphenolic-rich) (heaven root) kit instructions for RNA extraction and concentration of the extracted RNA samples was determined using a microdust NanoDrop. Then useThe One-Step gDNA Removal and cDNA Synthesis Super Mix Kit (all-type gold) Kit reversely transcribes the extracted RNA into cDNA, designs a pair of specific primers, amplifies a 594bp long sequence, the nucleotide sequence of which is shown as SEQ ID NO.1 (the corresponding genomic DNA sequence is shown as 71-762 of SEQ ID NO.2, wherein 154-251 is an intron), and determines that the sequence contains a translation initiation site ATG and a termination codon through sequencing, so that the protein containing 197 amino acid residues can be coded, namely, the tea tree ERF transcription factor CsERF3 gene.

Wherein, the nucleotide sequence of the specific primer is as follows:

an upstream primer: 5'AACACCTTGCCACAAGAAAC 3';

a downstream primer: 5'TGAGATGCTTTGGACTTCGT 3'.

Example 2

Analyzing the tissue-specific expression and abiotic stress response expression pattern of the CsERF3 gene of the tea tree:

taking 2-year-old 'Fuding big white tea' as a material, and taking roots, stems, tender leaves and mature leaves thereofAnd flowers for CsERF3 tissue expression pattern analysis. Cutting a seedling of 25cm of 2-year-old 'Fuding big white tea', reserving 3 completely-unfolded leaves, putting the seedling into 1/2Hogland nutrient solution, culturing for 15 days under the conditions of 25 ℃ and long day (14h/10h, day/night), and respectively carrying out the following treatments: 20% (w/V) PEG-6000 solution, 200mmol/L NaCl, low temperature (4 ℃) and high temperature (40 ℃) for 0, 2, 12, 24 and 48 hours, taking 3 times for repeated treatment, quickly freezing by liquid nitrogen, and storing in a refrigerator at-80 ℃. RNA was extracted and inverted to cDNA as described in example 1. Real-time quantitative PCR (quantitative time RT-PCR) was carried out according to the instructions of SYBR Premix Ex Taq kit (TaKaRa Co., Ltd.) and the reaction was carried out on a Bio-Rad CFX96 Touch fluorescent quantitative PCR instrument. Delta CT method for analyzing relative quantitative reference gene of CT value of each sample, expression difference is equal to 2^–ΔΔCTThe gene of tea tree Actin is used as an internal reference gene and is amplified together with a target gene CsERF3, and the amplification program is 95 ℃ for 5 min; 5s at 95 ℃, 30s at 55 ℃, 10s at 65 ℃ and 35 cycles. Each sample was replicated 3 times. An Actin primer sequence (F: 5'TGGTTAAGGCTGGATTTGCT 3'; R: 5'TGCATGCTTTGACCCATAC 3'); the CsERF3 primer sequence (F: 5'GCCAGACCACAACAGCGATAC 3'; R: 5'CGGATTGTAAGGGAAGTTGGTT 3').

As a result, CsERF3 was found to be low in roots, mature leaves and flowers, and high in expression levels in young leaves and stems (FIG. 1A). The general trend for CsERF3 expression under drought (PEG), high salt (NaCl), low and high temperature stress was up-regulated, with NaCl inducing CsERF3 up-regulated expression significantly faster than drought, low and high temperature induction (fig. 1B).

Example 3

The construction of the binary plant expression vector pCAMBIA1301-35s-CsERF3 is as follows:

using pEASY-Blunt-CsERF3 plasmid (obtained by inserting CsERF3 gene cDNA shown in SEQ ID NO.1 into pEASY-Blunt vector) as a template, and using primers CsERF3-PstI (F): 5'ctgcagAACACCTTGCCACAAGAAAC3' and CsERF3-BamHI (R): 5'cctaggTGAGATGCTTTGGACTTCGT3' introduces restriction sites PstI and BamHI before and after CsERF3, the PCR product and pCAMBIA1301 empty vector plasmid are double-digested with BamHI and PstI, the two digestion products are connected, the connection product is transformed into E-Coli.DH5 alpha, and the E-Coli.DH5 alpha is coated on LB plate containing 50mg/ml kanamycin resistance. Culturing at 37 ℃, selecting a single colony for colony PCR verification after 12h, shaking the bacteria with positive colony PCR verification, extracting plasmids, carrying out enzyme digestion and identification to obtain a target strip, and finally carrying out Shanghai's engineering sequencing to show that the vector pCAMBIA1301-35s-CsERF3 is correctly constructed.

Example 4

The construction of Agrobacterium strain EHA105: pCAMBIA1301-35s-CsERF3 for plant transgenosis is as follows:

the agrobacterium strain used was EHA 105. The constructed expression vector is transferred into agrobacterium by adopting a liquid nitrogen freeze-thawing method. The specific process is as follows: 1) melting EHA105 competent cells in ice bath, adding at least 100ng of recovered and purified pCAMBIA1301-35s-CsERF3 expression vector plasmid, gently mixing uniformly, and carrying out ice bath for 30 min; 2) quickly freezing with liquid nitrogen for 5min, water bathing at 37 deg.C for 5min, and rapidly freezing on ice for 1 min; 3) adding 800 μ L YEB culture medium without antibiotics, and resuscitating at 28 deg.C and 200rpm for 2 h; 4) centrifuging at 6000rpm for 2min, and sucking off the culture medium; 5) mixing the rest bacteria liquid evenly, and smearing on a solid YEB culture medium added with 50mg/ml kanamycin and 50mg/ml rifampicin; 6) performing inverted culture at 28 deg.C for 48-72 h; 7) PCR detecting positive clone to obtain EHA105 pCAMBIA1301-35s-CsERF3, and storing at 4 deg.C for use.

Example 5

The CsERF3 gene is transformed into tobacco, and the specific steps are as follows:

after tobacco seeds were sterilized with 1% sodium hypochlorite, they were cultured in sterile water in a flask, and after about 2 days, the seed coat was broken to expose radicles. The germinated tobacco seeds were grown on 1/2MSB solid medium at 25 ℃ for 16h light/8 h dark photoperiod. After about one month, the strong, sterile shoots can be excised and used as transformed explants.

The genetic transformation of tobacco was carried out by the Agrobacterium-mediated leaf disc transformation method. Agrobacterium strains for transformation were inoculated in liquid YEB medium and shake-cultured overnight at 28 ℃ and 200 rpm. Sucking 1mL of the bacterial liquid, inoculating the bacterial liquid into 20-25mL of liquid YEB, performing shake culture at 28 ℃ and 200rpm for secondary activation, centrifuging and collecting thalli when the bacterial liquid is shaken until OD600 is 0.6-0.8, and re-suspending the thalli by using the liquid YEB with the same volume for later use. Cutting sterile seedling leaf into size of 0.5cm × 0.5cm, infecting in prepared Agrobacterium liquid for 10min, removing the liquid, placing the explant on co-culture medium with a layer of filter paper on the surface, and dark culturing at 24 deg.C for 2-3 days.

After co-culture, explants were inoculated into screening medium for induction and differentiation, and subcultured every 2-3 weeks. And after the adventitious bud appears, cutting off the strongly grown adventitious bud, and transferring the strongly grown adventitious bud into a rooting culture medium for rooting. When the resistant seedlings grow strongly and have developed root systems, the root agar is cleaned, and the seedlings are hardened for 2 to 3 days and then transplanted into a flowerpot to grow.

Wherein the content of the first and second substances,

YEB Medium: 0.5% sucrose (W/V), 1% bacto tryptone (W/V), 0.1% bacto yeast extract (W/V), 0.05% MgSO4 & 7H₂O (W/V), pH 7.0. Adding 1.5% agar powder (W/V) before sterilizing the solid culture medium;

MSB culture medium: MS inorganic salts + B5 organic +2.4g/L Gelrite +30g/L sucrose, pH 5.8.

Wherein the MS inorganic salt is obtained by diluting MS inorganic mother liquor by the dilution times described below;

formulation of MS inorganic mother liquor (1000 ml):

50 × mother liquor I: 82.5g NH₄NO₃、95g KNO₃、8.5g KH₂PO₄，

50 × mother liquor II: 18.5g MgSO₄·7H₂O，

50 × mother liquor III: 16.612g CaCl₂，

50 × mother liquor IV: 1.39g FeSO₄·7H₂O、1.866g Na₂EDTA，

200 × mother liquor V: 1.24g H₃BO₃、0.166g KI、0.05g Na₂MoO₄·2H₂O、4.46g MnSO₄·4H₂O、3.3802gMnSO₄·H₂O、1.72g ZnSO₄·7H₂O、0.005g CuSO₄·5H₂O、0.005g CoCl₂·6H₂O。

B5 organic: 100mg/L inositol, 1mg/L nicotinic acid and 1mg/L pyridoxine hydrochloride.

Tobacco co-culture medium: 1 × MSB +0.5mg/L IAA +2 mg/L6-BA +30g/L sucrose +2.4g/L Gelrite, pH 5.4;

tobacco screening culture medium: 1 XMSB +0.5mg/L IAA +2 mg/L6-BA +30g/L sucrose +50mg/L Km +200mg/L CEF +2.4g/L Gelrite, pH 5.8;

rooting culture medium: 1 XMSB +30g/L sucrose +50mg/L Km +200mg/L CEF +2.4g/L Gelrite, pH 5.8.

In this example, the CsERF3 gene was transferred into tobacco in an agrobacterium tumefaciens mediated manner, and the DNA of the regenerated plant was amplified using a specific primer for the CsERF3 gene. 3 lines (L1, L2 and L3) of tobacco transformed with the CsERF3 gene amplified a specific band of about 594bp, and the same band was not detected in wild plants, indicating that the CsERF3 gene was successfully integrated into the tobacco genome. Then, plant RNA is extracted, RT-PCR detection is carried out, and the result shows that the CsERF3 gene can be normally expressed in tobacco, as shown in figure 2.

Example 6: overexpression of CsERF3 to improve high salt stress tolerance

The sterilized CsERF3 overexpression tobacco lines (L2 and L3) and wild type tobacco seeds were placed on 1/2MS solid medium containing 0, 100mmol/L and 200mmol/L NaCl, respectively, and cultured for 21 days under long-day conditions (14h/10h, day/night) at 25 ℃ for 3 replicates. The results show that the survival rate after high salt treatment of L2 and L3 is significantly higher than that of the wild type (fig. 3). Thus, overexpression of CsERF3 in tobacco could positively modulate the response of tobacco to high salt stress.

Example 7: overexpression CsERF3 for inhibiting growth of tobacco plants

Compared with wild tobacco, the transgenic tobacco strains L2 and L3 over-expressing the CsERF3 gene have obviously reduced plant height, as shown in FIG. 4.

The above-mentioned embodiments are intended to illustrate the objects, technical solutions and advantages of the present invention in further detail, and it should be understood that the above-mentioned embodiments are merely exemplary embodiments of the present invention, and are not intended to limit the scope of the present invention, and any modifications, equivalent substitutions, improvements and the like made within the spirit and principle of the present invention should be included in the scope of the present invention.

Sequence listing

<110> agriculture academy of sciences of Chongqing City

<120> tea tree CsERF3 gene and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 594

<212> DNA

<213> tea tree (Camellia sinensis (L.) O. Kuntze)

<400> 1

atggccagac cacaacagcg ataccgcgga gtccgacaaa ggcattgggg ttcttgggtc 60

tccgaaattc gccacccgtt actaaagact agaatttggc taggaacatt cgaaacggca 120

gaggatgcgg ctcgagccta cgacgaggcc gcaaggctaa tgtgtgggcc cagggcccga 180

accaacttcc cttacaatcc gaatttgtcg tcgcagtcgt cgtcgtcgaa acttctctcg 240

gctactttga cagccaaatt gcacaaatgt tacatggctt cacttcaatt gactcagcaa 300

tcaatgcaag tgtcacaaag aattccaatt ccaaatgttg ttgacaccaa ttgcattatt 360

cgcaatggga atgaaatggt tgggtggttg ccggagatga aaccggtggt ggcggtggcg 420

ccgccacaga aggaggagag ttgggttgtg aagaaagaac aaatggaggg tatacaacaa 480

caggtcaagg ctcttgaaga tgatcacatt gagcaaatga ttgaggagtt gcttgattat 540

gggtccatta ttgagctctg ccctgttgtc ccatctcagg ctactactat gtaa 594

<210> 2

<211> 800

<212> DNA

<213> tea tree (Camellia sinensis (L.) O. Kuntze)

<400> 2

acccatctct ctcattcaga cattttcaca aacaccttgc cacaagaaac gtttcaattg 60

agcaccaacc atggccagac cacaacagcg ataccgcgga gtccgacaaa ggcattgggg 120

ttcttgggtc tccgaaattc gccacccgtt actgtaagct gacctaacca cgaacttttg 180

tcgatcagtt ttttttatta tttatcttca ttttctttgg taactaaaga aacgtttctt 240

tttttgtgca gaaagactag aatttggcta ggaacattcg aaacggcaga ggatgcggct 300

cgagcctacg acgaggccgc aaggctaatg tgtgggccca gggcccgaac caacttccct 360

tacaatccga atttgtcgtc gcagtcgtcg tcgtcgaaac ttctctcggc tactttgaca 420

gccaaattgc acaaatgtta catggcttca cttcaattga ctcagcaatc aatgcaagtg 480

tcacaaagaa ttccaattcc aaatgttgtt gacaccaatt gcattattcg caatgggaat 540

gaaatggttg ggtggttgcc ggagatgaaa ccggtggtgg cggtggcgcc gccacagaag 600

gaggagagtt gggttgtgaa gaaagaacaa atggagggta tacaacaaca ggtcaaggct 660

cttgaagatg atcacattga gcaaatgatt gaggagttgc ttgattatgg gtccattatt 720

gagctctgcc ctgttgtccc atctcaggct actactatgt aatgtagacg aagtccaaag 780

catctcaatc accctcctct 800