1. The tea tree orphan gene CsOG3 is characterized in that the nucleotide sequence of the tea tree orphan gene CsOG3 is shown as a sequence table SEQ ID NO. 1.

2. The isolated tea gene CsOG3 of claim 1, wherein the protein sequence encoded by the isolated tea gene CsOG3 is as shown in SEQ ID No.2 of the sequence Listing.

3. The use of the tea tree orphan gene CsOG3 according to claim 1 or 2 for improving the cold tolerance of tea trees.

Background

Tea tree (Camellia sinensis (L.) o.kuntze) is an important economic crop in China. As perennial evergreen woody plants, tea trees are subjected to different stresses of adversities, such as low temperature, drought, high temperature, insect pests and other biotic and abiotic stresses in the growth process. As tea demand increases, the area of the global tea garden needs to be expanded to meet the supply, and these biotic and abiotic stresses greatly limit the growth of tea trees and the expansion of planting areas. In contrast, researchers have also conducted intensive studies on the stress resistance of tea trees to understand the response mechanism of tea trees under adversity stress, so as to breed new tea tree varieties with strong environmental adaptability. Tea tree prefers warm and aversion to cold, and is mainly distributed in tropical and subtropical regions and mountainous and hilly areas in temperate zone. The low-temperature natural disasters such as late spring cold, frost, snow freeze and the like can cause large-area yield reduction of the tea garden, the quality of the tea leaves is reduced, and the sustainable development of the tea industry in China is severely limited. The low temperature becomes one of the key factors for restricting the south planting and north moving of tea trees and the efficiency increase of tea yield. Therefore, from the perspective of genetic background of tea trees, the molecular mechanism of the tea trees for coping with low-temperature stress is clarified, and then the genetic improvement for assisting cold-resistant breeding of the tea trees has important significance for expanding the tea garden area and promoting the sustainable development of tea industry.

An Orphan gene (Orphan gene) is a gene that is unique in only one species or Lineage, but has no significant homologous sequences in other species or lineages, and is also known as a Lineage-specific gene (linear-specific genes), Taxonomic Restricted Genes (TRGs). This concept was first proposed by the french scientist Bernard Dujon in 1996 after completion of yeast genome sequencing. In recent years, the rapid development of high-throughput sequencing technology promotes the rapid development of animal and plant genome and transcriptomics research, and simultaneously, the orphan gene becomes a hot spot for comparative genomics research in the post-genomics era. Currently, studies on orphan genes have been widely focused on various species or groups of animals such as Drosophila (Drosophilae), mouse (Mus musculus), and human (Homo sapiens), plants such as Arabidopsis thaliana (Arabidopsis thaliana), rice (Oryza sativa), and orange (Citrus sinensis), and Saccharomyces cerevisiae (Saccharomyces cerevisiae). Studies have shown that orphan genes are widely present in the genomes of various organisms and play an important role in the unique biological traits and environmental adaptability of species or groups.

The analysis of the tea tree genome map provides important reference data and a brand-new scientific perspective for revealing the genetic basis of the tea tree for coping with adversity stress and forming tea quality from the perspective of orphan genes. However, the research of the orphan gene of the tea tree in regulating and controlling the stress of the tea tree to the adversity, particularly the low-temperature stress is not reported at present. Therefore, by researching the expression mode of the orphan gene under low temperature stress, the tea tree orphan gene responding to the low temperature stress is screened, and functional verification is carried out, so that the response mechanism of tea trees under the low temperature stress is clarified from the perspective of the orphan gene, and the cold resistance theory of the tea trees is enriched. The research can also establish data and theoretical foundation for promoting the north-south transplantation of the tea trees by improving the cold resistance of the tea trees by using the orphan gene, further enlarging the area of a tea garden and promoting the long-term development of the tea industry in China.

Disclosure of Invention

The invention aims to: the orphan tea gene CsOG3 and the application thereof in improving the cold tolerance of tea trees are provided, the molecular regulation mechanism theory of the tea trees for coping with low temperature stress is enriched, and an important target gene and reference foundation are provided for tea tree resistance breeding.

In order to achieve the above purpose, the invention provides the following technical scheme:

a tea tree orphan gene CsOG3 has a nucleotide sequence shown in a sequence table SEQ ID NO.1, wherein the nucleotide sequence of the tea tree orphan gene CsOG3 is shown in the sequence table SEQ ID NO. 1.

Preferably, the protein sequence coded by the tea tree orphan gene CsOG3 is shown as the sequence table SEQ ID NO. 2.

Preferably, the tea tree orphan CsOG3 has the function of improving the cold resistance of tea trees.

The invention has the beneficial effects that:

in the invention, the orphan gene CsOG3 is cloned for the first time and the molecular mechanism of participating in the low-temperature stress response of tea trees is verified. The invention also provides a recombinant plasmid, a transgenic engineering bacterium and a transgenic plant containing the CsOG3 gene. The invention enriches the cognition of the orphan gene of the tea tree and a new mechanism of the orphan gene in regulating and controlling the low-temperature response of the tea tree, and provides a theoretical and reference basis for resistance breeding of the tea tree.

Drawings

FIG. 1: the sequence cloning and the expression mode under low temperature stress of the orphan CsOG3 of the tea tree;

FIG. 2: CsOG3 response to transient expression in tobacco and low temperature stress treatment;

FIG. 3: influence of silent CsOG3 on cold resistance related physiological and biochemical indexes of tea trees under low temperature stress.

Detailed Description

Terms used in the present invention have generally meanings as commonly understood by one of ordinary skill in the art, unless otherwise specified.

The present invention will be described in further detail below with reference to specific production examples and application examples, and with reference to the data. It will be understood that these examples are intended to illustrate the invention and are not intended to limit the scope of the invention in any way.

In the following examples, various procedures and methods not described in detail are conventional methods well known in the art. The primers used are indicated for the first time and the same primers used thereafter are indicated for the first time.

Example 1:

1. cloning and sequence structure analysis of orphan tea plant gene CsOG3

The sequence cloning was carried out using young leaves of national grade elite Shucha of tea tree (planted in national high and new technology agricultural garden of Anhui agricultural university, 31 ° 56 'in northern latitude, 117 ° 12' in east longitude) as material. The extraction of the total RNA adopts a centrifugal column type plant total RNA rapid extraction kit of the Tiangen, and is carried out according to the operation steps of the kit specification. The total RNA content and quality were determined using a nucleic acid protein quantifier and gel electrophoresis.

Reverse transcription to synthesize cDNA: mu.g of total RNA was used as a template for reverse transcription reaction according to the PrimeScript II 1st Strand cDNA Synthesis Kit of TaKaRa, as follows: oligo dT Primer (50. mu.M) 0.6. mu.g, Random 6mers (50. mu.M) 0.4. mu.l, dNTP mix (10mM each) 1.0. mu.l were added, respectively, and RNase Free dH was used₂O is added to a constant volume of 10 mu L, denaturation is carried out for 5min at 65 ℃, and the mixture is immediately placed on ice for cooling; then, 4.0. mu.l of 5 XPrimeScript II Buffer, 0.5. mu.l of RNase Inhibitor (40U/. mu.l), 1.0. mu.l (200U/. mu.l) of PrimeScript II RTase, respectively, were added thereto, and RNase Free dH was added thereto₂Supplementing O to 20 μ l; pretreating at 30 ℃ for 10min, reverse transcribing at 42 ℃ for 45min, inactivating reverse transcriptase at 95 ℃ for 5min, immediately placing on ice after the reaction is finished, and detecting the content and quality of cDNA by using a nucleic acid protein quantifier.

The cDNA was used as a PCR template to clone the sequence of the orphan tea plant gene CsOG 3. The primer sequences used for PCR were as follows: an upstream primer (5'-ggccgctcgagtcgacccgggCTATTCCGCCGGTCTCTTCTT-3') and a downstream primer (5'-ggccgctcgagtcgacccgggCTATTCCGCCGGTCTCTTCTT-3'). The PCR reaction system is as follows: 2 XPhanta Max Buffer 50. mu.L, dNTP mix 2. mu.l, cDNA (100 ng/. mu.l) 4. mu.l, upstream and downstream primers 4. mu.l each, Phanta Max Super-Fidelity DNA Polymerase 2. mu.l, ddH₂O34. mu.l. The reaction procedure was (95 ℃ 3 min), (95 ℃ 15sec, 54 ℃ 15sec, 72 ℃ 35sec, 30 cycles (72 ℃ C.) for 5 min. The PCR product CsOG3 gene is connected to a pGEX-4T-1 vector obtained by double enzyme digestion (enzyme digestion site: 5'BamHI, 3' SmaI) after purification and recovery to obtain pGEX-4T-1-CsOG3 plasmid, transformed into an escherichia coli competent cell DH5 alpha, sent to a general biological system (Anhui) Limited company for sequencing,

the obtained tea tree orphan gene CsOG3 has a nucleotide sequence shown in a sequence table SEQ ID NO.1, and specifically comprises the following steps:

ATGGCTTCGTCTTCCCGTGGTCTGCTCACTCTCTTTCCAGACCTTAACGAGTCAACAAGAGAGATAACTGGTGCGGGGGCCAGTGAACCTCAACCAAGCGCCCCGGGGTTTGCTCCGTTGAACTTTCCTATGCGGTCTGTGGAGCAAAAAATGGCAGTGCAAACTGACATTGAAGCCAATCAGTATACTTTGAAGTCCTGTGTGGAGACGATGACGGCAGTCACAAACTTGTCGCACCGGCTGCAGAGTAGGACAAATGAGGTGCAACAGTTAAACTCCCAGCTGGCTCTGCTCCAACGCATGTATAAGGATGCGCGAGTAGAGATAAGTGTGCTAAAGACAGAAAACAAGGAGCTGAAGCGGAAGGCCACCGTGATGTTCCGATTTGGAGGTCCACCATATGCTGTAGTGGAGGAGCAGGGAGGAGGAAACTTGCTTGGTGGTCTAGGAAGCACGGAGGCAACACCGGCAAGGGCCGCCCAGGACAGGGGCAAAAAGAAGAGACCGGCGGAATAG

the protein sequence coded by the tea tree orphan gene CsOG3 is shown in a sequence table SEQ ID NO.2 and specifically comprises the following steps:

MASSSRGLLTLFPDLNESTREITGAGASEPQPSAPGFAPLNFPMRSVEQKMAVQTDIEANQYTLKSCVETMTAVTNLSHRLQSRTNEVQQLNSQLALLQRMYKDARVEISVLKTENKELKRKATVMFRFGGPPYAVVEEQGGGNLLGGLGSTEATPARAAQDRGKKKRPAE。

2. expression pattern of tea tree orphan gene CsOG3 under low-temperature treatment

The tea trees used for low-temperature treatment are national-grade fine-variety Shucha early varieties and are planted in the Daichong agriculture extraction garden (31 degrees in northern latitude and 52 degrees in east longitude and 117 degrees in east longitude and 15 degrees) of Anhui agriculture. The potted tea tree is put at 4 ℃ for low-temperature treatment, and sample collection, total RNA extraction and quantitative PCR (qRT-PCR) are respectively carried out for 0h, 2h, 6h, 12h, 1d, 2d, 3d and 7 d.

qRT-PCR Using 20-fold dilution of reverse transcription product as templateqPCRGreen Master Mix (No Rox), prepare 20. mu.l reaction: mu.l of 20-fold diluted reverse transcription product, 0.4. mu.l (10. mu.M) of each of the upstream and downstream primers, 10. mu.lqPCR SYBR Green Master Mix (Yeasen, Shanghai, China), 7.2. mu.l sterile ddH₂O, 3 replicates per reaction. Then program on Bio-rad CFX-96: the melting curve is drawn from 65 ℃ to 95 ℃ by 40 cycles of 95 ℃ for 3min, 95 ℃ for 10s, 60 ℃ for 15s and 72 ℃ for 30s and at 0.1 ℃/s. An upstream primer: (5'-GCGAGTAGAGATAAGTGTGCTAA-3'), the downstream primer: (5'-GTTGCCTCCGTGCTTCCTA-3'), taking tea tree ACTIN gene as internal reference, and upstream primer: (5'-GCCATCTTTGATTGGAATGG-3'), downstream primer: (5'-GGTGCCACAACCTTGATCTT-3') use 2^-△△CTThe method is used for calculating and analyzing the relative expression quantity of the orphan gene of the tea tree.

FIG. 1 is a graph showing the cloning results of the tea tree orphan gene CsOG3 and the expression pattern under different tissues and low temperature stress. Wherein A: electropherograms of CsOG3 PCR results; b: CsOG3 is connected with an electrophoretogram for PCR verification of transformed bacteria liquid; c: CsOG3 sequence feature information; d: the expression pattern of CsOG3 in representative tea plant tissue; e: expression pattern of CsOG3 under low temperature stress.

As shown in FIG. 1, the CDS sequence of the successfully cloned tea tree orphan gene CsOG3 is 516bp in length, the protein is 171aa in length, the GC content is 53.10%, the protein molecular weight is 18.64kDa, and the isoelectric point is 9.54. Through qRT-PCR technical analysis, the relative expression quantity of the tea tree orphan gene CsOG3 after low-temperature treatment for 0h, 2h, 6h, 12h, 1d, 2d, 3d and 7d is obtained, and the result shows that the CsOG3 is induced to be up-regulated and expressed after low-temperature treatment for 1 d. CsOG3 is constitutively expressed in tea plant, and has higher expression level in bud and tender leaf.

3. Transient expression of the CsOG3 gene in tobacco.

(1) CsOG3-pCambia1305.1 vector construction

pGEX-4T-1-CsOG3 plasmid was used as a template, and primers: the upstream primer (5'-gtctcgaggaccggtcccgggATGGCTTCGTCTTCCCGTG-3') and the downstream primer (5'-gtctcgaggaccggtcccgggATGGCTTCGTCTTCCCGTG-3') were used for PCR amplification. The amplified product was ligated to a double restriction enzyme (restriction site: 5'SmaI, 3' BamHI) and the recovered overexpression vector pCambia1305.1-GFP was purified to give CsOG3-pCambia1305.1-GFP plasmid. Transformed into Mach1-T1 strain at room temperature, cultured overnight, screened for positive colonies, and sent to general biological systems (Anhui) Inc. for sequencing verification.

(2) Tobacco transient expression transformation

Adding deionized water into proper amount of Nicotiana benthamiana seeds, vernalizing in a refrigerator at 4 deg.C, and sowing three days after vernalization. After sowing, covering with preservative film, placing in greenhouse to adjust suitable conditions (humidity 60%, temperature 25 ℃, photoperiod 16h light/8 h dark), after seed germination, selecting seedling with consistent size for transplanting, and culturing in normal greenhouse. The CsOG 3-pCambi1305.1-GFP plasmid was transformed into the GV3101 Agrobacterium by cold shock and positive clones were identified by conventional PCR. Selecting positive colonies containing target genes, and culturing in 5ml LB liquid culture medium containing Kan and Rif antibiotics at 28 deg.C and 200r/min overnight; sucking 1mL of the cultured bacterial liquid, adding the bacterial liquid into 100mL of LB liquid culture medium containing Kan and Rif antibiotics, carrying out shaking overnight culture at 28 ℃ at 200r/min until the OD600 is about 0.8, centrifuging 5000g for 15min, collecting thalli, carrying out heavy suspension on the thalli by using a heavy suspension (10mM MgCL 2; 10mM MES) until the final OD600 is 0.4, adding 100uM Acetosyringone (AS), standing at the room temperature for 2-3 h, and injecting tobacco. Dark culture is carried out for 12h after injection, low-temperature treatment is carried out for 0h, 6h and 12h after normal culture is carried out for 3 days, liquid nitrogen is used for sample fixation, samples are rapidly ground, and the expression level of the tea tree orphan gene CsOG3 in the tobacco, the chlorophyll fluorescence map, the Fv/Fm value, the malondialdehyde content, the superoxide dismutase activity and the catalase activity of the tobacco are measured.

FIG. 2 is a graph showing the results of tobacco transient expression CsOG3 and low temperature stress treatment. Wherein A: expression levels of CsOG3 control group (CK) and transiently expressed tobacco (CsOG 3-pCambi1305.1-GFP) under low temperature stress; b: results of chlorophyll-fluorometric irradiation of CK and CsOG 3-pCambi1305.1-GFP after cryotreatment (0 ℃ for 1h, 30min recovery at ambient temperature); c: (iii) Fv/Fm values after cold treatment of CK and CsOG 3-pCambi1305.1-GFP; d: transiently expressing the content of malondialdehyde in tobacco leaves of CsOG3 tobacco and CK after low-temperature treatment; e: transiently expressing the activity of total superoxide dismutase in tobacco leaves of CsOG3 tobacco and CK after low-temperature treatment; f: transiently expressing the catalase activity of CsOG3 tobacco and CK in tobacco leaves after the low-temperature treatment.

As shown in fig. 2, after the low-temperature treatment for 6h and 12h, it was seen that the tobacco material transiently expressing CsOG3 had significantly increased activities of superoxide dismutase (SOD) and Catalase (CAT) after the low-temperature treatment for 6h, decreased malondialdehyde increase, and had higher Fv/Fm values, and the degree of leaf damage was significantly reduced, compared to the control group.

4. Functional verification of CsOG3 gene in tea tree

(1) In vitro antisense oligonucleotide inhibition assay

Designing and synthesizing antisense oligonucleotide primer according to sequence obtained by CsOG3 sequencing, wherein the antisense oligonucleotide primer is designed at websitehttp://sfold.wadsworth.org/cgi-bin/soligo.plThe above was done and the specificity was determined by alignment of the BioEdit software with the genomic database of tea tree (Shucha Zao), the primer sequences are shown:

P1，(5'-GCAGACCACGGGAAGACGAAGCCAT-3')；

P2，(5'-CCCGCACCAGTTATCTCTCTTGTTG-3')；

P3，(5'-CAAGTTTGTGACTGCCGTCATCGTC-3')；

dissolving in sterilized water, preparing and obtaining in-vitro antisense oligonucleotide inhibition buffer solution, and taking the sterilized water as a blank control; a pair of buds and two leaves with basically consistent size, healthy color and no plant diseases and insect pests are cut by scissors and inserted into a 1.5ml centrifuge tube filled with 1ml of 10 mu M primer solution (or sterilized water), so that the tails of the two leaves of the buds are ensured to be immersed in the solution, and the tube opening is sealed by a breathable sealing film to prevent the solution from volatilizing to cause experimental errors. Placing the centrifuge tube into a light incubator for light culture according to 16 h/8 h of light, and setting the temperature of the incubator to be 25 ℃. After the treatment for 1d, the primer-treated sample and the blank sample were respectively sampled for gene expression analysis.

(2) In vitro antisense oligonucleotide inhibition sample low temperature treatment

The method comprises the following steps of carrying out low-temperature treatment on tea tree bud leaves successfully inhibiting the tea tree orphan gene CsOG3 at 0 ℃ for 1h, carrying out dark recovery at 25 ℃ for 30min, measuring the net photosynthetic rate and the maximum photochemical efficiency of a photosystem II (Fv/Fm) by using a chlorophyll fluorescence instrument after the recovery is finished, establishing a related kit of a bioengineering research institute by using Nanjing, measuring the malonaldehyde content, the superoxide dismutase activity and the catalase activity, and taking the bud leaves which are not subjected to silent treatment as a control, wherein each experiment is not less than 3 biological repetitions.

(3) Expression analysis of in vitro antisense oligonucleotide for inhibiting tea tree CsOG3

And (3) extracting total RNA from the treated sample and the control sample respectively, then carrying out reverse transcription, synthesizing cDNA, and detecting related gene expression by using qRT-PCR. Firstly, the gene expression level of CsOG3 in a control sample and a treated sample is detected, and the result shows that the in vitro antisense oligonucleotide inhibition can obviously reduce the expression level of CsOG3 by about 4 times. Compared with a control group, the tea leaf sheet for silencing the tea tree orphan gene CsOG3 is greenish or even yellowish in color, which indicates that the tea leaf sheet is more seriously damaged. The Fv/Fm values of the control group were significantly higher than the CsOG3 treated group (p <0.01), indicating that the maximum photosynthesis rate of the control group was greater than the treated group. The content of malondialdehyde in tea leaves inhibiting CsOG3 expression is obviously higher than that in the control group (p < 0.01). The activities of total superoxide dismutase and catalase in tea tree bud leaves inhibiting CsOG3 are obviously lower than those of a control group (p < 0.01).

FIG. 3 shows the effect of silencing tea tree orphan CsOG3 on the cold resistance of tea trees. Wherein A: expression levels of CsOG3 in control (SODN) and silenced (ASODN) tea bud leaves after 1d treatment; b: the chlorophyll content of the ASODN is reduced after low-temperature treatment (0 ℃ for 1h and normal temperature recovery for 30 min); Fv/Fm values (C) after cryogenic treatment of SODN and ASODN, malondialdehyde content (D), total superoxide dismutase activity (E) and catalase activity (F).

As shown in FIG. 3, through in vitro antisense oligonucleotide experiments and the results of measurement of the expression level of CsOG3 gene, the damage degree of tea tree leaves and related enzyme activity after 1d of low-temperature treatment, it can be seen that compared with a control group, the inhibition of the expression of the tea tree orphan gene CsOG3 significantly increases the damage degree of tea tree leaves under the low-temperature condition and the content of malondialdehyde, and reduces the activities of superoxide dismutase (SOD) and Catalase (CAT).

In conclusion, the tea tree orphan gene CsOG3 and the protein coded by the same can obviously improve the low-temperature tolerance of tea trees. The clone of the orphan gene CsOG3 of the tea tree and the effect thereof in the low-temperature response process of the tea tree are beneficial to increasing the understanding of the orphan gene participating in the adversity response of the tea tree, provide an important target gene for resistance breeding of the tea tree, and have great application value.

In the invention, the molecular mechanism of the orphan gene CsOG3 participating in the low-temperature stress response of tea trees is cloned and verified for the first time, and the invention also provides a recombinant plasmid, a transgenic engineering bacterium and a transgenic plant containing the CsOG3 gene. The invention improves the understanding of orphan genes of tea trees and the functions thereof, enriches the regulation mechanism theory of tea trees under low-temperature stress and provides important target genes and theoretical reference basis for resistance breeding of tea trees.

The foregoing is an illustrative description of the invention, and it is clear that the specific implementation of the invention is not restricted to the above-described manner, but it is within the scope of the invention to apply the inventive concept and solution to other applications without substantial or direct modification.

Sequence listing

<110> agriculture university of Anhui

<120> tea tree orphan CsOG3 and application thereof in improving cold resistance of tea trees

<130> NO

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 516

<212> DNA

<213> tea tree (Camellia sinensis L.O. Kuntze)

<400> 1

atggcttcgt cttcccgtgg tctgctcact ctctttccag accttaacga gtcaacaaga 60

gagataactg gtgcgggggc cagtgaacct caaccaagcg ccccggggtt tgctccgttg 120

aactttccta tgcggtctgt ggagcaaaaa atggcagtgc aaactgacat tgaagccaat 180

cagtatactt tgaagtcctg tgtggagacg atgacggcag tcacaaactt gtcgcaccgg 240

ctgcagagta ggacaaatga ggtgcaacag ttaaactccc agctggctct gctccaacgc 300

atgtataagg atgcgcgagt agagataagt gtgctaaaga cagaaaacaa ggagctgaag 360

cggaaggcca ccgtgatgtt ccgatttgga ggtccaccat atgctgtagt ggaggagcag 420

ggaggaggaa acttgcttgg tggtctagga agcacggagg caacaccggc aagggccgcc 480

caggacaggg gcaaaaagaa gagaccggcg gaatag 516

<210> 2

<211> 171

<212> PRT

<213> tea tree (Camellia sinensis L.O. Kuntze)

<400> 2

Met Ala Ser Ser Ser Arg Gly Leu Leu Thr Leu Phe Pro Asp Leu Asn

1 5 10 15

Glu Ser Thr Arg Glu Ile Thr Gly Ala Gly Ala Ser Glu Pro Gln Pro

20 25 30

Ser Ala Pro Gly Phe Ala Pro Leu Asn Phe Pro Met Arg Ser Val Glu

35 40 45

Gln Lys Met Ala Val Gln Thr Asp Ile Glu Ala Asn Gln Tyr Thr Leu

50 55 60

Lys Ser Cys Val Glu Thr Met Thr Ala Val Thr Asn Leu Ser His Arg

65 70 75 80

Leu Gln Ser Arg Thr Asn Glu Val Gln Gln Leu Asn Ser Gln Leu Ala

85 90 95

Leu Leu Gln Arg Met Tyr Lys Asp Ala Arg Val Glu Ile Ser Val Leu

100 105 110

Lys Thr Glu Asn Lys Glu Leu Lys Arg Lys Ala Thr Val Met Phe Arg

115 120 125

Phe Gly Gly Pro Pro Tyr Ala Val Val Glu Glu Gln Gly Gly Gly Asn

130 135 140

Leu Leu Gly Gly Leu Gly Ser Thr Glu Ala Thr Pro Ala Arg Ala Ala

145 150 155 160

Gln Asp Arg Gly Lys Lys Lys Arg Pro Ala Glu

165 170