1. The application of the rice OsAKR4C10 gene in regulating the absorption and accumulation of glyphosate in rice is characterized in that the nucleotide sequence of the rice OsAKR4C10 gene is shown as SEQ ID NO: 2 is shown in the specification; or with SEQ ID NO: 2, and encodes a nucleotide sequence shown as SEQ ID NO: 1, or a nucleotide sequence of the amino acid shown in the specification.

2. The application of the rice OsAKR4C10 protein in regulating the absorption and accumulation of glyphosate in rice is characterized in that the amino acid sequence of the rice OsAKR4C10 protein is shown as SEQ ID NO: 1 is shown in the specification; or SEQ ID NO: 1 by substitution and/or deletion and/or addition of one or more amino acid residues, and/or the like.

3. The application of the rice OsAKR4C10 gene in culturing glyphosate-resistant rice varieties is characterized in that the nucleotide sequence of the rice OsAKR4C10 gene is shown as SEQ ID NO: 2 is shown in the specification; or with SEQ ID NO: 2, and encodes a nucleotide sequence shown as SEQ ID NO: 1, or a nucleotide sequence of the amino acid shown in the specification.

4. The application of the rice OsAKR4C10 protein in culturing glyphosate-resistant rice varieties is characterized in that the amino acid sequence of the rice OsAKR4C10 protein is shown as SEQ ID NO: 1 or SEQ ID NO: 1 by substitution and/or deletion and/or addition of one or more amino acid residues, and/or the like.

5. The use of claim 3 or 4, wherein the glyphosate-resistant rice variety is obtained by inhibiting the expression of OsAKR4C10 gene in rice or inhibiting the expression level and/or activity of OsAKR4C10 protein.

6. The use according to claim 3, wherein the inhibition of the expression of OsAKR4C10 gene, or the inhibition of the expression level and/or activity of OsAKR4C10 protein in rice is achieved by gene editing, RNA interference, homologous recombination or gene knock-out.

7. The use of claim 6, wherein the gene editing is carried out to construct a rice CRISPR-Cas9 system, and the system contains sgRNA for recognizing a rice OsAKR4C10 gene target sequence.

8. The use of claim 7, wherein the sequence of the target is as set forth in SEQ ID NO: 3, respectively.

Background

The rice is the main grain of about 22 hundred million people all over the world, wherein proper weed control is the key for ensuring the quality and the yield of the rice, the manual removal and biological control modes have low efficiency and high cost, and the herbicide can well overcome the defects and is still the most important control means at present. At present, the types of herbicides in rice fields are more than ten, the control objects are different, the use technical requirements are different, and the problems of herbicide phytotoxicity, excessive pesticide residues, increase of tolerant weed groups and the like are easily caused.

The glyphosate is in the leading position of herbicide all the year round due to the characteristics of broad spectrum, high efficiency, no harm to human and livestock and good environmental compatibility, but is also restricted by the non-selective killing of the glyphosate on rice, so that the glyphosate cannot be applied to a large area in a rice field. However, the cultivation of glyphosate-resistant rice is a commonly used coping method at present, for example, chinese patent CN107129993A discloses a modified glyphosate-resistant gene and a cultivation method of glyphosate-resistant rice, chinese patents CN106497922A, CN106497924A, CN106497923A and the like disclose construction methods of glyphosate-resistant transgenic rice of borer resistance, and the methods all culture glyphosate-resistant transgenic rice varieties by genetically transforming exogenous glyphosate-resistant genes into rice. However, the exogenous transfer of resistance genes has the problems of long research and development time, low efficiency and gene pollution; the problems can be better solved by exploring the endogenous glyphosate transporter gene of the rice and inactivating the glyphosate transporter gene by a plant genetic engineering technology. However, related genes which play a role in regulating the glyphosate absorption and accumulation of rice are rarely reported in rice at present.

Disclosure of Invention

The invention aims to overcome the defects in the prior art and provide the application of the rice OsAKR4C10 gene in regulating the absorption and accumulation of glyphosate in rice.

The second purpose of the invention is to provide the application of the rice OsAKR4C10 gene in the establishment of non-transgenic glyphosate-resistant rice germplasm resources.

The above object of the present invention is achieved by the following technical solutions:

the research of the invention shows that the rice OsAKR4C10 gene knockout can inhibit the absorption and accumulation of the rice on glyphosate, reduce the glyphosate content in the rice and improve the resistance of the rice on the glyphosate; the gene editing technology is utilized to carry out gene editing on OsAKR4C10 gene of a main production cultivar to obtain a glyphosate-resistant rice cultivar, and the glyphosate-resistant rice cultivar is obtained by sexual or asexual propagation. Therefore, the present invention provides the following applications of the rice OsAKR4C10 gene and OsAKR4C10 protein:

the application of the rice OsAKR4C10 gene in regulating the absorption and accumulation of glyphosate in rice is disclosed, wherein the nucleotide sequence of the rice OsAKR4C10 gene is shown as SEQ ID NO: 2 is shown in the specification; or with SEQ ID NO: 2, and encodes a nucleotide sequence shown as SEQ ID NO: 1, or a nucleotide sequence of the amino acid shown in the specification.

The application of rice OsAKR4C10 protein in regulating the absorption and accumulation of glyphosate in rice is disclosed, wherein the amino acid sequence of the rice OsAKR4C10 protein is shown as SEQ ID NO: 1 is shown in the specification; or SEQ ID NO: 1 by substitution and/or deletion and/or addition of one or more amino acid residues, and/or the like.

SEQ ID NO: 1:

MAKHFVLNTGAKIPSVGLGTWQSDPGVVGDAVYAAVKAGYRHIDCARMYKNENEVGIALKKLFEEGVVKREDLFITSKLWCDCHAPEDVPESLDKTLSDLQLEYLDLYLIHWPFRVKKGSGISNTEDYIPPDIPSTWGAMEKLYDSGKSRAIGVSNFSSKKLGDLLAVACVPPAVDQVECHPGWQQTKLHNFCQSTGVHLSAYSPLGSPGSTWMNSNVLKESVIISIAEKLGKTPAQVALHWNIQMGHSVLPKSVTEERIKQNIDVYDWSIPEDLLVKFSEIKQVRLLRGDVIVNPHSVYKTHEELWDGEI.

SEQ ID NO: 2:

atggcgaagcatttcgtgctcaacaccggcgccaagatcccctcggtggggctcggcacctggcagtccgacccgggcgtcgtcggcgacgccgtctacgccgctgtcaaggcggggtaccggcacatcgattgcgccagaatgtacaaaaatgaaaatgaggtggggatagctctgaagaagctatttgaagaaggtgttgtcaagcgtgaagatttatttatcacatctaagctatggtgtgattgtcatgccccagaggatgtgcctgagtcactagacaaaactctgagtgacttacagcttgagtacctggatctttaccttattcattggccattcagagtcaagaagggctcaggcattagtaacactgaagactacataccacctgacatcccatctacctggggagcaatggagaagctatatgattctggtaaatctcgtgccattggtgtaagtaacttctcatcaaaaaaactgggtgacctgcttgctgtagcctgtgtacctccagctgttgatcaggtagaatgccatcctggttggcagcaaacgaagctacataacttctgccagtcaactggcgttcatctttctgcatactcgcctctaggttcacctggttcaacatggatgaacagtaacgtccttaaggaatccgtcatcatctcaattgcagagaagctcggcaaaactcctgcacaagtggcactgcactggaacattcagatgggtcacagtgtactcccaaaaagtgtgaccgaagaaaggataaagcagaacatagatgtttatgactggtctattccagaggacttgcttgttaagttctctgagattaagcaggttaggcttctcaggggcgacgtcattgttaatccccacagcgtttataagacccatgaggagctctgggacggcgaaatttag

the application of the rice OsAKR4C10 gene in culturing glyphosate-resistant rice varieties is characterized in that the nucleotide sequence of the rice OsAKR4C10 gene is shown as SEQ ID NO: 2 is shown in the specification; or with SEQ ID NO: 2, and encodes a nucleotide sequence shown as SEQ ID NO: 1, or a nucleotide sequence of the amino acid shown in the specification.

The application of the rice OsAKR4C10 protein in culturing glyphosate-resistant rice varieties is disclosed, wherein the amino acid sequence of the rice OsAKR4C10 protein is shown as SEQ ID NO: 1 or SEQ ID NO: 1 by substitution and/or deletion and/or addition of one or more amino acid residues, and/or the like.

Specifically, the glyphosate-resistant rice variety is obtained by inhibiting the expression of OsAKR4C10 gene in rice or inhibiting the expression quantity and/or activity of OsAKR4C10 protein.

Optionally, the inhibition of the expression of the OsAKR4C10 gene in rice, or the inhibition of the expression level and/or activity of the OsAKR4C10 protein is performed by a conventional method in the field, such as gene editing, RNA interference, homologous recombination or gene knockout.

Optionally, the gene editing is to construct a rice CRISPR-Cas9 system, and the system contains sgRNA recognizing a rice OsAKR4C10 gene target sequence.

Optionally, the sequence of the target is as set forth in SEQ ID NO: 3, respectively.

AGGTGCCGAGCCCCACCGAGGGG(SEQ ID NO：3)。

The invention obtains the glyphosate resistant rice germplasm resource by taking low-absorption glyphosate as a mechanism through the functional identification of the glyphosate transporter gene of the rice and the inactivation of the glyphosate transporter gene by utilizing a plant gene editing technology. The advantages are that: the characteristics of efficient killing of glyphosate are exerted to simplify weeding in the rice field and prolong the suitable weeding period; the problems of long research and development time, low efficiency and gene pollution caused by exogenous transfer of resistance genes into conventional glyphosate-resistant crops are avoided; most importantly, the glyphosate conductance selectivity is realized in weeds and crops, the cumulant and the application amount of glyphosate in rice are reduced while weeds are killed, the method is environment-friendly and ecological, and a new thought can be provided for accelerating the innovation of biological breeding and ensuring the national food safety.

Compared with the prior art, the invention has the following beneficial effects:

the invention provides application of a rice OsAKR4C10 gene in regulation of glyphosate absorption and accumulation of rice, and the research of the invention shows that the rice OsAKR4C10 gene knockout can inhibit the absorption and accumulation of herbicide glyphosate of rice, reduce the content of glyphosate in rice plants and reduce the health risk to human bodies; meanwhile, the rice OsAKR4C10 gene is knocked out, so that the absorption and accumulation of the rice on glyphosate can be genetically regulated, the resistance of the rice on the glyphosate is improved, and a glyphosate-resistant rice variety is bred. The method combines the glyphosate absorption accumulation and resistance mechanism, provides a good choice for the research of herbicide-resistant crops, can be used for creating non-transgenic glyphosate-resistant rice germplasm resources, and has a great application prospect.

Drawings

FIG. 1 is a diagram showing the results of sequence alignment of mutants of Zhonghua No. 11 and OsAKR4C10 genes.

FIG. 2 is a graph showing the real-time fluorescent quantitative PCR detection results of OsAKR4C10 gene at different times after glyphosate spray treatment of flower No. 11. (A) The OsAKR4C10 gene expression condition of the rice overground part; (B) the OsAKR4C10 gene expression condition of the underground part of the rice.

FIG. 3 shows the glyphosate tolerance of the Zhonghua No. 11 and OsAKR4C10 gene mutants in the seed germination stage. (A) Comparing the seedling bud length of WT and osakr4c10 in the glyphosate tissue culture medium with different concentrations; (B) WT was compared with the length of the aerial part of the seedlings in osakr4c10 tissue culture medium of different concentrations; (C) WT was compared to osakr4c10 for root length in different concentrations of glyphosate tissue culture medium.

FIG. 4 is a graph showing the results of measurements of the accumulation of different parts of the Zhonghua No. 11 and OsAKR4C10 gene mutants after glyphosate absorption at the roots of seedlings. (A) Leaf glyphosate accumulation; (B) a stem glyphosate accumulation amount; (C) the accumulated amount of glyphosate at the root; (D) and detecting the peak patterns of the glyphosate and a metabolite AMPA thereof by LC-MS/MS.

FIG. 5 shows the tolerance of the Zhonghua No. 11 and OsAKR4C10 gene mutants after glyphosate soaking of leaves in adult plants. (A) Observing the phenotype of the leaves after being soaked in glyphosate of 5.75 mmol/L; (B) observing the phenotype of the leaves after being soaked in 11.5mmol/L glyphosate; (C) soaking in 5.75mmol/L glyphosate to obtain Fv/Fm of the leaf; (D) Fv/Fm of leaves after soaking in 11.5mmol/L glyphosate.

FIG. 6 shows the tolerance of the Zhonghua No. 11 and OsAKR4C10 gene mutants after spraying glyphosate in the adult stage.

FIG. 7 shows the change of chlorophyll content of the Zhonghua No. 11 and OsAKR4C10 gene mutants after spraying glyphosate in the adult stage. (A) The chlorophyll content of WT and osakr4c10 rice leaves sprayed with 3.6mM glyphosate changes; (B) the chlorophyll content of rice leaves under the condition that 10.8mM glyphosate is sprayed on WT and osakr4c10 is changed.

FIG. 8 shows the tolerance of the OsAKR4C10 gene mutant and its filial generation sprayed with glyphosate in the adult stage, both of which are the Chinese No. 1 and Guiyu No. 11 background.

Detailed Description

The invention is further described with reference to the drawings and the following detailed description, which are not intended to limit the invention in any way. Reagents, methods and apparatus used in the present invention are conventional in the art unless otherwise indicated.

Unless otherwise indicated, reagents and materials used in the following examples are commercially available.

Coli DH 5. alpha. and Agrobacterium EHA105, which are commonly used strains in the following examples, are commercially available; the rice variety is wild type Zhonghua No. 11 (publicly used rice variety, commercially available). The primers used in the examples were synthesized by Shenzhen Huamao Gene Co, and the sequencing was performed by Shenzhen Huamao Gene Co.

The quantitative tests in the following examples, all set up three replicates and the results averaged.

Example 1CRISPR knockout construction of OsAKR4C10 mutant plants

1. Selection of target sequences based on exon sequences of OsAKR4C10 using CRISPR/Cas9 system

Selecting a specific target sequence according to an OsAKR4C10 exon sequence by utilizing a simple and efficient CRISPR/Cas9 system, wherein the target sequence comprises the following steps: 5'-AGGTGCCGAGCCCCACCGAGGGG-3' are provided. The target sequence is specific to OsAKR4C10 gene and inactivates OsAKR4C10 protein.

2. Construction of pCRISPR/Cas9 recombinant vector containing the target sequence fragment

1) Design of adaptor primer with cohesive end according to target sequence

The designed target sequence is added to the specific sticky-end linker of the pCRISPR/Cas9 system and the complete linker primer is synthesized.

F1：5’-TGTGTGGGTGCCGAGCCCCACCGAG-3’；

R1：5’-AAACCTCGGTGGGGCTCGGCACCCA-3’。

2) Annealing and complementing the adaptor primer with the cohesive end to form a double-stranded small fragment with the cohesive end

Diluting the F1 primer and the R1 primer into 10 mu M solutions, uniformly mixing 10 mu L of each solution, carrying out annealing reaction in a PCR instrument, reducing the temperature from 98 ℃ to 22 ℃, and enabling the F1 primer and the R1 primer to be complementary to form a double-stranded small fragment with a sticky end.

3) Cleavage of the original vector pOs-sgRNA containing sg-RNA (TAKARA Cat #632640)

The original vector pOs-sgRNA containing sg-RNA was digested with the restriction enzyme Bsa I, resulting in cohesive ends which could be complementary to the cohesive ends of the target sequence. The pOs-sgRNA original vector system was digested with Bsa I: 10 × buffer 2. mu. L, Bsa I enzyme 1. mu. L, pOs-sgRNA vector 4. mu.g, ddH₂The amount of O is up to 20. mu.L, and the enzyme is cleaved at 37 ℃ for 12 h. Checking the size of the cut enzyme product with 1% agarose gel electrophoresis, purifying the cut enzyme product with a column chromatography kit (OMEGA Cat # D2500-02) to obtain pOs-sgRNA vector, adding sterilized ddH₂Dissolving O, and measuring the concentration for later use.

4) Ligating double-stranded small fragments with cohesive ends to the digested pOs-sgRNA vector to form a recombinant vector comprising the target sequence and sg-RNA

Connecting the double-stranded small fragment in the step 2) with the pOs-sgRNA vector cut in the step 3) by using T4 ligase to form a complete recombinant vector containing a target sequence aiming at the OsAKR4C10 protein and sg-RNA. The 15 μ L linker is: 10 XT 4 ligation buffer 1.5 uL, double-stranded small fragment 4 uL, enzyme-cleaved pOs-sgRNA vector 3 u L, T4 DNA ligation buffer 1 u L, ddH₂O to 15. mu.L, and ligation was performed at 16 ℃ for 12 hours. The ligation product was transformed into E.coli DH 5. alpha. and kanamycin-resistant LB plates were cultured overnight (10 mg/L kanamycin), and positive strains were selected for sequencing to obtain correctly sequenced recombinant vectors containing the target sequence and sg-RNA.

5) LR reaction recombination of a recombinant vector comprising a target sequence and sg-RNA with LR mix, vector pH-Ubicas9-7 comprising Cas9, to form a complete recombinant vector comprising the target sequence-sg-RNA + Cas9

LR mix (North Noro Biotech Co., Ltd, Shanghai) was used to recombine the recombinant vector obtained in step 4) with LR reaction using pH-Ubi-Cas9-7 (supplied by Baige Gene science Co., Ltd) which is a vector containing Cas 9. LR reaction system: 25-50ng of recombinant vector containing target sequence and sg-RNA, 75ng of pH-Ubi-cas9-7 vector, 1. mu.L of 5 xlR clone TM Buffer, TE Buffer (pH8.0) were supplemented to 4.5. mu.L, LR clone TM 0.5. mu.L. The system is incubated for 2h at 25 ℃,2 mu L of 2 mu g/mu L of protease K is added after reaction, the reaction product is treated for 10min at 37 ℃, then 2 mu L of reaction product is transferred into escherichia coli DH5 alpha, gentamicin resistance LB plate is cultured overnight at 37 ℃, positive strains are selected for sequencing, and the complete pCPR RIS/Cas 9-OsAKR4C10 recombinant expression vector containing OsAKR4C10 protein target sequence-sg-RNA + Cas9 with correct sequencing is obtained.

3. The obtained complete recombinant vector containing the OsAKR4C10 protein target sequence-sg-RNA + Cas9 is introduced into rice callus to obtain a transgenic plant

1) And (3) transferring the recombinant expression vector pCRISPR/Cas9-OsAKR4C10 obtained in the step (2) into agrobacterium EHA105 (Olivia C.D,2019) by electric shock to obtain a recombinant bacterium AGL1/pCRISPR/Cas9-OsAKR4C 10.

2) The recombinant strain AGL1/pCRISPR/Cas9-OsAKR4C10 is used for transforming medium-flower No. 11 rice callus by an agrobacterium-mediated method, which comprises the following steps:

AGL1/pCRISPR/Cas9-OsAKR4C10 single colony is picked up, inoculated into 10mL of agrobacterium culture medium (containing 50mg/L kanamycin and 50mg/L rifampicin), and shake-cultured at 28 ℃ and 180rpm for 2-3 days. Centrifuging 4mL of bacterial solution at 4000rpm for 3min, pouring out the supernatant, adding a small amount of AAM culture medium to reconstitute the suspended cells, adding 20mL of AAM culture medium (containing 0.1mM acetosyringone As), performing shake cultivation at 28 deg.C and 150rpm in the dark for 1-2h, and culturing to OD₆₀₀About 0.4. Selecting and soaking granular Zhonghua No. 11 (also called wild rice below) rice callus with good growth state into agrobacterium culture solution (YEP without agar), shaking at 28 ℃ and 200rpm for 20min, pouring out the callus, sucking excess bacteria solution with sterile filter paper, spreading the callus in a sterile plate containing multiple layers of filter paper, drying on an ultra-clean bench (the callus is dispersed and not caked), transferring the callus onto a co-culture medium, and culturing for 2-3 days under dark condition. The calli were transferred to NB minimal medium containing 100mg/L hygromycin and 400mg/L cefamycin for 3-4 weeks (one screen). The surviving calli were transferred to a secondary screening medium (NB minimal medium containing 100mg/L hygromycin and 200mg/L cefuroxime) for 3 weeks. Transferring the resistant callus to a differentiation culture medium (containing 100mg/L hygromycin) for differentiation, transferring a regenerated plant to a greenhouse after rooting (about 3-4 weeks) on a strong seedling culture medium containing 100mg/L hygromycin, and obtaining a transgenic plant with the OsAKR4C10 protein completely inactivated in T0 generation plants.

The media used in the above transformation were as follows:

coculture medium (beijing huayuyo biotechnology limited): the callus and subculture medium was induced + As (0.1mmol/L) + glucose (10g/L), pH 5.2.

Agrobacterium infection rice callus culture medium (AAM medium, Beijing Huayuyang Biotech Co., Ltd.): AA macroelement, AA microelement, AA amino acid, MS vitamin, hydrolyzed casein (500mg/L), sucrose (68.5g/L), glucose (36g/L), As (0.1mM) and pH 5.2.

NB minimal medium (bio-technologies ltd, waryo, beijing): macroelement N6 + trace element B5 + organic component B5 + iron salt + hydrolyzed casein (300mg/L) + proline (500mg/L) + sucrose (30g/L) + agar (8g/L), pH 5.8.

Induction of callus and subculture medium: NB minimal medium +2, 4-D (2 mg/L).

Differentiation medium: NB minimal medium +6-BA (3mg/L) + NAA (1 mg/L).

Strong seedling culture medium: 1/2MS medium + NAA (0.5mg/L) + MET (0.25 mg/L).

Agrobacterium culture medium (YEP): 10g/L tryptone +10g/L yeast extract +5g/L sodium chloride +15g/L agar.

4. Screening transgenic positive plants in transgenic plants

The transgenic plant (T) transplanted in the step 3₀Generation) to extract DNA (OMEGA Cat # D3485-02), and detecting target sequence locus to obtain 12 positive plants.

5. Obtaining mutant plants using transgenic positive plants

1) Identification of the site of mutation

And (3) extracting DNA (OMEGA Cat # D3485-02) from the transplanted positive plant in the step (4), designing specific primers F2 and R2 aiming at the DNA fragment within 500bp containing the target site, amplifying the DNA fragment containing the target site, purifying and then sending the amplified 289bp PCR product to a company for sequencing, and comparing the sequencing result with the sequence of a wild plant to screen out a mutant plant.

F2:5’-GGCCGCTGCCTACAGTAAAG-3’；

R2:5’-AGAGGAGAGGAGGAGACGC-3’。

2) And (3) breeding the mutant plant, detecting that a plant single plant without transgenic elements such as hygromycin, Cas9 and the like in a T1 generation transgenic segregation population collects seeds to obtain a function deletion mutant which is named as osakr4c 10. The results of mutation analysis of the loss-of-function mutants and wild-type plants are shown in FIG. 1.

Example 2 real-time fluorescent quantitation assay after Glyphosate treatment of Rice

10.8mmol/L glyphosate solution is prepared, spray treatment is carried out on No. 11 plants growing in 25-day wild type varieties, and clear water treatment is used as a control. After treatment, 5h, 72h and 120h of RNA (OMEGA Cat # R6827-02) of the aerial part (stem and leaf) and the underground part (stem and leaf) were extracted, and after reverse transcription (Takara, PrimeScript RT reagent Kit with gDNA Eraser), real-time fluorescence quantitative PCR was performed to detect the expression of OsAKR4C10 gene. The experiment was repeated three times and the results averaged.

Real-time fluorescent quantitative PCR was performed using Bio-Rad CFX 96. The PCR reaction system (20. mu.L) was carried out according to the product instruction SYBR Green Real-Time PCR Master Mix reagent (Takara) as follows: 10 μ L SYBR Green Real-Time PCR Master Mix, 2 μ L upstream and downstream primer Mix (both 10 μ M upstream and downstream primer concentration), 7 μ L RNase-free water, 1 μ L cDNA template. The specific reaction procedure is as follows: enzymatic heat activation at 95 deg.C for 30s for 1 cycle; denaturation at 95 ℃ for 5s, extension at 60 ℃ for 30s for 40 cycles.

The primer sequence for amplifying the OsAKR4C10 gene is as follows:

F3：5’-AACACTGAAGACTACATACCACCT-3’；

R3：5’-ACTTACACCAATGGCACGAGA-3’。

the primer sequence for amplifying the internal reference UBQ2 by using UBQ2 as an internal reference gene is as follows:

F4：5’-TGCTATGTACGTCGCCATCCAG-3’；

R4：5’-AATGAGTAACCACGCTCCGTCA-3’。

the data are processed by using a Comparative Ct method, i.e., the Ct value is the number of cycles that the fluorescence signal in the PCR tube passes through when reaching a set threshold value, and the delta Ct (OsAKR4C10) -Ct (UBQ2) is calculated by 2^－△△CtThe gene transcription level is measured, and the expression of the OsAKR4C10 gene in the sample is analyzed and compared.

The results are shown in fig. 2, and after glyphosate induction treatment for 5h, the expression level of OsAKR4C10 in the upper part of the rice is up-regulated by 2.62 times compared with the control group treated by clear water; in the underground part of rice, the expression level of OsAKR4C10 gene was not different between the treated group and the control group. After 72h, compared with the clear water control group, the expression level of the OsAKR4C10 gene of the overground part or the underground part of the rice is not statistically different, and the expression level of the OsAKR4C10 gene of the overground part of the rice of the glyphosate treatment group falls back. After 120h, compared with a clear water control group, the expression quantity of the OsAKR4C10 gene on the overground part of the rice has no statistical significance difference; compared with the control group, the induction expression level of the OsAKR4C10 gene in the treatment group of the underground part of the rice is obviously increased by 9.71 times.

Example 3 susceptibility test of Rice in germinating stage to Glyphosate

The sensitivity test of the osakr4c10 mutant and wild rice in the germination period to glyphosate is carried out by adopting a planting mode of tissue culture seedlings. The osakr4c10 mutant rice and the wild type rice seed of Zhonghua No. 11 as a control were baked at 49 ℃ for 4 days, and the seed vigor was recovered. The pre-seeded rice seeds were washed with 75% alcohol (prepared with absolute ethanol and sterile water), then with 50% NaClO solution, and finally rinsed clean with sterile water to complete the thorough disinfection of the seeds. When in seeding, the tweezers are heated under an alcohol lamp, the cooled tweezers are clamped and placed in an MS culture medium (containing 0, 10, 25 and 50 mu mol/L glyphosate respectively), after seeding, the mouth of a tissue culture bottle is sealed, the seedling is placed in a dark place at 28 ℃ for sprouting at the early stage, after seedling emergence, the seedling is transferred to a light-dark period of 12/12 hours, the temperature is 30 ℃ under the light, and the seedling is continuously cultured for 15 days under the environment condition of 28 ℃ in the dark. Watch phenotypic photographic records and measure above and below ground section lengths.

The results show that at a glyphosate concentration of 10. mu. mol/L, the root length and shoot length of the mutant plants are significantly higher than that of the wild type. At a glyphosate concentration of 25 μmol/L, growth of osakr4c10 mutant rice seedlings was only slightly inhibited compared to growth in the absence of glyphosate, whereas wild type rice seeds were barely able to grow after germination. At a glyphosate concentration of 50 μmol/L, the osakr4c10 mutant rice seedling seeds still germinated but further vegetative growth stages of the seedlings were significantly inhibited, and the wild type rice seeds completely blacked out and shrivelled to die (fig. 3). The result shows that the deletion of the OsAKR4C10 gene obviously improves the glyphosate tolerance of the rice seeds in the germination period and is beneficial to the growth of plants.

Example 4 test for Glyphosate uptake by roots of rice at seedling stage

The osakr4c10 mutant and middle-flowering No. 11 rice seedlings, which were grown uniformly in 21 days of hydroponics, were transferred to 50mL centrifuge tubes, with 6 in each group being one replicate, and 3 replicates per treatment. Before application, rice roots were placed at 0.5mmol/LCaCl₂(pH 5.8) after 1h of preculture, 0.5mM CaCl was used instead₂(pH 5.8) after culturing for 3 days with 0.5mmol/L glyphosate solution, the roots, stems and leaves of the rice were collected and weighed for storage. The sample pretreatment method comprises the following steps: the sample was ground to a powder with liquid nitrogen, 1mL of sterile water was used per 0.2g of sample, and the extract mixture was transferred to a10 mL centrifuge tube, vortexed for 5min, sonicated for 30min, and centrifuged at 6000rpm for 5 min. 1mL of the supernatant was added with 0.4mL of CH₂Cl₂Removing impurities, carrying out vortex mixing for 3min, carrying out centrifugation at 6000rpm for 5min, taking 1mL of supernatant, adding 50mg of C18 for purification, carrying out vortex mixing for 3min, carrying out centrifugation at the highest rotation speed for 10min, taking 0.8mL of centrifuged supernatant, adding 0.4mL of 5% sodium borate buffer solution and 0.4mL of 1.0g/L FMOC-Cl acetone solution, carrying out vortex mixing uniformly, carrying out overnight derivatization treatment at 37 ℃, passing through a 0.45-micrometer organic filter membrane after derivatization is finished, and measuring the amounts of glyphosate and AMPA by LC-MS/MS.

The results show that the glyphosate content of the OsAKR4C10 mutant is lower than that of the wild rice in roots, stems and leaves after 24 hours, which indicates that the glyphosate absorption capacity is reduced after the OsAKR4C10 function is lost; the glyphosate content in leaves and roots of the osakr4c10 mutant was lower than that of wild type rice after 72h, but there was no significant difference between the glyphosate content in stems of the osakr4c10 mutant and wild type, which is probably the result of saturation of up-transport capacity of rice roots, while no glyphosate metabolite AMPA was detected in all samples (fig. 4). The results show that the OsAKR4C10 gene is involved in the transport of glyphosate from the root of rice to the upper part.

Example 5 resistance test of Ex vivo leaves of adult-stage Rice against Glyphosate

Selecting plants growing in a rice incubator for 35 days, cutting leaves with the same length, soaking the leaves in 20mL of 0.1% (v/v) Silwet L-77 (Beijing Bootouda technologies Co., Ltd.) solution (containing 5.75 or 11.5mmol/L glyphosate), and standing in a dark and light cycle of 12/12h at the temperature of 30 ℃ in the light and 28 ℃ in the dark for culture. Observing the development process of the phytotoxicity at different time periods, and measuring the PS II maximum quantum yield (Fv/Fm) value of each leaf by using a chlorophyll fluorescence imager at 5h, 24h and 48h time periods respectively. After 4 days, the osakr4c10 mutant and wild-type rice leaf sections were examined for phytotoxicity and recorded by photography.

The results show that wild type (middle flower No. 11) and osakr4C10 mutant rice leaves were not severely damaged under low glyphosate treatment, Fv/Fm decreased with time but no significant difference (fig. 5A and C); whereas at high concentrations, the phytotoxicity was more pronounced in leaves of wild-type rice compared to the osakr4c10 mutant, more yellow spots appeared and the greenness lost was severe, consistent with the photosynthesis index Fv/Fm indicating that the osakr4c10 mutant was more tolerant to glyphosate than the wild-type (fig. 5B and D).

Example 6 resistance test of Rice plants at adult stage to Glyphosate

The osakr4c10 mutant rice seeds and wild type Zhonghua No. 11 rice seeds are disinfected, germinated and sowed in pot pots, placed in the environment conditions of the light and dark period of 12/12h, the temperature is 30 ℃ under the light and 28 ℃ under the dark for culturing for 55 days, then glyphosate spraying experiments (the concentration is 3.6 or 10.8mmol/L) are carried out, the medicament selects glyphosate commercial products, namely, the agricultural product is achieved (the effective content of glyphosate is 30 percent), and the growth and morphological characteristics of plants are continuously recorded.

The chlorophyll content of each treated leaf is measured at 0, 1, 3, 5, 7 and 9 days after spraying, and the experimental conditions and the method are according to the literature (Zhouyong, Severe dawn, Lin champion, Chen Hao. (2018). measuring the chlorophyll content of rice. Bio-101e 1010147.).

The results show that the growth status of osakr4c10 mutant rice and wild type rice was comparable for flower No. 11 without glyphosate application; under the treatment of 3.6mmol/L glyphosate, growth retardation appears after 4 days on wild type Zhonghua No. 11 plants, and the leaves are yellowed and curled after 9 days because of water loss and withering; the WT plants were yellow-curled after 4 days and withered and dead after 9 days under 10.8mmol/L glyphosate treatment. The growth of the osakr4c10 mutant rice showed no obvious phytotoxicity profile after 4 or 9 days at both concentrations, comparable to the growth of plants without sprayed glyphosate (fig. 6). The chlorophyll content of the leaves after different treatments was simultaneously detected, and the chlorophyll content of the WT leaves was found to be continuously reduced with time, and the chlorophyll content of the leaves of the osakr4c10 mutant rice was reduced but not significant with glyphosate application (FIG. 7). The loss of the function of the OsAKR4C10 gene is proved to endow the rice adult plants with glyphosate resistance.

Example 7 determination of Glyphosate resistance of hybrid progeny of OsAKR4C10 Gene-edited plants and Rice varieties with Guiyu Yuyu No. 11 background

OsAKR4C10 gene editing plant with Guiyu No. 11 background, wherein when the rice ear is completely or partially extracted, the plant capable of flowering on the same day is taken as male parent plant; the Chinese No. 1 plant is selected as the female parent, the ear of rice is completely or partially extracted, but more grains are not bloomed yet. Cutting off branches which are completely bloomed on the upper part of the rice ear of the female parent plant and branches which are not developed on the lower part of the rice ear by using scissors, then cutting off glumes of 1/2-2/3 on the upper part of grains which are opaque and internally provided with anthers in the middle, and particularly taking the cut anthers in the grains and the female organs in the intact grains as standards. The ears of rice thus treated were then sprayed with a spray can filled with 70% medicinal alcohol to remove the ears and bagging. Artificial pollination is carried out at noon of the day or at noon of the next day. And slightly shearing the rice ears with large pollen amount at the ear necks by using scissors in the full bloom stage of the male parent rice ears, slightly putting the rice ears downwards into a female parent plant kraft paper hybridization bag prepared in advance, shaking off to ensure that the male parent pollen fully falls on the rice ears of the female parent plant, and achieving the aim of pollination. F1 identification of the mutation of OsAKR4C10 Gene locus according to the method of example 1, selection of homozygous mutants, and successive selfing for 3 generations, each generation identifying the mutation of the target locus according to the method of example 1. A OsAKR4C10 gene locus mutation purification strain is obtained, and the glyphosate resistance of the plant is identified according to the method of example 6 by taking the Chinese No. 1 as a control. As a result, it was found that the growth states of the mutant rice lines of the strains GY11-1, GY11-2 and GY11-3 and China No. 1 were comparable without application of glyphosate; under the treatment of 10.8mmol/L glyphosate, Chinese No. 1 plants have severe yellowing and curling of leaves after 4 days and wither and die after 9 days. The lines GY11-1, GY11-2 and GY11-3 mutant rice lines all had no obvious phytotoxicity characteristic and had growth situation equivalent to that of the plants not sprayed with glyphosate (FIG. 8). The loss of the function of the OsAKR4C10 gene is proved to endow the rice adult plant with glyphosate resistance, and the method can be used for creating glyphosate resistance germplasm resources in a hybridization mode.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Sequence listing

<110> southern China university of agriculture

Application of OsAKR4C10 in creating non-transgenic glyphosate-resistant rice germplasm resource

<141> 2021-05-08

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 311

<212> PRT

<213> Rice (Oryza sativa L)

<400> 1

Met Ala Lys His Phe Val Leu Asn Thr Gly Ala Lys Ile Pro Ser Val

1 5 10 15

Gly Leu Gly Thr Trp Gln Ser Asp Pro Gly Val Val Gly Asp Ala Val

20 25 30

Tyr Ala Ala Val Lys Ala Gly Tyr Arg His Ile Asp Cys Ala Arg Met

35 40 45

Tyr Lys Asn Glu Asn Glu Val Gly Ile Ala Leu Lys Lys Leu Phe Glu

50 55 60

Glu Gly Val Val Lys Arg Glu Asp Leu Phe Ile Thr Ser Lys Leu Trp

65 70 75 80

Cys Asp Cys His Ala Pro Glu Asp Val Pro Glu Ser Leu Asp Lys Thr

85 90 95

Leu Ser Asp Leu Gln Leu Glu Tyr Leu Asp Leu Tyr Leu Ile His Trp

100 105 110

Pro Phe Arg Val Lys Lys Gly Ser Gly Ile Ser Asn Thr Glu Asp Tyr

115 120 125

Ile Pro Pro Asp Ile Pro Ser Thr Trp Gly Ala Met Glu Lys Leu Tyr

130 135 140

Asp Ser Gly Lys Ser Arg Ala Ile Gly Val Ser Asn Phe Ser Ser Lys

145 150 155 160

Lys Leu Gly Asp Leu Leu Ala Val Ala Cys Val Pro Pro Ala Val Asp

165 170 175

Gln Val Glu Cys His Pro Gly Trp Gln Gln Thr Lys Leu His Asn Phe

180 185 190

Cys Gln Ser Thr Gly Val His Leu Ser Ala Tyr Ser Pro Leu Gly Ser

195 200 205

Pro Gly Ser Thr Trp Met Asn Ser Asn Val Leu Lys Glu Ser Val Ile

210 215 220

Ile Ser Ile Ala Glu Lys Leu Gly Lys Thr Pro Ala Gln Val Ala Leu

225 230 235 240

His Trp Asn Ile Gln Met Gly His Ser Val Leu Pro Lys Ser Val Thr

245 250 255

Glu Glu Arg Ile Lys Gln Asn Ile Asp Val Tyr Asp Trp Ser Ile Pro

260 265 270

Glu Asp Leu Leu Val Lys Phe Ser Glu Ile Lys Gln Val Arg Leu Leu

275 280 285

Arg Gly Asp Val Ile Val Asn Pro His Ser Val Tyr Lys Thr His Glu

290 295 300

Glu Leu Trp Asp Gly Glu Ile

305 310

<210> 2

<211> 936

<212> DNA

<213> Rice (Oryza sativa L)

<400> 2

atggcgaagc atttcgtgct caacaccggc gccaagatcc cctcggtggg gctcggcacc 60

tggcagtccg acccgggcgt cgtcggcgac gccgtctacg ccgctgtcaa ggcggggtac 120

cggcacatcg attgcgccag aatgtacaaa aatgaaaatg aggtggggat agctctgaag 180

aagctatttg aagaaggtgt tgtcaagcgt gaagatttat ttatcacatc taagctatgg 240

tgtgattgtc atgccccaga ggatgtgcct gagtcactag acaaaactct gagtgactta 300

cagcttgagt acctggatct ttaccttatt cattggccat tcagagtcaa gaagggctca 360

ggcattagta acactgaaga ctacatacca cctgacatcc catctacctg gggagcaatg 420

gagaagctat atgattctgg taaatctcgt gccattggtg taagtaactt ctcatcaaaa 480

aaactgggtg acctgcttgc tgtagcctgt gtacctccag ctgttgatca ggtagaatgc 540

catcctggtt ggcagcaaac gaagctacat aacttctgcc agtcaactgg cgttcatctt 600

tctgcatact cgcctctagg ttcacctggt tcaacatgga tgaacagtaa cgtccttaag 660

gaatccgtca tcatctcaat tgcagagaag ctcggcaaaa ctcctgcaca agtggcactg 720

cactggaaca ttcagatggg tcacagtgta ctcccaaaaa gtgtgaccga agaaaggata 780

aagcagaaca tagatgttta tgactggtct attccagagg acttgcttgt taagttctct 840

gagattaagc aggttaggct tctcaggggc gacgtcattg ttaatcccca cagcgtttat 900

aagacccatg aggagctctg ggacggcgaa atttag 936

<210> 3

<211> 23

<212> DNA

<213> Rice (Oryza sativa L)

<400> 3

aggtgccgag ccccaccgag ggg 23