Single base mutation method and system adopted by same
1. A single base mutation method characterized by: the method comprises the following steps:
(1) designing sgRNA aiming at a point mutation site of a gene to be mutated;
(2) cloning the sgRNA and the CRISPR/Cpf1 lyase onto a eukaryotic expression vector PX330 to construct a CRISPR/Cpf1 plasmid with specific targeting cutting capacity;
(3) intercepting a base sequence near a mutation point of a gene to be mutated, introducing nonsense mutation into the base sequence, carrying out sulfo-modification on bases at the 5 'end and the 3' end of the base sequence, and then synthesizing donor 1;
(4) co-transfecting the CRISPR/Cpf1 plasmid and the donor1 cell containing a gene to be mutated, and cloning and screening to obtain a cell containing nonsense mutation;
(5) designing Re-sgRNA aiming at the point mutation site of the sequence containing the nonsense mutation in the cell containing the nonsense mutation;
(6) cloning the Re-sgRNA and CRISPR/Cpf1 lyase onto a eukaryotic expression vector PX330 to construct a Re-CRISPR/Cpf1 plasmid;
(7) intercepting a base sequence near a mutation point of a gene to be mutated, carrying out sulfo-modification on bases at the 5 'end and the 3' end of the base sequence, and then synthesizing donor 2;
(8) co-transfecting the Re-CRISPR/Cpf1 plasmid and the donor2 into the cell containing the nonsense mutation to obtain a cell line containing a gene to be mutated;
the method aims at the point mutation of the IVS-II-654 type thalassemia, the sequence of the sgRNA is aatttctactcttgtagatctattgccttaacccagaaatta, and the sequence of the Re-sgRNA is aatttctactcttgtagatctggtaccttaacccagaaatta.
2. The single base mutation method according to claim 1, wherein: in the step (3) and the step (7), in the case of the thio modification, two bases at the 5 'and 3' ends are modified.
3. The single base mutation method according to claim 1, wherein: the length of the donor1 and the length of the donor2 are 90 bp.
4. The single base mutation method according to claim 1, wherein: the sequences of donor1 and donor2 are either c × c attctaaagaataacagtgataatttctgggttaaggtaccagcaatatctctgcatataaatatttctgcatataaattgtaact × g × a or c × c attctaaagaataacagtgataatttctgggttaaggcaatagcaatatctctgcatataaatatttctgcatataaattgtaact × g × a, wherein x represents a thio modification.
5. A system for single base mutation characterized by: the system comprises a first system unit for introducing nonsense mutation into a gene to be mutated and a second system unit for mutating the gene subjected to directional mutation by the first system unit into the gene to be mutated, wherein the first system unit comprises a CRISPR/Cpf1 plasmid and a donor1, the second system unit comprises a Re-CRISPR/Cpf1 plasmid and a donor2, and the base sequence of the donor1 contains nonsense mutation;
the system for single base mutation can specifically induce the repair of HBB-IVS-II-654 pathogenic mutation,
the sgRNA sequence in the CRISPR/Cpf1 plasmid is aatttctactcttgtagatctattgccttaacccagaaatta,
the sequence of Re-sgRNA in the Re-CRISPR/Cpf1 plasmid is aatttctactcttgtagatctggtaccttaacccagaaatta.
6. The system for single base mutation according to claim 5 wherein: the nonsense mutation base is cc.
Background
Beta thalassemia (beta thalassemia) is an autosomal recessive genetic disease caused by an imbalance in a and beta peptide chain synthesis due to a reduction or inability to synthesize globin peptide chain synthesis constituting hemoglobin HbA (a2 beta 2) caused by mutation or deletion of beta globin gene. Beta thalassemia genes are frequently the most common point mutations, and the point mutation (C → T) of the beta globin non-coding region IVS-II-654 is one of the earliest reported point mutations related to beta thalassemia diseases, and the pathogenic mutation can influence the inaccurate formation of abnormal mRNA in the processing processes such as mRNA shearing and the like, thereby causing beta thalassemia.
It is reported that there are about 4 million carriers of thalassemia genes worldwide. In China, the disease is better to be developed in southern areas, and particularly, the incidence rate in Guangdong province is far higher than that in other provinces. Screening research on 14332 household registration inpatient delivery pregnant women in 21 places and cities in Guangdong province in 2012 finds that the local poor gene carrying rate is 16.8%, namely that the local poor gene is carried by people up to 1/6 with the age of childbearing. The birth of each seriously poor child brings up 100 to 300 ten thousand yuan to the society and families. Thalassemia is currently treatable by lifelong blood transfusion, however most children still die before adulthood in the case of active treatment. Another treatment is by bone marrow or hematopoietic stem cell transplantation, but finding a matching allogeneic donor is difficult and costly. At present, the spreading of the thalassemia disease-causing gene can be blocked only by genetic diagnosis technology before embryo implantation or by screening normal embryos or fetuses by a fetal cord blood cell gene detection technology. With the emergence and development of gene editing technology, how to prevent and treat genetic diseases of gene mutation types by using the gene editing technology is an emerging clinical disease treatment mode at present.
Since 2011 pioneers the initiative to advance to precise medicine, the precise medicine in China is also continuously advancing. "accurate gene editing" is the core of gene editing technology and also an important embodiment of precise medicine. The development of accurate gene editing treatment based on diseases caused by specific gene mutation and the acquisition of more accurate and efficient gene editing is an innovative direction for future disease treatment. CRISPR technology has greatly facilitated the therapeutic role of gene editing in a variety of diseases, including malignancies and genetic diseases, since its emergence in 2012, gaining widespread clinical applications, such as: 2016, the national institute of health approved to extract T cells of an immune system from a cancer patient, utilizes CRISPR to carry out gene modification on the T cells, and the T cells after the gene modification are infused back into the patient, and the T cells after the gene modification can destroy tumor cells in a targeted manner; in 2018, 5 months, journal of NATURE reported a case of leukemia in one patient cured by CAR-T treatment; in China, the CRISPR is approved for the first time in 2016 to be used for carrying out human clinical tests to treat metastatic non-small cell lung cancer patients who are not treated by chemotherapy, radiotherapy and other therapies, and the like. Aiming at the single-gene genetic disease causing HBB-28 thalassemia gene point mutation, the invention tests the high efficiency and the practicability of the high efficiency gene editing and treating method.
The use of CRISPR for the treatment of thalassemia has been reported: the method comprises the steps of precisely and specifically repairing a beta globin gene (HBB) defect gene of a somatic cell of a patient by utilizing a gene editing tool CRISPR, inducing the somatic cell subjected to gene editing and repairing into a pluripotent stem cell, and finally transplanting the pluripotent stem cell into a body so as to divide and differentiate into red blood cells with corresponding functions, thereby treating and relieving the symptoms of the beta-thalassemia patient. Currently, gene therapy for beta-thalassemia is initiated where subjects have transitioned from induced pluripotent stem cells (iPS) and Hematopoietic Stem Cells (HSCs) to human embryos, directly blocking the vertical transmission of the genetic disease.
In 2015, an applicant of the patent firstly utilizes a CRISPR gene editing technology to carry out HBB gene editing and repairing on abnormally inseminated human 3PN fertilized eggs, and observes that the CRISPR has the target gene cutting efficiency of 51.9% in human embryos, but simultaneously finds that the target removal is obvious. In 2017, applicants again utilized the single base editing system (APOBEC1) and the nuclear transfer technology to successfully correct a single nucleotide mutation-28 th mutation causing β -thalassemia, with single base editing achieved in human embryos for the first time. This single base editing system consists of a variant of CRISPR and a cytosine deaminase, replacing guanine (C) with thymine (T) by a guide RNA directed to the correct DNA position. However, the gene repair efficiency is only 23%, the embryo obtained after repair is still a chimera, the repaired blastomere is only 20%, complete cure is difficult to realize, and the operation is complex and tedious. In addition, the method also has higher off-target rate. The above several features will greatly limit the use of this technology in gene editing for the treatment of beta thalassemia.
Disclosure of Invention
Based on the above, applicants designed and synthesized a new high-efficiency and accurate repair donor based on the genome editing framework of CRISPR by using degeneracy of amino acids and codon optimization on the basis of the previous period, i.e. nonsense mutation is introduced on a modified repair template (ssODN), i.e. the mutated base does not cause the change of corresponding amino acids, and it can selectively introduce the sequence change of single allele and double allele with high efficiency and accuracy, thus greatly promoting the improvement of accurate repair. The technical principle is described as follows:
the CRISPR/Cas gene editing system is derived from the bacterial adaptive immune system and consists of nuclease Cas and 20bp guide rna (sgrna). CRISPR specific cleavage is mediated by sgrnas that bind to sites on genomic DNA adjacent to a promoter-adjacent motif (PAM) sequence via RNA-DNA base complementary pairing, directing the Cas enzyme to the target site. This simple target navigation by programmable sgrnas distinguishes CRISPR systems from earlier technologies (e.g., zinc finger nucleases or transcription activator-like effector nucleases (TALENs), both of which require the assembly of complex DNA binding protein domains for site-specific editing). The CRISPR/Cpf1 is a new type-2V CRISPR effector protein, and is an endonuclease capable of conducting cleavage by being combined with a specific site of target DNA under the guidance of a single-stranded guide RNA. Compared with the commonly used classical CRISPR/Cas9, the Cpf1 can recognize and cut DNA only by a single-stranded RNA consisting of 42-44 nucleotides, thereby simplifying the experimental design steps and being more beneficial to multi-gene editing; cpf1 cleavage generates a cohesive end that facilitates insertion of the gene of interest into the targeted site; in addition, Cpf1 is able to recognize thymine (T) -rich PAM sequences, which can extend the editing range of CRISPR. The development of CRISPR/Cpf1 has helped break through and overcome some of the limitations in CRISPR/Cas9 applications, and is therefore referred to as a new generation of CRISPR genome editing tools. Referring to the sequence characteristics of the IVS-II-654 pathogenic mutation of beta globin researched by the invention, a target site suitable for genome editing by using CRISPR/Cpf1 is known to be arranged near the mutation point.
The CRISPR/Cpf1 protein requires PAM and sgRNA binding to introduce Double Strand Breaks (DSBs) at specific sites. In most cases, these DSBs are repaired by non-homologous end joining (NHEJ) pathways, leading to non-specific insertions, deletions or other mutations, commonly referred to as 'indels'. This is likely to cause mutations in the open reading frame of the target gene, leading to premature termination of translation or mis-translation of the codon, thereby achieving gene knockout. However, NHEJ repair does not allow the introduction of specific sequence changes and is not applicable to precise gene therapy of the type in which normal gene mutations necessary for normal life functions are pathogenic.
To make a particular sequence change, e.g., to introduce a pathogenic mutation or to correct a mutation in a patient-derived cell line, Homology Directed Repair (HDR), a unique cellular DNA repair pathway, must be used. To do this, the most common approach is to introduce a modified DNA repair template, such as a single stranded oligonucleotide (ssODN), which contains flanking sequences at both ends that are homologous to the genomic region surrounding the DSB, as well as the expected sequence changes. Single-stranded DNA is widely applied to the gene editing process as 'donor template', can realize site-directed repair and DNA fragment knock-in, and researches show that ssDNA with the length of 70-100bp has higher efficiency of site-directed repair and fragment knock-in as a homologous arm, and is easier to screen and obtain mutants of site-directed edition and fragment knock-in. HDR is relatively rare in mammalian cells, double-strand breaks (DSBs) produced by CRISPR editing of the genome are mainly repaired by NHEJ, but cell cycle regulation, inhibition of NHEJ components, or introduction of repair templates can increase the frequency of HDR. However, the genome editing events required for HDR generation also need to improve editing accuracy by preventing the sgrnas from targeting binding again after cleavage, which was not directly addressed in earlier studies. These "inaccurate" edits result from reediting of previously edited sites by the CRISPR complex, which will reappear the target sites until they are sufficiently modified (fig. 1). By utilizing the degeneracy of amino acids in a CRISPR-targeted target sequence and introducing nonsense mutation (blocking base) into an HDR-ssDNA repair template, the method can prevent unwelcome reediting to a great extent (figure 2) and achieve the purpose of traceless repair.
ssDNA donor has been shown to have a strong site-directed repair efficiency in a number of experimental systems, including in cellular experiments and embryo microinjection, among others. Partial thio modification of terminal nucleotides can greatly improve the capability of resisting nuclease degradation of the ODN, the whole ODN is not required to be subjected to thio modification, although the thio oligonucleotide can be hybridized with RNA or DNA fragments of a complementary strand to form a stable double-stranded structure, research shows that the stability and the melting point (Tm) of the double strand are reduced to a certain extent compared with the double strand of a corresponding normal oligonucleotide through comparison of the change of the Tm value of the thio oligonucleotide, and in addition, the thio oligonucleotide has a slight toxic effect on normal cells. The method for modifying the end part of the oligonucleotide by the sulfo-group not only overcomes the defects of complete sulfo-group modification, but also greatly improves the stability of the oligonucleotide, and is a good method for improving the treatment effect of the nucleic acid. At present, ssODN with 2 bases at the 5 'end and the 3' end subjected to thio modification is adopted, and the best fixed-point editing effect is achieved through experimental observation. The application and research of the method mainly focus on cell lines or animal embryos, and the application in human embryonic cells is rarely reported.
Therefore, aiming at the autosomal recessive genetic disease of the non-coding region point mutation of the HBB-IVS-II-654 point mutation thalassemia, the invention constructs a CRISPR/Cpf1 expression plasmid targeting the mutation site in the thalassemia correspondingly, simultaneously adopts ssDNA (single-stranded oligonucleotide) with 2 base thio-modified 5 'and 3' ends, introduces nonsense mutation for blocking reediting by utilizing the amino acid degeneracy principle, synthesizes into donor, transfects the CRISPR/Cpf1 expression plasmid and the donor into cells together, specifically induces the traceless directional modification of the gene mutation site in the IVS-II-654 thalassemia in 293TT cells, and has important clinical application value for developing the precise gene editing treatment based on the monogenic point mutation disease.
In order to achieve the purpose, the invention adopts the following technical scheme:
an object of the present invention is to provide a single base mutation method, comprising the steps of:
(1) designing sgRNA aiming at a point mutation site of a gene to be mutated;
(2) cloning the sgRNA and the CRISPR/Cpf1 lyase onto a eukaryotic expression vector PX330 to construct a CRISPR/Cpf1 plasmid with specific targeting cutting capacity;
(3) intercepting a base sequence near a mutation point of a gene to be mutated, introducing nonsense mutation into the base sequence, carrying out sulfo-modification on bases at the 5 'end and the 3' end of the base sequence, and then synthesizing donor 1;
(4) co-transfecting the CRISPR/Cpf1 plasmid and the donor1 cell containing a gene to be mutated, and cloning and screening to obtain a cell containing nonsense mutation;
(5) designing Re-sgRNA aiming at the point mutation site of the sequence containing the nonsense mutation in the cell containing the nonsense mutation;
(6) cloning the Re-sgRNA and CRISPR/Cpf1 lyase onto a eukaryotic expression vector PX330 to construct a Re-CRISPR/Cpf1 plasmid;
(7) intercepting a base sequence near a mutation point of a gene to be mutated, carrying out sulfo-modification on bases at the 5 'end and the 3' end of the base sequence, and then synthesizing donor 2;
(8) and co-transfecting the Re-CRISPR/Cpf1 plasmid and the donor2 into the cell containing the target mutation and the nonsense mutation to obtain a cell line containing the gene to be mutated.
Preferably, the method is directed to a point mutation in thalassemia type IVS-II-654.
Preferably, in the step (3) and the step (7), the two bases at the 5 'and 3' ends are modified when the thio modification is performed.
Preferably, said donor1 and said donor2 are 90bp in length.
Preferably, the sequence of the sgRNA is aatttctactcttgtagattgggttaaggcaatagcaatat, aatttctactcttgtagatctattgccttaacccagaaatta, aatttctactcttgtagataggcaatagcaatatctctgcat, and the sequence of the Re-sgRNA is aatttctactcttgtagatctggtaccttaacccagaaatta.
Preferably, the sequence of donor1 is
c attctaaagaataacagtgataatttctgggttaaggtaccagcaatatctctgcatataaatatttctgcatataaattgtaact g a, the sequence of donor2 is
c attctaaagaataacagtgataatttctgggttaaggcaatagcaatatctctgcatataaatatttctgcatataaattgtaact g a, wherein x represents a thio modification.
The invention also aims to provide a system for single base mutation, which comprises a first system unit for introducing nonsense mutation into a gene to be mutated and a second system unit for mutating the gene subjected to directional mutation by the first system unit into the gene to be mutated, wherein the first system unit comprises a CRISPR/Cas9Cpf1 plasmid and a donor1, the second system unit comprises a Re-CRISPR/Cas9Cpf1 plasmid and a donor2, and the base sequence of the donor1 contains the nonsense mutation.
Preferably, the nonsense-mutated base is cc.
Preferably, the system for single base mutation specifically induces repair of pathogenic mutation of HBB-IVS-II-654. The specificity refers to the specificity of the pathogenic site of HBB-IVS-II-654, the CRISPR/Cpf1 and the corresponding donor which are targeted, the repair of the pathogenic mutation of HBB-IVS-II-654 can be specifically induced, and the editing and treating effects on other types of pathogenic mutations such as HBB-beta 41/42 and the like and normal cells are not generated.
Due to the implementation of the technical scheme, compared with the prior art, the invention has the following advantages:
by introducing nonsense mutation, the invention can avoid the repaired gene sequence from being cut again, thereby improving the cutting efficiency and reducing the off-target effect, thereby achieving the purpose of traceless repair, and having important clinical application value for developing gene editing accurate treatment based on single gene point mutation diseases.
Drawings
FIG. 1 is an illustration of the manner of gene repair following CRISPR/Cpf 1-mediated double-strand break, note: following CRISPR/Cpf 1-mediated double-strand break (1), most genes will be repaired by the error-prone NHEJ pathway, resulting in random gene mutations (2). In 1-10% of cases, the introduction of a homologous DNA repair template results in the expected sequence changes provided by HDR (3). However, only in rare cases, this sequence change is accurate (i.e. not disrupted by additional CRISPR/Cpf1 reediting) (4). In most DSB repairs, the CRISPR/Cpf1 complex will reappear and bind to the target site (5) and cause additional indels (6).
FIG. 2 is a schematic diagram of the seamless repair of a blocking base with a nonsense mutation introduced into the donor, note: b, blocking mutation, which is positioned in the sgRNA targeted sequence in the HDR repair template to reduce the re-cutting after the integration and repair; m-mutations associated with mutant repair of disease-causing genes, also located in HDR repair templates, to introduce desired mutations of interest.
FIG. 3 is a diagram of the modification pattern of ssDNA donor, note: asterisks indicate thio modifications, the upper panel shows 2 base thio modifications at both ends of ssDNA.
FIG. 4 shows the sanger sequencing of the blood DNA of normal (homozygous no mutation), poor patients with mild HBB-IVS-II-654 (heterozygous mutation) and poor patients with severe HBB-IVS-II-654 (homozygous mutation) in clinical samples to confirm that the pathogenic mutation of IVS-II-654 is C → T pathogenic.
FIG. 5 is a schematic diagram of the sequence design of sgRNA designed near the mutation site to site-specifically mutate normal 293TT cells into abnormal homozygous mutant HBB-IVS-II-654-293TT cells according to the design principle of FIG. 2, note that: boxes in the first row and the third row indicate that an original target mutation sequence (integrated mutation) is C, a small box in the second row indicates that the original target mutation sequence becomes pathogenic mutation T after the mutation is changed into IVS-II-654, a large box in the second row indicates that nonsense mutation is introduced on the donor and simultaneously a restriction enzyme site KpnI which is not possessed originally can be generated, whether integration is rapidly identified through the restriction enzyme site after the improved donor is integrated, and whether blocking base is introduced into a genome sequence for traceless repair; 2 bases (cc) above the small square below the second row sequence are introduced blocking bases which can avoid re-targeted recognition by the same sgrnas after donor integration repair.
FIG. 6 shows digestion experiments performed after 293TT cells are co-transfected by CRISPR/Cpf1 particles and donor-ssDNA, total cell genome DNA is extracted and PCR amplification is performed on target fragments containing mutations, wherein the T7E1 digestion experiment identifies the cutting efficiency of a knife, the KpnI digestion experiment identifies the integration efficiency of the donor-ssDNA, the two digestion experiments are controlled to be the same batch of experiments, and the template amount is consistent.
FIG. 7 is a calculated efficiency value quantified by performing a gray scale analysis on the glue map of FIG. 6, noting: the calculation formula of the editing efficiency is as follows: % gene modification 100x (1- (1-fraction) 1/2). T7E1 enzyme cutting efficiency-reflecting the efficiency of targeted cutting by a knife; KpnI cleavage efficiency-when donor is integrated into the target position, it is recognized and cleaved by this enzyme; the integration efficiency of Donor, which is calculated by the formula of repair efficiency, is (KpnI cutting efficiency/T7E 1 cutting efficiency) x 100%, and this efficiency represents the repair efficiency of the mutation introduced by integration repair, which is also the efficiency of the present invention.
FIG. 8 shows that the edited monoclonal cell is selected from the IVS-II-654 mutant 293TT cell line, DNA is extracted, PCR target fragments are subjected to sanger sequencing, and whether doror is integrated and repaired is further identified, and the steps of: the small box covering one base represents the genome introducing the IVS-II-654 mutation, C → T; the small box covering two bases represents the introduced nonsense mutant base, AT → CC. The small box in the first row of the sequence, covering one base, is indicated in the normal sequence, where the normal base is C; a small box in the sequence of the second row, covering one base, indicates that in a clinical patient homozygous for the pathogenic mutation, the pathogenic mutation base is T; in the third row of the sequence, it is shown that after gene editing, the small box covering one base represents the target mutation T introduced by the method of the present invention, and the small box covering two bases represents the nonsense mutation base introduced by the method of the present invention, AT → CC. It is further explained that: the sequencing direction of the monoclonal IVS-II-654 mutant 293TT with the normal base of C is reverse sequencing, so that the sequencing peak is represented as IVS-II-654 mutation G → A, and the C → T corresponding to forward sequencing is the required target mutation according to the base complementary pairing principle; the small box covering two bases represents the nonsense mutant base introduced, the AT → CC red box represents the nonsense mutant base introduced, TA → GG.
Fig. 9 shows that using the same strategy of the study approach, only sgRNA and donor1 were substituted for Re-sgRNA and donor2, respectively, and the monoclonal IVS-II-654 mutant 293TT cell line was again edited and further mutated back to the normal wild-type 293TT cell line and verified by PCR-sanger sequencing, noting that: the small box covering one base represents the base to which the IVS-II-654 mutation is introduced to be repaired to the normal base, T → C; the small box covering two bases represents the repair of the introduced nonsense mutant base to the normal wild-type base, CC → AT. Since the sequencing direction of the monoclonal IVS-II-654 mutant 293TT is reverse sequencing, the sequencing peak is represented by IVS-II-654 mutation G → A; the red box represents the nonsense mutant base introduced, TA → GG.
Detailed Description
The invention will be further illustrated by the following specific examples, which are not intended to limit the scope of the invention. The skilled person can make modifications to the preparation method and the apparatus used within the scope of the claims, and such modifications should also be considered as the protection scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.
Primer design used in this example was done using Primer3Plus on-line Primer design tool (http:// www.primer3plus.com/cgi-bin/dev/Primer3Plus. cgi); synthesized by Suzhou Jinzhi Biotechnology, Inc., and the integrated thiomodified donor-ssDNA is synthesized by Suzhou Jinzhi Biotechnology, Inc.; the engineered enzyme T7E1 enzyme used to identify whether knives are cleaving was purchased from NEW ENGLAND BIOLAB (cat # M0302S), the engineered enzyme KpnI enzyme for identifying donor integration repair and the complementary 10 XBuffer from Thermo Scientific (cat # FD 0524). sanger sequencing was performed by the firm of Committee Biotechnology (Shanghai), and plasmid construction was performed by the firm of Jinzhi Biotechnology, Suzhou, based on sequences designed by patent applicants.
1. Blood DNA of normal people (homozygous no mutation), patients with mild IVS-II-654 poor disease (heterozygous mutation) and patients with severe IVS-II-654 poor disease (homozygous mutation) in clinical samples are adopted for sanger sequencing, and IVS-II-654 mutation is determined to be C → T pathogenic.
Blood samples of normal persons (homozygous no mutation), patients with anemia in light IVS-II-654 (heterozygous mutation) and patients with anemia in heavy IVS-II-654 (homozygous mutation) were taken using blood lancets, and DNA in blood was extracted using a whole gold DNA extraction kit (cat # M10122) according to the protocol, and the results are shown in FIG. 4.
Searching the upstream and downstream sequences of the IVS-II-654 mutation point through NCBI database, designing primers at a Primer3Plus online Primer design tool website (http:// www.primer3plus.com/cgi-bin/dev/Primer3Plus. cgi), amplifying upstream and downstream fragments of the target mutation point, sending PCR products to Shanghai Biotech company for Sanger sequencing, and determining the IVS-II-654 mutation characteristic as C → T single-base point mutation. The primer sequence is as follows:
primer-F:aactttacacagtctgcctagt(SEQ ID NO.1)
primer-R:aagggcctagcttggactca(SEQ ID NO.2)
the sequencing sequence obtained by sequencing the blood DNA of the poor patient (homozygous mutation) of the heavy IVS-II-654 is as follows: (the bold type base is a mutant base T)
2. According to the design principle of fig. 2, sgrnas are designed near mutation sites of a sequence obtained by sequencing blood DNA of normal persons (homozygous without mutation), and 3 optimal sgrnas are designed and selected, thereby constructing CRISPR plasmids.
The sequences selected were:
sgRNA1：
sgRNA2：
sgRNA3：
wherein, the bold letters are sequences of sgRNA sequences combined with target DNA, and the parts without bold letters are scaffold (dr), namely secondary structure regions of sgRNA.
The construction method of the expression vector of CRISPR/Cpf1 is completed by a construction method in a referential citation (Zhang F.cell.2015 Sep 23.pii: S0092-8674(15)01200-3.doi:10.1016/j.cell.2015.09.038.), a Cpf1 sequence and a sgRNA sequence are cloned to an expression vector PX330, a eukaryotic expression vector plasmid of CRISPR/Cpf1 is constructed, after the construction is completed, the correctness and no mutation of the constructed vector sequence are determined by conventional sequencing comparison, and the completely correct clone is selected for amplification and plasmid extraction.
3. According to the design principle of FIG. 2, the donor1 sequence of the site-directed traceless mutation was designed and synthesized.
Intercepting a 90bp base sequence near the IVS-II-654 mutation point, introducing IVS-II-654 pathogenic mutation (bold) and nonsense mutation (capitalized), and performing thio modification (shown by a letter) at two ends, wherein the donor sequence is as follows:
the sequence was submitted for synthesis by Suzhou Jinzhi Biotechnology, Inc.
4. The cleavage effect of the CRISPR/Cpf1 plasmid knife and whether the donor is integrated are identified.
After the CRISPR/Cpf1 plasmid and the donor1-ssDNA are co-transfected into 293TT cells, total cell genome DNA is extracted and subjected to Sanger sequencing to verify the cutting effect of the CRISPR/Cpf1 plasmid knife and whether the donor1 is integrated. WT represents the absence of the CRISPR/Cpf1 plasmid; sgRNA1, sgRNA2, and sgRNA3 (i.e., 654-g1, 654-g2, 654-g3) represent 3 sgrnas designed near the IVS-II-654 mutation site, respectively. After the plasmid and the ssDNA are transfected into cells, the CRISPR/Cpf1 system of the IVS-II-654 mutation site targeted expressed by the plasmid can rapidly recognize the IVS-II-654 mutation site sequence and play a role in cutting. The cleaved cells increase the efficiency of homologous repair of HDR when exogenous ssDNA is present as a repair template. And simultaneously carrying out PCR amplification on the extracted cell genome DNA to obtain a target fragment containing mutation, and carrying out enzyme digestion experiments, wherein the T7E1 enzyme digestion experiment identifies the cutting efficiency of the knife, the KpnI enzyme digestion experiment identifies the efficiency of donor1-ssDNA integration, the two groups of enzyme digestion experiments are controlled to be the same batch of experiments, and the template amount is consistent. The restriction enzyme cutting bands of the T7E1 enzyme and the KpnI enzyme can be observed in the experimental group (654-g1, 654-g2, 654-g 3).
The specific operation method comprises the following steps:
(1) cell culture
The 293TT cell line was cultured in DMEM complete medium containing 10% serum at 37 ℃ in a 5% CO2 incubator. After the cell confluence reached 90%, digestion was stopped with a DMEM complete medium, and the cells were inoculated into 6-well plates and cultured for 24 hours.
(2) Plasmid transfection
After 24 hours, the cells were confirmed to adhere well, and the degree of cell fusion reached 80%, and transfection was performed. 2ug CRISPR/Cpf1 plasmid and 100pmol of donor-ssDNA were transfected per well, using X-tremeGENE HP DNA Transfection Reagent from Roche, according to the instructions, and the transfected cells were further cultured at 37 ℃ in a 5% CO2 incubator.
(3) Extraction of genomic DNA
After 48 hours of transfection, cells were digested with 0.25% trypsin, collected into a centrifuge tube, centrifuged at 300g for 5 minutes at room temperature, washed once with PBS, and centrifuged at 300g for 5 minutes at room temperature. Cell genomic DNA was extracted using the reagent components of the Whole gold DNA extraction kit (Whole gold Biotechnology Co., Ltd., Cat. No.: EE101-01) according to the following method:
add 100ul cell lysate LB2, mix well, suspend the cells, add 20ul RnaseA and 20ul Proteinase K to the sample, vortex and mix well, incubate for 2min at room temperature.
Add 500ul of DNA-binding BB2 reagent, vortex immediately for 5 seconds, and incubate at room temperature for 10 min.
The whole solution was added to the column, centrifuged at 12000Xg for 30 seconds, and the effluent was discarded.
500ul of clean buffer2(CB2) was added, and the mixture was centrifuged at 12000Xg for 30 seconds, and the effluent was discarded. And then repeated once.
500ul of wash buffer2(WB2) was added and centrifuged at 12000Xg for 30 seconds, and the effluent was discarded. And then repeated once.
12000Xg centrifugation for 2min, completely removed the residual WB 2.
The column was placed in a clean centrifuge tube, 50ul of preheated (60-70 ℃) deionized water (pH >7) was added to the center of the column, and the column was allowed to stand at room temperature for 1 minute, and then centrifuged at 12000Xg for 1 minute to elute the DNA. The DNA concentration was measured.
(4) Design of primers
The primers for amplifying the upstream and downstream fragments of the target mutation point are adopted, and both ends of the primers cross over the target (the length of the product is preferably 500bp, and the distance between the target and the two primer segments should be different by more than 50bp so as to effectively distinguish the two enzyme-cut small fragments during agarose gel electrophoresis). Sending the PCR product to Shanghai Biotechnology company for Sanger sequencing, wherein the amplification primer is consistent with the sequencing primer, and the sequence is as follows:
primer-F:aactttacacagtctgcctagt(SEQ ID NO.8)
primer-R:aagggcctagcttggactca(SEQ ID NO.9)
(5) PCR reaction
The above-mentioned extracted genomic DNA was used as a template, and the above-mentioned primers were used to carry out PCR reaction. The high fidelity DNA polymerase used in this experiment wasBeijing of all-purpose gold Biotechnology LtdPCR SuperMix (cat # AS 111-02).
And (3) PCR reaction system:
and (3) PCR reaction conditions:
and after the PCR reaction is finished, taking a small amount of PCR products for agarose gel electrophoresis, and preliminarily judging whether the concentration of the PCR products and the size of bands are correct or not according to the electrophoresis result.
(6) T7 Endonuclease I enzyme digestion experiment and agarose gel electrophoresis
T7 Endonuclease I and the associated 10 XNEB Buffer2 used in this experiment were purchased from New England Biolabs (cat. No.: M0302S). The operation steps are as follows:
200ng of the purified PCR product was used for the following reaction:
reaction system:
annealing conditions:
after the annealing reaction is finished, adding 1 mu L of T7 Endonuclease I, shaking and mixing uniformly, incubating at 37 ℃ for 20 minutes to finish cutting, and adding 2 mu L of 0.25M EDTA solution to stop the enzyme digestion reaction. After completion of the reaction, electrophoresis was performed using 2% agarose gel.
The agarose gel electrophoresis result shows that the PCR product can be cut by T7 Endonuclease I, and one large band and one small band (see figure 6) appear, which indicates that the CRISPR/Cpf1 can successfully cut the IVS-II-654 gene sequence in cells, and the cutting efficiency can be estimated by measuring the gray value of the bands through ImageJ software (see figure 7).
(7) Integration and identification KpnI restriction enzyme digestion experiment and agarose gel electrophoresis
The KpnI enzyme used in this experiment and the 10 XBuffer used therewith were purchased from Thermo Scientific Inc. (Cat. No.: FD 0524). The operation steps are as follows:
200ng of the purified PCR product was used for the following reaction:
reaction system:
after mixing, the mixture was incubated at 37 ℃ for 1 hour to complete the cleavage, and 2. mu.L of 0.25M EDTA solution was added to terminate the cleavage reaction. After completion of the reaction, electrophoresis was performed using 2% agarose gel.
The agarose gel electrophoresis result shows that the PCR product can be cut by KpnI, and two large and small bands (shown in a figure 6) appear, which indicates that after the CRISPR/Cpf1 successfully cuts the IVS-II-654 gene in cells, the modified donor1-ssDNA is integrated into a target site. The gray value of the band is measured by Image J software, so that the KpnI cutting efficiency can be estimated, and the integration efficiency of the donor can be calculated by comparing the KpnI cutting efficiency with the T7E1 cutting efficiency (see figure 7).
5. The 293TT cell line screened for IVS-II-654 mutation and nonsense mutation is further identified by selecting monoclonal cells.
The sequencing data of the monoclonal cell shows that IVS-II-654 mutation and nonsense mutation are successfully introduced into the normal 293TT cell by the method, so that the IVS-II-654 mutant 293TT cell line is obtained. Indicating the successful use of the high efficiency site-directed mutagenesis method.
The 48h transfected groups of cells were digested with 0.25% trypsin and blown into single cells, and the cells were suspended in 10% fetal bovine serum in DMEM for use.
And diluting the cell suspension in a gradient multiple manner, respectively inoculating the cells of each group into a dish containing 10mL of the pre-warmed culture solution at 37 ℃ at the gradient density of 50 cells, 100 cells and 200 cells per dish, and slightly rotating to uniformly disperse the cells so that the culture wells contain 1 cell at most. Culturing in a cell culture box with 37 ℃ and 5% CO2 at saturated humidity for 2-3 weeks.
It is often observed that when macroscopic colonies appear in the culture dish, the cells are amplified and passaged until the number of cells reaches 50 ten thousand/well, a part of the cells are collected and cell DNA is extracted according to the method, and the cells are subjected to PCR amplification according to the method and then sent to the company Limited Biotechnology (Shanghai) for sequencing.
6. According to the design principle of FIG. 2, sgRNA is designed near the mutation site of the sequence obtained by DNA sequencing of the cell extracted in step 5, and 1 optimal sgRNA is designed, so that the Re-CRISPR/Cpf1 plasmid is constructed to transform 654-293TT cells back to normal wild-type 293TT cells.
Based on the results of the previous experiments, the sgRNA sequences were selected as opposed to 654-g 2:
654-repair-sg2：
wherein, the bold letters are sequences of sgRNA sequences combined with target DNA, and the parts without bold letters are scaffold (dr), namely secondary structure regions of sgRNA.
The construction method of the expression vector of CRISPR/Cpf1 is completed by a construction method in a referential citation (Zhang F.cell.2015 Sep 23.pii: S0092-8674(15)01200-3.doi:10.1016/j.cell.2015.09.038.), a Cpf1 sequence and a sgRNA sequence are cloned to an expression vector PX330, a eukaryotic expression vector plasmid of CRISPR/Cpf1 is constructed, after the construction is completed, the correctness and no mutation of the constructed vector sequence are determined by conventional sequencing comparison, and the completely correct clone is selected for amplification and plasmid extraction.
7. According to the design principle of FIG. 2, the donor2 sequence of the site-directed traceless mutation was designed and synthesized.
Truncating the 90bp base sequence near the IVS-II-654 mutation point, introducing the repair IVS-II-654 mutation (bold font) and the nonsense mutation (capital letters) and carrying out thio-modification (indicated by a letter) at both ends, and carrying out the following donor sequence:
the sequence was submitted for synthesis by Suzhou Jinzhi Biotechnology, Inc.
8. 293TT monoclonal cells edited as 654 and nonsense mutations were edited again and further mutated back to the normal wild type 293TT cell line and verified by PCR-sanger sequencing.
Since the cutting effect of the 654-sg2 plasmid was verified earlier, and 654-repair-sg2 designed for repair is a relative sequence thereof, we confirmed the effectiveness of the method by directly selecting a positive clone of 293TT cells repaired to normal wild type after co-transfecting the 293TT cells with CRISPR/Cpf1 plasmid of 654-repair-sg2 and donor-ssDNA, and the identification result is shown in FIG. 9.
The specific operation method comprises the following steps:
(1) cell culture
The 293TT cell line was cultured in DMEM complete medium containing 10% serum at 37 ℃ in a 5% CO2 incubator. After the cell confluence reached 90%, digestion was stopped with a DMEM complete medium, and the cells were inoculated into 6-well plates and cultured for 24 hours.
(2) Plasmid transfection
After 24 hours, the cells were confirmed to adhere well, and the degree of cell fusion reached 80%, and transfection was performed. 2ug CRISPR/Cpf1 plasmid and 100pmol of donor2-ssDNA were transfected per well, using the X-tremeGENE HP DNA Transfection Reagent from Roche, according to the instructions, and the transfected cells were further cultured at 37 ℃ in a 5% CO2 incubator.
(3) Seed monoclonal cell
The cells of each group after 48h transfection were digested with 0.25% trypsin and blown into single cells, and the cells were suspended in DMEM medium containing 10% fetal bovine serum for use.
Diluting the cell suspension by gradient multiple, respectively inoculating each group of cells into a dish containing 10mL of 37 ℃ pre-warming culture solution at the gradient density of 50 cells, 100 cells and 200 cells per dish, and slightly rotating to uniformly disperse the cells, so that the culture wells contain 1 cell at most. Culturing in a cell culture box with 37 ℃ and 5% CO2 at saturated humidity for 2-3 weeks.
(4) Extraction of genomic DNA from monoclonal cells
It is frequently observed that when macroscopic colonies appear in the culture dish, the expansion is passaged until the number of cells reaches 50 ten thousand/well, and a part of the cells is harvested to extract cellular DNA as follows:
cells were digested routinely with 0.25% pancreatin, collected into a centrifuge tube, centrifuged at 300g for 5 minutes at room temperature, washed once with PBS, and centrifuged at 300g for 5 minutes at room temperature. Cell genomic DNA was extracted using the reagent components of the Whole gold DNA extraction kit (Whole gold Biotechnology Co., Ltd., Cat. No.: EE101-01) according to the following method:
add 100ul cell lysate LB2, mix well, suspend the cells, add 20ul RnaseA and 20ul Proteinase K to the sample, vortex and mix well, incubate for 2min at room temperature.
Add 500ul of DNA-binding BB2 reagent, vortex immediately for 5 seconds, and incubate at room temperature for 10 min.
The whole solution was added to the column, centrifuged at 12000Xg for 30 seconds, and the effluent was discarded.
500ul of clean buffer2(CB2) was added, and the mixture was centrifuged at 12000Xg for 30 seconds, and the effluent was discarded. And then repeated once.
500ul of wash buffer2(WB2) was added and centrifuged at 12000Xg for 30 seconds, and the effluent was discarded. And then repeated once.
12000Xg centrifugation for 2min, completely removed the residual WB 2.
The column was placed in a clean centrifuge tube, 50ul of preheated (60-70 ℃) deionized water (pH >7) was added to the center of the column, and the column was allowed to stand at room temperature for 1 minute, and then centrifuged at 12000Xg for 1 minute to elute the DNA. The DNA concentration was measured.
(5) Design of primers
The primers for amplifying the upstream and downstream fragments of the target mutation point are adopted, and both ends of the primers cross over the target (the length of the product is preferably 500bp, and the distance between the target and the two primer segments should be different by more than 50bp so as to effectively distinguish the two enzyme-cut small fragments during agarose gel electrophoresis). Sending the PCR product to Shanghai Biotechnology company for Sanger sequencing, wherein the amplification primer is consistent with the sequencing primer, and the sequence is as follows:
primer-F:aactttacacagtctgcctagt(SEQ ID NO.12)
primer-R:aagggcctagcttggactca(SEQ ID NO.13)
(6) PCR reaction
The above-mentioned extracted genomic DNA was used as a template, and the above-mentioned primers were used to carry out PCR reaction. The high-fidelity DNA polymerase used in the experiment is that of Beijing Quanji Biotech limitedPCR SuperMix (cat # AS 111-02).
And (3) PCR reaction system:
and (3) PCR reaction conditions:
and after the PCR reaction is finished, taking a small amount of PCR products for agarose gel electrophoresis, and preliminarily judging whether the concentration of the PCR products and the size of bands are correct or not according to the electrophoresis result.
(6) The PCR amplified product was subjected to sequencing by Biotechnology engineering (Shanghai) Ltd. The method is used for successfully repairing and mutating the normal IVS-II-654 mutant 293TT cell line into a normal wild 293TT cell. Indicating the successful use of the high efficiency site-directed mutagenesis method.
The above embodiments are merely illustrative of the technical ideas and features of the present invention, and the purpose thereof is to enable those skilled in the art to understand the contents of the present invention and implement the present invention, and not to limit the protection scope of the present invention. All equivalent changes and modifications made according to the spirit of the present invention should be covered within the protection scope of the present invention.
Sequence listing
<110> Zhuhaishutong medical science and technology Limited
<120> single base mutation method and system adopted by same
<160> 13
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213> Artificial sequence (rengongxulie)
<400> 1
aactttacac agtctgccta gt 22
<210> 2
<211> 20
<212> DNA
<213> Artificial sequence (rengongxulie)
<400> 2
aagggcctag cttggactca 20
<210> 3
<211> 505
<212> DNA
<213> Homo sapiens
<400> 3
aactttacac agtctgccta gtacattact atttggaata tatgtgtgct tatttgcata 60
ttcataatct ccctacttta ttttctttta tttttaattg atacataatc attatacata 120
tttatgggtt aaagtgtaat gttttaatat gtgtacacat attgaccaaa tcagggtaat 180
tttgcatttg taattttaaa aaatgctttc ttcttttaat atactttttt gtttatctta 240
tttctaatac tttccctaat ctctttcttt cagggcaata atgatacaat gtatcatgcc 300
tctttgcacc attctaaaga ataacagtga taatttctgg gttaaggtaa tagcaatatc 360
tctgcatata aatatttctg catataaatt gtaactgatg taagaggttt catattgcta 420
atagcagcta caatccagct accattctgc ttttatttta tggttgggat aaggctggat 480
tattctgagt ccaagctagg ccctt 505
<210> 4
<211> 41
<212> DNA
<213> Artificial sequence (rengongxulie)
<400> 4
aatttctact cttgtagatt gggttaaggc aatagcaata t 41
<210> 5
<211> 42
<212> DNA
<213> Artificial sequence (rengongxulie)
<400> 5
aatttctact cttgtagatc tattgcctta acccagaaat ta 42
<210> 6
<211> 42
<212> DNA
<213> Artificial sequence (rengongxulie)
<400> 6
aatttctact cttgtagata ggcaatagca atatctctgc at 42
<210> 7
<211> 90
<212> DNA
<213> Artificial sequence (rengongxulie)
<400> 7
ccattctaaa gaataacagt gataatttct gggttaaggt accagcaata tctctgcata 60
taaatatttc tgcatataaa ttgtaactga 90
<210> 8
<211> 22
<212> DNA
<213> Artificial sequence (rengongxulie)
<400> 8
aactttacac agtctgccta gt 22
<210> 9
<211> 20
<212> DNA
<213> Artificial sequence (rengongxulie)
<400> 9
aagggcctag cttggactca 20
<210> 10
<211> 42
<212> DNA
<213> Artificial sequence (rengongxulie)
<400> 10
aatttctact cttgtagatc tggtacctta acccagaaat ta 42
<210> 11
<211> 90
<212> DNA
<213> Artificial sequence (rengongxulie)
<400> 11
ccattctaaa gaataacagt gataatttct gggttaaggc aatagcaata tctctgcata 60
taaatatttc tgcatataaa ttgtaactga 90
<210> 12
<211> 22
<212> DNA
<213> Artificial sequence (rengongxulie)
<400> 12
aactttacac agtctgccta gt 22
<210> 13
<211> 20
<212> DNA
<213> Artificial sequence (rengongxulie)
<400> 13
aagggcctag cttggactca 20
