1. A method for constructing an expression vector with an epitope tag M at the C terminal, which is characterized by comprising the following steps:

XhoI and NotI are adopted to cut unloaded pQFC-FLAG₃SKP1, obtaining pQFC-FLAG with XhoI and NotI cleavage ports₃(ii) a Using a vector containing a GFP sequence as a template, and adopting a sequence shown as SEQ ID NO: 3-SEQ ID NO: 4, carrying out PCR on the primer pair shown in the specification to obtain a GFP gene fragment; then the GFP gene fragment is subjected to double enzyme digestion by XhoI and NotI and then is subjected to pQFC-FLAG with XhoI and NotI enzyme digestion ports₃Enzyme linked to obtain pQFC-FLAG₃-GFP；

The pQFC-FLAG is cut by NotI and BamHI₃GFP to obtain pQFC-GFP with NotI and BamHI enzyme cutting ports;

the vector containing the epitope tag M sequence is used as a template and adopts a sequence shown as SEQ ID NO: 5-SEQ ID NO: 6 to obtain M1 fragment with NotI and BamHI; connecting the M1 fragment with the pQFC-GFP enzyme with NotI and BamHI enzyme cutting ports to obtain pQFC-M-GFP;

or the vector containing the epitope tag M sequence is taken as a template and sequentially adopts the sequences as shown in SEQ ID NO: 7-SEQ ID NO: 8 and the primer pair shown as SEQ ID NO: 9-SEQ ID NO: 10 to obtainObtaining M with NotI and BamHI₃A fragment; the M is added₃The gene fragment is connected with the pQFC-GFP enzyme with NotI and BamHI enzyme cutting ports to obtain pQFC-M₃-GFP；

Digesting the pQFC-M-GFP or the pQFC-M with XhoI and EcoRI₃GFP, obtaining the Linear vector pQFC-M or pQFC-M with XhoI and EcoRI cleavage ports₃；

The peptide as shown in SEQ ID NO: 11-SEQ ID NO: annealing the annealing primer shown in 14, and then connecting the annealed primer to the linear vector pQFC-M with XhoI and EcoRI enzyme cutting ports to obtain unloaded pQFC-M with five enzyme cutting sites of XhoI, AgeI, PacI, BamHI and NotI;

or a variant of a polypeptide as set forth in SEQ ID NO: 7-SEQ ID NO: 9 and SEQ ID NO: 15 is annealed and then connected to the linear vector pQFC-M with XhoI and EcoRI cleavage ports₃Obtaining unloaded pQFC-M with five restriction sites of XhoI, AgeI, PacI, BamHI and NotI₃。

2. The method for constructing the expression vector with the epitope tag M at the C terminal according to claim 1, wherein the annealing temperature of PCR is 60 ℃, and the conditions of the first annealing and the second annealing both comprise: 30min at 37 ℃ and 5min at 95 ℃, and then naturally cooling to 25 ℃.

3. An expression vector with an epitope tag M at the C-terminal, constructed by the method of any one of claims 1-2, wherein the vector comprises pQFC-M-GFP and pQFC-M₃GFP, unloaded pQFC-M with five cleavage sites Xhol, Agel, Pacl, BamHI and Notl and unloaded pQFC-M with five cleavage sites Xhol, Agel, Pacl, BamHI and Notl₃。

4. The application of the expression vector with the epitope tag M at the C terminal of claim 3 in detection of exogenous over-expressed genes, which comprises the application in western blotting experiments, immunoprecipitation experiments, immunofluorescence experiments and flow cytometry.

5. The application according to claim 4, wherein the application comprises:

finding out a sequence of a target gene X to be researched on NCBI, designing and obtaining an upstream primer pair and a downstream primer pair with XhoI and NotI multiple cloning sites according to the sequence of the gene X, and amplifying the X gene with the XhoI and NotI multiple cloning sites by adopting the upstream primer pair and the downstream primer pair to obtain an X gene fragment;

carrying out XhoI and NotI double enzyme digestion on the X gene fragment and recycling enzyme digestion products to obtain an X gene fragment with XhoI and NotI enzyme digestion ports;

the expression vector pQFC-M or/and pQFC-M with the epitope tag M at the C end of claim 3₃XhoI and NotI are adopted for enzyme digestion and electrophoresis recovery to obtain pQFC-M or/and pQFC-M with XhoI and NotI enzyme digestion ports₃；

Carrying out enzyme digestion connection on the pQFC-M and the pQFC-M3 with the XhoI and NotI enzyme digestion ports and the X gene fragment with the XhoI and NotI enzyme digestion ports respectively to obtain recombinant plasmids pQFC-M-X and pQFC-M of bit tag sequences₃-X。

6. The application of claim 5, further comprising:

the recombinant plasmid pQFC-M-X or pQFC-M is₃X is transfected into cells respectively, and the expression of the protein coded by the X gene is detected by a protein immunoblotting technology by utilizing a label M;

and/or performing an immunoprecipitation experiment on the X gene using tag M;

and/or the recombinant plasmid pQFC-M-X or pQFC-M₃And (3) transfecting X to mammalian cells respectively, fixing, perforating, sealing, incubating with a monoclonal antibody M primary antibody, incubating with a fluorescent secondary antibody, dyeing with DAPI, and sealing, and monitoring the positioning condition of the X gene corresponding to the coded protein by using a label M through an immunofluorescence technique.

Background

An article published in 1984, in 1984 by Munro and Pelham, for the first time, applied an epitope tag to the detection of mutants of the drosophila hsp70 protein by recombinant DNA methods. In order to observe the activity of the mutated protein in cells alone, a highly sensitive and unique epitope tag is fused to the end of the protein, and the detection is performed by using an antibody corresponding to the epitope tag. After the next time, the epitope labeling technology can be used for detecting the recombinant protein without specific antibodies, and simultaneously, scientific researchers can conveniently detect and compare the similarities and differences of the products of the transgenosis and the products of the endogenous genes. Compared with the traditional endogenous protein, the method is time-consuming, labor-consuming and unpredictable, the labeled antibody selected as the labeled protein is easier to obtain and has higher sensitivity, and can be detected by various biochemical and cell biological technologies, including flow cytometry, protein immunoblotting and immunofluorescence staining, and the antibody has specificity aiming at each label. Labeling systems are also widely used for affinity purification and immunoprecipitation.

There is a certain requirement for an amino acid sequence that can be used as a tag. First, the size of the epitope tag protein is generally 6-30 amino acids, and the biological activity of the fusion protein is not affected. It is important to have a highly sensitive antibody capable of specifically recognizing the epitope tag. One method to improve sensitivity is to concatenate repeated tag sequences, such as the commonly used 3-fold FLAG tag, which binds antibodies more strongly. Third, most tags are hydrophilic and contain more charged amino acids, for example, a 9 amino acid long HA tag contains two aspartic acids and a 10 amino acid long c-myc tag contains three glutamic acids, one lysine and one aspartic acid. The epitope tag is typically positioned at the C-terminus or N-terminus, and the tag should be positioned at the terminus with greater probability of maintaining the biological activity of the protein of interest than if it were inserted into the interior of the protein of interest. Approximately 63% of fusion proteins have been reported in the literature to be well-tolerated for epitope tags. Meanwhile, the tail end of most of folded proteins is exposed outside the spatial structure, and the tag is positioned at the tail end, so that the recognition of the tag antibody can be facilitated. The epitope tags which are common at present are as follows:

(1) c-myc with amino acid length of 10 and sequence of EQKLISEEDL, and the immunogen is human c-myc gene 408-439 product, and 9E10 antibody is provided commercially.

(2) FLAG with the amino acid length of 8 and the sequence of DYKDDDDK, and immunogen is synthetic segment peptide containing enterokinase cleavage site, and M1, M2 and M3 antibodies are correspondingly provided on the market.

(3) V5, amino acid length 14, sequence GKPIPNPLLGLDS, and immunogen obtained by separating simian virus 5(SV5) paramyxovirus P protein and V protein, and providing V5 antibody on the market.

(4) His6, amino acid length of 6, sequence HHHHHHHHHH, and recombinant fusion protein with His label as immunogen, and provides 6-His, 6 XHis and HIS-11 antibody.

(5) T7, amino acid length 11, sequence MASMTGGQQMG, immunogen is leader peptide of phage T7 major capsid protein, corresponding to available commercial productsAn antibody.

(6) HSV, amino acid length 11, sequence QPELAPEDPED, and the immunogen is a synthetic peptide derived from HSV glycoprotein D, corresponding to that provided on the marketAn antibody.

Because of the advantages and disadvantages of the tags, there is a need to develop new tags, and there is a need to develop a new epitope tag that can basically monitor the expression of the corresponding protein of the cloned gene in mammalian cells.

Disclosure of Invention

In order to solve the technical problem, the invention provides an expression vector with an epitope tag M at the C end and application thereof, which can be used for detecting protein expression.

In a first aspect of the present invention, there is provided a method for constructing an expression vector having an epitope tag M at its C-terminus, the method comprising:

cleavage with XhoI and NotINo-load pQFC-FLAG₃SKP1, obtaining pQFC-FLAG with XhoI and NotI cleavage ports₃(ii) a Using a vector containing a GFP sequence as a template, and adopting a sequence shown as SEQ ID NO: 3-SEQ ID NO: 4, carrying out PCR on the primer pair shown in the specification to obtain a GFP gene fragment; then the GFP gene fragment is subjected to double enzyme digestion by XhoI and NotI and then is subjected to pQFC-FLAG with XhoI and NotI enzyme digestion ports₃Enzyme linked to obtain pQFC-FLAG₃-GFP；

The pQFC-FLAG is cut by NotI and BamHI₃GFP to obtain pQFC-GFP with NotI and BamHI enzyme cutting ports;

the vector containing the epitope tag M sequence is used as a template and adopts a sequence shown as SEQ ID NO: 5-SEQ ID NO: 6 to obtain M1 fragment with NotI and BamHI; connecting the M1 fragment with the pQFC-GFP enzyme with NotI and BamHI enzyme cutting ports to obtain pQFC-M-GFP;

or the vector containing the epitope tag M sequence is taken as a template and sequentially adopts the sequences as shown in SEQ ID NO: 7-SEQ ID NO: 8 and the primer pair shown as SEQ ID NO: 9-SEQ ID NO: 10, second annealing to obtain M with NotI and BamHI₃A fragment; the M is added₃The gene fragment is connected with the pQFC-GFP enzyme with NotI and BamHI enzyme cutting ports to obtain pQFC-M₃-GFP；

The pQFC-M-GFP or the pQFC-M3-GFP is cut by XhoI and EcoRI to obtain a linear vector pQFC-M or pQFC-M with XhoI and EcoRI cutting ports₃；

The peptide as shown in SEQ ID NO: 11-SEQ ID NO: annealing the annealing primer shown in 14, and then connecting the annealed primer to the linear vector pQFC-M with XhoI and EcoRI enzyme cutting ports to obtain unloaded pQFC-M with five enzyme cutting sites of XhoI, AgeI, PacI, BamHI and NotI;

or a variant of a polypeptide as set forth in SEQ ID NO: 7-SEQ ID NO: 9 and SEQ ID NO: 15 is annealed and then connected to the linear vector pQFC-M with XhoI and EcoRI cleavage ports₃Obtaining unloaded pQFC-M with five restriction sites of XhoI, AgeI, PacI, BamHI and NotI₃。

Further, the annealing temperature of the PCR is 60 ℃, and the conditions of the first annealing and the second annealing comprise: 30min at 37 ℃ and 5min at 95 ℃, and then naturally cooling to 25 ℃.

In a third aspect of the invention, an expression vector which is constructed by the method and has an epitope tag M at the C terminal is provided.

In the fourth aspect of the invention, the application of the expression vector with the epitope tag M at the C terminal in detecting the exogenous over-expressed gene is provided, and the application comprises the application in western blotting experiments, immunoprecipitation experiments, immunofluorescence experiments and flow cytometry.

Further, the application includes:

finding out a sequence of a target gene X to be researched on NCBI, designing and obtaining an upstream primer pair and a downstream primer pair with XhoI and NotI multiple cloning sites according to the sequence of the gene X, and amplifying the X gene with the XhoI and NotI multiple cloning sites by adopting the upstream primer pair and the downstream primer pair to obtain an X gene fragment;

carrying out XhoI and NotI double enzyme digestion on the X gene fragment and recycling enzyme digestion products to obtain an X gene fragment with XhoI and NotI enzyme digestion ports;

the C end of the expression vector pQFC-M or/and pQFC-M with the epitope tag M₃XhoI and NotI are adopted for enzyme digestion and electrophoresis recovery to obtain pQFC-M or/and pQFC-M with XhoI and NotI enzyme digestion ports₃；

The pQFC-M and the pQFC-M with XhoI and NotI enzyme cutting ports are used₃Respectively carrying out enzyme digestion connection with the X gene fragments with the XhoI and NotI enzyme digestion ports to obtain recombinant plasmids pQFC-M-X and pQFC-M of bit label sequences₃-X。

Further, the application further comprises:

the recombinant plasmids pQFC-M-X and pQFC-M are₃X is transfected into cells respectively, and the expression of the protein coded by the X gene is detected by a protein immunoblotting technology by utilizing a label M;

and/or performing an immunoprecipitation experiment on the X gene using tag M;

and/or the recombinant plasmids pQFC-M-X and pQFC-M₃-X is transfected into mammalian cells separately, followed byFixing, perforating, sealing, incubating a monoclonal antibody M primary antibody, incubating a fluorescent secondary antibody, dyeing DAPI and sealing, and monitoring the positioning condition of the X gene corresponding to the coded protein by using the label M through an immunofluorescence technique.

One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

1. the invention provides an expression vector with an epitope tag M at a C end, and a preparation method and application thereof₃The M tag sequence can be specifically recognized to characterize the expression of the fusion protein through Western blotting detection. The constructed expression vector with the M tag provides a novel universal fusion tag vector resource for the field of mammalian protein expression, and enriches domestic epitope tag resources;

2. the gene is convenient to replace. The 5 cleavage sites for XhoI, AgeI, PacI, BamHI and NotI were provided at the multiple cloning site for selection. Wherein, the two restriction sites of XhoI and NotI are not available in most genes, and the upstream of a few genes containing the XhoI site can be replaced by a primer of the XhoI-carrying isocaudarner SalI. The expression vectors pQFC-M and pQFC-M constructed by the invention₃The GFP gene can be replaced by the gene to be researched through enzyme digestion connection only by simply carrying out XhoI and NotI double enzyme digestion;

3. the monoclonal mouse monoclonal antibody 3B9 corresponding to the epitope tag M has good specificity and high sensitivity, and can be used for detecting protein expression;

4. the invention successfully constructs expression vectors pQFC-M and pQFC-M₃Can be used for immunoprecipitation and co-immunoprecipitation experiments; can be tried for protein affinity purification experiments; can be tried for proteomics experiments.

Drawings

In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings needed to be used in the description of the embodiments will be briefly introduced below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings based on these drawings without creative efforts.

FIG. 1 is a schematic diagram of the process for constructing an expression vector with an M epitope tag; wherein the method comprises the construction of pQFC-M/M₃GFP and pQFC-M/M₃No load;

FIG. 2 shows pQFC-M₃Expression vector pattern and sequences at the multiple cloning sites;

FIG. 3 is a western blot using M tags to detect fusion protein expression in HEK293 cell line. Wherein, A is the protein expression identification of pQFC-M-GFP/SQSTM1 with one M tag sequence, and B is pQFC-M with three M tag sequences₃Identification of the expression of GFP/SQSTM 1;

FIG. 4 shows the application of the C-terminal fused M tag of example 1 in Western blotting experiments. Wherein, A is protein expression identification with three M tag sequences at the N end, and B is protein expression identification with three FLAG tag sequences at the N end;

FIG. 5 shows the detection of subcellular localization of SQSTM1 protein using C-terminal fused FLAG tag and M tag in application example 2;

FIG. 6 shows the application of the C-terminal fused M-tag of example 3 in immunoprecipitation experiments;

FIG. 7 shows the application of the C-terminal fused M-tag of application example 4 in flow cytometry.

Detailed Description

The present invention will be described in detail below with reference to specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly apparent therefrom. It will be understood by those skilled in the art that these specific embodiments and examples are for the purpose of illustrating the invention and are not to be construed as limiting the invention.

Throughout the specification, unless otherwise specifically noted, terms used herein should be understood as having meanings as commonly used in the art. Accordingly, unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. If there is a conflict, the present specification will control.

Unless otherwise specifically stated, various raw materials, reagents, instruments, equipment and the like used in the present invention are commercially available or can be prepared by existing methods.

In order to solve the technical problems, the embodiment of the invention provides the following general ideas:

the fragment M is a PPYDDD sequence with the minimum epitope of 6 amino acids, is shorter than a common FLAG sequence with the length of 8 amino acids, and can be used as a label to fuse and express a protein without a specific antibody. The amino acid sequence PPYDDD (shown as SEQ ID NO: 1) of the novel epitope tag M has the base sequence: CCTCCGTATGACGATGAC (shown in SEQ ID NO: 2).

According to an exemplary embodiment of the present invention, there is provided a method for constructing an expression vector having an epitope tag M at a C-terminal, the method comprising:

XhoI and NotI are adopted to cut unloaded pQFC-FLAG₃SKP1, obtaining pQFC-FLAG with XhoI and NotI cleavage ports₃(ii) a Using a vector containing a GFP sequence as a template, and adopting a sequence shown as SEQ ID NO: 3-SEQ ID NO: 4, carrying out PCR on the primer pair shown in the specification to obtain a GFP gene fragment; then the GFP gene fragment is subjected to double enzyme digestion by XhoI and NotI and then is subjected to pQFC-FLAG with XhoI and NotI enzyme digestion ports₃Enzyme linked to obtain pQFC-FLAG₃-GFP；

The pQFC-FLAG is cut by NotI and BamHI₃GFP to obtain pQFC-GFP with NotI and BamHI enzyme cutting ports;

the vector containing the epitope tag M sequence is used as a template and adopts a sequence shown as SEQ ID NO: 5-SEQ ID NO: 6 to obtain M1 fragment with NotI and BamHI; connecting the M1 fragment with the pQFC-GFP enzyme with NotI and BamHI enzyme cutting ports to obtain pQFC-M-GFP;

or the vector containing the epitope tag M sequence is taken as a template and sequentially adopts the sequences as shown in SEQ ID NO: 7-SEQ ID NO: 8 and the primer pair shown as SEQ ID NO: 9-SEQ ID NO: 10, second annealing to obtain M with NotI and BamHI₃A fragment; the M is added₃The gene fragment is connected with the pQFC-GFP enzyme with NotI and BamHI enzyme cutting ports to obtain pQFC-M₃-GFP；

Digesting the pQFC-M-GFP or the pQFC-M with XhoI and EcoRI₃GFP, obtaining the Linear vector pQFC-M or pQFC-M with XhoI and EcoRI cleavage ports₃；

The peptide as shown in SEQ ID NO: 11-SEQ ID NO: annealing the annealing primer shown in 14, and then connecting the annealed primer to the linear vector pQFC-M with XhoI and EcoRI enzyme cutting ports to obtain unloaded pQFC-M with five enzyme cutting sites of XhoI, AgeI, PacI, BamHI and NotI;

or a variant of a polypeptide as set forth in SEQ ID NO: 7-SEQ ID NO: 9 and SEQ ID NO: 15 is annealed and then connected to the linear vector pQFC-M with XhoI and EcoRI cleavage ports₃Obtaining unloaded pQFC-M with five restriction sites of XhoI, AgeI, PacI, BamHI and NotI₃。

In the embodiment of the invention, pQCXIP is used as an expression vector framework for modification, the expression vector framework is named as pQF after being copied, amino acid PPYDDD is used as a tag sequence M, and expression vectors pQFC-M and pQFC-M which can be fused with the N end of a target protein are constructed₃And 5 enzyme cutting sites of XhoI, AgeI, PacI, BamHI and NotI are designed at the multiple cloning sites fused with M tags at the N end, and the existence of a plurality of enzyme cutting sites can be suitable for containing more gene insertions. Meanwhile, in order to facilitate the use of the later-stage vector for replacing the tag, an EcoRI enzyme digestion site is added after the C-terminal fused M tag, GFP and SQSTM1 genes are fused into the expression vector, and the detection of the Western blot shows that the M tag sequence can be specifically identified to represent the expression of the fusion protein. The constructed expression vector with the M tag provides a novel universal fusion tag vector resource for the field of mammalian protein expression.

As an alternative embodiment, the annealing temperature of the PCR is 60 ℃, and the conditions of the first annealing and the second annealing each include: 30min at 37 ℃ and 5min at 95 ℃, and then naturally cooling to 25 ℃.

According to another exemplary embodiment of the present invention, there is provided a use of the expression vector having the epitope tag M at the C-terminus, the use including:

finding out a sequence of a target gene X to be researched on NCBI, designing and obtaining an upstream primer pair and a downstream primer pair with XhoI and NotI multiple cloning sites according to the sequence of the gene X, and amplifying the X gene with the XhoI and NotI multiple cloning sites by adopting the upstream primer pair and the downstream primer pair to obtain an X gene fragment;

carrying out XhoI and NotI double enzyme digestion on the X gene fragment and recycling enzyme digestion products to obtain an X gene fragment with XhoI and NotI enzyme digestion ports;

the C end of the expression vector pQFC-M or/and pQFC-M with the epitope tag M₃XhoI and NotI are adopted for enzyme digestion and electrophoresis recovery to obtain pQFC-M or/and pQFC-M with XhoI and NotI enzyme digestion ports₃；

The pQFC-M and the pQFC-M with XhoI and NotI enzyme cutting ports are used₃Respectively carrying out enzyme digestion connection with the X gene fragment with the XhoI and NotI enzyme digestion ports to obtain recombinant plasmids pQFC-M-X and pQFC-M of the M label sequence₃-X。

The recombinant plasmids pQFC-M-X and pQFC-M are₃X is transfected into cells respectively, and the expression of the protein coded by the X gene is detected by a protein immunoblotting technology by utilizing a label M;

and/or performing an immunoprecipitation experiment on the X gene using tag M;

and/or the recombinant plasmids pQFC-M-X and pQFC-M₃And (3) transfecting X to mammalian cells respectively, fixing, perforating, sealing, incubating with a monoclonal antibody M primary antibody, incubating with a fluorescent secondary antibody, dyeing with DAPI, and sealing, and monitoring the positioning condition of the X gene corresponding to the coded protein by using a label M through an immunofluorescence technique.

The effects of the present application will be described in detail below with reference to examples and experimental data. The specific experimental conditions and methods not indicated in the following examples are generally in accordance with conventional conditions such as: J. SummBruk et al, science publishers, 1992, molecular cloning, A laboratory Manual (third edition); l. speekt et al, scientific press, 2001, cell protocols, etc., or as recommended by the manufacturer.

Example 1 construction method of expression vector having epitope tag M at C-terminus

1. C-terminal fusion of M tag:pQFC-M/M₃construction of GFP.

(1) Cleavage of pQFC-FLAG with restriction endonucleases XhoI and NotI₃SKP1 to obtain pQFC-FLAG with XhoI and NotI cleavage ports₃。

(2) Designing GFP gene primers with XhoI at the upstream and NotI enzyme cutting sites at the downstream, and connecting GFP gene fragments to pQFC-FLAG by methods such as PCR (a PCR system is shown in table 2, and PCR conditions are shown in table 2), enzyme cutting connection and the like₃Obtaining pQFC-FLAG on the carrier₃-GFP。

TABLE 1

TABLE 2

TABLE 3

(3) The pQFC-FLAG is cut by NotI and BamHI₃GFP to obtain pQFC-FLAG with NotI and BamHI cleavage ports₃-GFP；

(4) Annealing primers of C1M and C3M were designed, respectively, and then ligated to pQF-GFP to obtain pQFC-M/M₃-GFP。

TABLE 4

Specifically, the vector containing the epitope tag M sequence is used as a template and adopts a sequence shown in SEQ ID NO: 5-SEQ ID NO: 6 to obtain M1 fragment with NotI and BamHI; connecting the M1 fragment with the pQFC-GFP enzyme with NotI and BamHI enzyme cutting ports to obtain pQFC-M-GFP;

or the vector containing the epitope tag M sequence is taken as a template and sequentially adopts the sequences as shown in SEQ ID NO: 7-SEQ ID NO: 8 and the primer pair shown as SEQ ID NO: 9-SEQ ID NO: 10, second annealing to obtain M with NotI and BamHI₃A fragment; the M is added₃The gene fragment is connected with the pQFC-GFP enzyme with NotI and BamHI enzyme cutting ports to obtain pQFC-M₃-GFP；

The first annealing and the second annealing are carried out under the conditions that: 30min at 37 ℃ and 5min at 95 ℃, and then naturally cooling to 25 ℃.

C-terminal fusion M tag: pQFC-M/M₃And (4) constructing.

(1) Cleavage of pQFC-M with XhoI and EcoRI₃GFP gave a linear vector pQF with XhoI and EcoRI cleavage ports.

(2) Design the annealing primer with XhoI, AgeI, PacI, BamHI and NotI5 cutting sites and 1M, 3M sequence, after annealing, connect it to pQF (XhoI, EcoRI) to get the no-load pQFC-M/M with five cutting sites₃(XhoI, AgeI, PacI, BamHI and NotI), specifically:

the peptide as shown in SEQ ID NO: 11-SEQ ID NO: the annealing primers shown in 14 were ligated to the linear vector pQF with XhoI and EcoRI cleavage ports to give empty pQFC-M with five cleavage sites of XhoI, AgeI, PacI, BamHI and NotI.

The peptide as shown in SEQ ID NO: 7-SEQ ID NO: 9 and SEQ ID NO: 15 to the linear vector pQF with XhoI and EcoRI cleavage ports to give an empty pQFC-M with five cleavage sites of XhoI, AgeI, PacI, BamHI and NotI₃。

The annealing system is shown in table 6, and the annealing conditions were: 30min at 37 ℃ and 5min at 95 ℃, and then naturally cooling to 25 ℃.

TABLE 5

TABLE 6

Example 2 recombinant plasmid pQFC-M₃Construction of SQSTM1

1. Design Synthesis of primers

A pair of specific primers is designed and synthesized according to the coding sequence of SQSTM1 isoform 1 obtained from the human SQSTM1 Gene provided in NCBI, Gene ID 8878, and the SQSTM1 Gene is amplified. The primer is synthesized by Shanghai biological engineering technology, Inc., and the sequence of the primer is as follows:

SQSTM1-F:CCCTCGAGATGTCGGAAGCGGGCGAGGAG(SEQ ID NO：16)；

SQSTM1-R:ATTTGCGGCCGCGTATGGCTTGTAGTTATTCTGATG(SEQ ID NO：17)；

extraction of total RNA and cDNA Synthesis of HEK293 cells

HEK293 cells were cultured in 24-well plates and after one well had been filled, the medium was aspirated and total RNA extraction kit was used (Plus Mini Kit，Company products), extracting total RNA of cells according to the method introduced by the kit operating instruction. The extracted RNA was reverse-transcribed using a reverse transcription kit (MonScript)^TMRT III Super Mix with dsDNase (Two-Step), REF: MR05201, product of Mona Biotechnology company), reverse transcription is carried out according to the method introduced by the kit operating instruction, HEK293 cell genome cDNA is obtained, and frozen for standby.

PCR amplification and product recovery

And (3) carrying out PCR amplification on the SQSTM1 gene by using the HEK293 cell genome cDNA synthesized in the step (2) as a template, wherein an amplification reaction system and specific reaction conditions are as follows:

the components are mixed evenly by a liquid transfer device, and the following reactions are carried out on a PCR thermal cycler:

agarose gel electrophoresis at 110V for 40min, and recovering DNA fragment with gel recovery kit (D2500-02, product of OMEGA, the same below) (according to kit instructions).

4. Digestion of vector and gene fragment and recovery

(1) pQFC-M was digested with restriction endonucleases XhoI and NotI (NEB Co., Ltd., the same applies hereinafter)₃No load or pQFC-M₃GFP plasmid, 110V, 80min agarose gel electrophoresis, recovery of the approximately 7.2kbp DNA fragment pQFC-M by gel recovery kit₃。

(2) The SQSTM1 gel in the step 3 is subjected to double-enzyme digestion by restriction endonucleases XhoI and NotI to recover products, and the gel recovery kit is directly used for recovering the enzyme digestion products.

5. Connection transformation of vector and gene fragment and positive clone screening

(1) With the vector pQFC-M₃: the gene fragment SQSTM1 was ligated at a molar ratio of 1:3 using a ligase (T4 DNALigase, M0202L, NEB Co., Ltd., the same applies hereinafter) in accordance with the protocol.

(2) The ligation product is transformed into escherichia coli, the positive clone of the recombinant is picked up and inoculated into 5mL of LB culture medium containing 50 mug/mL ampicillin resistance and cultured overnight at 37 ℃, the plasmid DNA is extracted by purifying the small upgraded plasmid, and the recombinant plasmid pQFC-M is obtained after nucleotide sequencing verification₃-SQSTM1。

Example 3 recombinant plasmid pQFC-M₃Construction of-RIG-I

1. Design Synthesis of primers

A pair of specific primers is designed and synthesized according to the coding sequence of the human RIG-I Gene, Gene ID 23586, provided in NCBI, and the RIG-I Gene is amplified. The primer is synthesized by Shanghai biological engineering technology, Inc., and the sequence of the primer is as follows:

RIG-I-F(Xho1):CCCTCGAGGCCACCATGACCACCGAGCAGCGAC(SEQ ID NO：18)；

RIG-I-R(Not1):ATTTGCGGCCGCTTTGGACATTTCTGCTGGATC(SEQ ID NO：19)；

extraction of total RNA and cDNA Synthesis of HEK293 cells

HEK293 cells were cultured in 24-well plates and after one well had been filled, the medium was aspirated and total RNA extraction kit was used (Plus Mini Kit，Company products), extracting total RNA of cells according to the method introduced by the kit operating instruction. The extracted RNA was reverse-transcribed using a reverse transcription kit (MonScript)^TMRT III Super Mix with dsDNase (Two-Step), REF: MR05201, product of Mona Biotechnology company), reverse transcription is carried out according to the method introduced by the kit operating instruction, HEK293 cell genome cDNA is obtained, and frozen for standby.

PCR amplification and product recovery

And (3) performing PCR amplification on the RIG-I gene by taking the HEK293 cell genome cDNA synthesized in the step (2) as a template, wherein an amplification reaction system and specific reaction conditions are as follows:

the components are mixed evenly by a liquid transfer device, and the following reactions are carried out on a PCR thermal cycler:

agarose gel electrophoresis at 110V for 40min, and recovering DNA fragment with gel recovery kit (D2500-02, product of OMEGA, the same below) (according to kit instructions).

4. Digestion of vector and gene fragment and recovery

(1) pQFC-M was digested with restriction endonucleases XhoI and NotI (NEB Co., Ltd., the same applies hereinafter)₃No load or pQFC-M₃GFP plasmid, 110V, 80min agarose gel electrophoresis, gel recoveryKit for recovering DNA fragment pQFC-M of about 7.2kbp₃。

(2) And (3) digesting the RIG-I gel recovery product in the step 3 by using restriction endonuclease XhoI and NotI double enzymes, and directly recovering the enzyme digestion product by using a gel recovery kit.

5. Connection transformation of vector and gene fragment and positive clone screening

(1) With the vector pQFC-M₃: the gene fragment RIG-I was ligated with a ligase (T4 DNALigase, M0202L, product of NEB, the same applies hereinafter) at a molar ratio of 1:3 (as described in the specification).

(2) The ligation product is transformed into escherichia coli, the positive clone of the recombinant is picked up and inoculated into 5mL of LB culture medium containing 50 mug/mL ampicillin resistance and cultured overnight at 37 ℃, the plasmid DNA is extracted by purifying the small upgraded plasmid, and the recombinant plasmid pQFC-M is obtained after nucleotide sequencing verification₃-RIG-I。

Example 4 recombinant plasmid pQFC-M₃Construction of STING

1. Design Synthesis of primers

Based on the coding sequence of the human STING Gene, Gene ID 340061, provided in NCBI, a pair of specific primers was designed and synthesized to amplify the STING Gene. The primer is synthesized by Shanghai biological engineering technology, Inc., and the sequence of the primer is as follows:

STING-F(Xho1):CCCTCGAGGCCACCATGCCCCACTCCAGCCTGCATC(SEQ ID NO：20)；

STING-R(Not1):ATTTGCGGCCGCAGAGAAATCCGTGCGGAGAG(SEQ ID NO：21)；

extraction of total RNA and cDNA Synthesis of HEK293 cells

HEK293 cells were cultured in 24-well plates and after one well had been filled, the medium was aspirated and total RNA extraction kit was used (Plus Mini Kit，Company products), extracting total RNA of cells according to the method introduced by the kit operating instruction. The extracted RNA was reverse-transcribed using a reverse transcription kit (MonScript)^TMRT III Super Mix with dsDNase (Two-Step), REF: MR05201, product of Mona Biotechnology company), reverse transcription is carried out according to the method introduced by the kit operating instruction, HEK293 cell genome cDNA is obtained, and frozen for standby.

PCR amplification and product recovery

And (3) taking the HEK293 cell genome cDNA synthesized in the step (2) as a template, carrying out PCR amplification on the STING gene, wherein an amplification reaction system and specific reaction conditions are as follows:

the components are mixed evenly by a liquid transfer device, and the following reactions are carried out on a PCR thermal cycler: denaturation at 98 ℃ 10 Sec; annealing 15Sec at 60 ℃; extending for 1min at 68 ℃; the three steps are carried out for 30 cycles, and the mixture is stored at 10 ℃; agarose gel electrophoresis at 110V for 40min, and recovering DNA fragment with gel recovery kit (D2500-02, product of OMEGA, the same below) (according to kit instructions).

4. Digestion of vector and gene fragment and recovery

(1) pQFC-M was digested with restriction endonucleases XhoI and NotI (NEB Co., Ltd., the same applies hereinafter)₃No load or pQFC-M₃GFP plasmid, 110V, 80min agarose gel electrophoresis, recovery of the approximately 7.2kbp DNA fragment pQFC-M by gel recovery kit₃。

(2) And (3) digesting the product recovered from the STING gel in the step 3 by using restriction endonucleases XhoI and NotI double enzymes, and directly recovering the enzyme digestion product by using a gel recovery kit.

5. Connection transformation of vector and gene fragment and positive clone screening

(1) With the vector pQFC-M₃: the gene fragment STING was ligated at a molar ratio of 1:3 using a ligase (T4 DNALigase, M0202L, product of NEB, the same applies hereinafter) as described above.

(2) The ligation product is transformed into escherichia coli, the positive clone of the recombinant is picked up and inoculated into 5mL of LB culture medium containing 50 mug/mL ampicillin resistance and cultured overnight at 37 ℃, the plasmid DNA is extracted by purifying the small upgraded plasmid, and the recombinant plasmid pQFC-M is obtained after nucleotide sequencing verification₃-STING。

Example 5 recombinant plasmid pQFC-M₃Construction of TBK1

1. Design Synthesis of primers

A pair of specific primers is designed and synthesized according to the coding sequence of the human TBK1 Gene and Gene ID 29110 provided in NCBI, and the TBK1 Gene is amplified. The primer is synthesized by Shanghai biological engineering technology, Inc., and the sequence of the primer is as follows:

TBK1-F(XhoI):CCCTCGAGGCCACCATGCAGAGCACTTCTAATCATC(SEQ ID NO：22)；

TBK1-R(NotI):ATTT GCGGCCGCAAGACAGTCAACGTTGCGAAG(SEQ ID NO：23)；

extraction of total RNA and cDNA Synthesis of HEK293 cells

HEK293 cells were cultured in 24-well plates and after one well had been filled, the medium was aspirated and total RNA extraction kit was used (Plus Mini Kit，Company products), extracting total RNA of cells according to the method introduced by the kit operating instruction. The extracted RNA was reverse-transcribed using a reverse transcription kit (MonScript)^TMRT III Super Mix with dsDNase (Two-Step), REF: MR05201, product of Mona Biotechnology company), reverse transcription is carried out according to the method introduced by the kit operating instruction, HEK293 cell genome cDNA is obtained, and frozen for standby.

PCR amplification and product recovery

And (3) performing PCR amplification on the TBK1 gene by using the HEK293 cell genome cDNA synthesized in the step (2) as a template, wherein an amplification reaction system and specific reaction conditions are as follows:

the components are mixed evenly by a liquid transfer device, and the following reactions are carried out on a PCR thermal cycler: denaturation at 98 ℃ 10 Sec; annealing 15Sec at 60 ℃; extending for 1min at 68 ℃; the three steps are 30 cycles. Storing at 10 deg.C; agarose gel electrophoresis at 110V for 40min, and recovering DNA fragment with gel recovery kit (D2500-02, product of OMEGA, the same below) (according to kit instructions).

4. Digestion of vector and gene fragment and recovery

(1) pQFC-M was digested with restriction endonucleases XhoI and NotI (NEB Co., Ltd., the same applies hereinafter)₃No load or pQFC-M₃GFP plasmid, 110V, 80min agarose gel electrophoresis, recovery of the approximately 7.2kbp DNA fragment pQFC-M by gel recovery kit₃。

(2) And (3) digesting TBK1 gel in the step 3 by using restriction endonucleases XhoI and NotI double enzymes to recover products, and directly recovering the digested products by using a gel recovery kit.

5. Connection transformation of vector and gene fragment and positive clone screening

(1) With the vector pQFC-M₃: the gene fragment TBK1 was ligated at a molar ratio of 1:3 using ligase (T4 DNALigase, M0202L, product of NEB, the same applies hereinafter) as described in the specification.

(2) The ligation product is transformed into escherichia coli, the positive clone of the recombinant is picked up and inoculated into 5mL of LB culture medium containing 50 mug/mL ampicillin resistance and cultured overnight at 37 ℃, the plasmid DNA is extracted by purifying the small upgraded plasmid, and the recombinant plasmid pQFC-M is obtained after nucleotide sequencing verification₃-TBK1。

Example 6 recombinant plasmid pQFC-M₃Construction of IRF3

1. Design Synthesis of primers

A pair of specific primers is designed and synthesized according to the coding sequence of the human IRF3 Gene and Gene ID 3661 provided in NCBI, and the IRF3 Gene is amplified. The primer is synthesized by Shanghai biological engineering technology, Inc., and the sequence of the primer is as follows:

IRF3-F(Xho1):CCCTCGAGGCCACCATGGGAACCCCAAAGCCACG(SEQ ID NO：24)；

IRF3-R(Not1):ATTT GCGGCCGCGCTCTCCCCAGGGCCCTG(SEQ ID NO：25)；

extraction of total RNA and cDNA Synthesis of HEK293 cells

HEK293 cells were cultured in 24-well plates and, after they had grown over one well, the culture was aspiratedTotal RNA extraction kit (1)Plus Mini Kit，Company products), extracting total RNA of cells according to the method introduced by the kit operating instruction. The extracted RNA was reverse-transcribed using a reverse transcription kit (MonScript)^TMRT III Super Mix with dsDNase (Two-Step), REF: MR05201, product of Mona Biotechnology company), reverse transcription is carried out according to the method introduced by the kit operating instruction, HEK293 cell genome cDNA is obtained, and frozen for standby.

PCR amplification and product recovery

And (3) carrying out PCR amplification on the IRF3 gene by using the HEK293 cell genome cDNA synthesized in the step (2) as a template, wherein an amplification reaction system and specific reaction conditions are as follows:

the components are mixed evenly by a liquid transfer device, and the following reactions are carried out on a PCR thermal cycler: denaturation at 98 ℃ of 10Sec, annealing at 60 ℃ of 15 Sec; extending for 1min at 68 ℃, and performing three steps for 30 cycles; storing at 10 deg.C; agarose gel electrophoresis at 110V for 40min, and recovering DNA fragment with gel recovery kit (D2500-02, product of OMEGA, the same below) (according to kit instructions).

4. Digestion of vector and gene fragment and recovery

(1) pQFC-M was digested with restriction endonucleases XhoI and NotI (NEB Co., Ltd., the same applies hereinafter)₃No load or pQFC-M₃GFP plasmid, 110V, 80min agarose gel electrophoresis, recovery of the approximately 7.2kbp DNA fragment pQFC-M by gel recovery kit₃。

(2) And (3) digesting IRF3 gel in the step 3 by using restriction endonucleases XhoI and NotI double enzymes to recover products, and directly recovering the digested products by using a gel recovery kit.

5. Connection transformation of vector and gene fragment and positive clone screening

(1) With the vector pQFC-M₃: the gene fragment IRF3 was ligated at a molar ratio of 1:3 using a ligase (T4 DNALigase, M0202L, product of NEB, the same applies hereinafter) as described in the specification.

(2) The ligation product is transformed into escherichia coli, the positive clone of the recombinant is picked up and inoculated into 5mL of LB culture medium containing 50 mug/mL ampicillin resistance and cultured overnight at 37 ℃, the plasmid DNA is extracted by purifying the small upgraded plasmid, and the recombinant plasmid pQFC-M is obtained after nucleotide sequencing verification₃-IRF3。

Application example 1, application of C-terminal M-containing tag carrier in western blotting experiment

pQFC-M obtained in example 1 was added₃GFP, recombinant plasmid pQFC-M obtained in example 2₃SQSTM1, recombinant plasmid pQFC-M obtained in example 3₃RIG-I, recombinant plasmid pQFC-M obtained in example 4₃STING, recombinant plasmid pQFC-M obtained in example 5₃TBK1 and recombinant plasmid pQFC-M obtained in example 6₃IRF3 was expressed separately for validation experiments.

1. Cells were passaged and plated: cells of appropriate density were plated.

(1) Passaging was performed when the cells in the culture dish grew to 90%. Firstly, sucking out old culture solution in a culture dish, adding 2mL of PBS (phosphate buffer solution) to slightly rinse cells, and washing out culture medium residues; adding 1.5ml of 0.25% trypsin digestion solution, and digesting at 37 deg.C for 1 min; digestion was stopped by adding 6ml of DMEM medium and resuspension cells were blown with a pipette. 1ml of the cell suspension was aspirated off and transferred to a new dish and cultured further by adding 9ml of medium.

(2) The cell suspension 1.5ml was pipetted into a new 15ml centrifuge tube, supplemented with DMEM medium to 12ml, mixed well and plated in 24-well plates at a cell density of 500. mu.L per well for the next day of transfection.

2. Calcium phosphate transfection method the plasmids were transfected separately: transfection was performed at cell densities of 60% -70%.

After the cell number reaches 60% -70%, transfection is carried out, and the following system is prepared:

TABLE 7

	10cm dish	6well	12well	24well
					MilliQ H2O	Make up to 1ml	Make up 150ul	Make up 60ul	Make up 30ul
2MCaCl2	124ul	20ul	10ul	5ul
					SQSTM1	15-20ug	2-3.5ug	1-1.5ug	400-500ng

After the components are added, the mixture is gently mixed uniformly, 2xHBS with the same quantity is slowly added dropwise, and the mixture is gently mixed uniformly and separated briefly. After waiting for 10 minutes until fine particles precipitate, the mixture was added to a cell culture dish and gently mixed.

3. Cell lysis and sample preparation: and adding a proper amount of lysate into the cell plate, and preparing a sample after the cell plate is cracked on ice for 30 min.

(1) After about 24 hours after transfection, the 24-well plates were removed from the incubator, 100. mu.L of TAP lysate was added to each well on ice, and the plates were subjected to shake lysis at 4 ℃ for 30 minutes.

(2) The lysed cell lysate was pipetted into a 1.5ml EP tube and centrifuged at 15000rpm for 10min at 4 ℃. 45 μ L of centrifuged supernatant was pipetted into a new 1.5ml EP tube and 15 μ L of 4 x loading buffer was added. The sample was boiled in a metal bath at 70 ℃ for 15 min. Freezing and storing at-20 ℃.

4. Western Blot (WB)

(1) Preparing glue: 10% SDS PAGE gel and 5% concentrated gel were prepared, respectively.

(2) Electrophoresis: add 8-10. mu.L of sample to each well, and perform electrophoresis at 180V for 50 min.

(3) Electric rotation (wet rotation): the following placing steps are carried out in the following order: transparent well plate, black sponge, filter paper, PVDF membrane, protein glue (placed in mirror symmetry), filter paper (after adding the layer of filter paper, removing air bubbles with a pipette), black sponge, black well plate. 80V (current is kept between 0.18 and 0.2A) and the film is rotated for 1 hour.

(4) And (3) sealing: 5% skimmed milk, slowly sealing on horizontal shaker for 1 h.

(5) Incubating primary antibody: incubate at 4 ℃ overnight.

(6) Washing the membrane: wash 3 times with 1 × TBS for 5min each time.

(7) Hatching a secondary antibody: incubate for 1h at room temperature.

(8) Washing the membrane: washing with 1 × TBS for 6 times, 5min each

(9) And (3) developing: ECL substrate (equal amount of A \ B solution mixed well), 3 min; developing in dark room, placing in X-ray film, and placing in developing machine after 1 min. X-ray films were obtained which exposed the SQSTM1 protein bands.

As shown in fig. 3, the fusion protein with three M-tags was more sensitively recognized by the 3B9 antibody than the fusion protein with only one M-tag.

As shown in FIG. 4, M-tagged fusion proteins (SQSTM1, RIG-I, STING, TBK1 and IRF3) were detected in HEK293 cell lysates by Western blotting, and the results also indicated that: the 3B9 monoclonal antibody is sensitive to the recognition of the 3M sequence fused at the N end; compared with the size difference of the protein, the 3B9 antibody has stronger recognition capability for the protein with small molecular weight.

Application example 2, application of C-terminal M-containing label carrier in immunofluorescence experiment

1. Cell slide culture and transfection

(1) One day before transfection, cell slide was put into 24-well plates and a certain number of Hela cells were plated.

(2) Mixing pQFC-M₃SQSTM1 was transfected into Hela cells in the same manner as in application example 1.

2. Immunofluorescence assay

(1) The medium was aspirated and the cells were rinsed 1 time with PBS.

(2) Cells were fixed with pre-chilled absolute methanol for 10min, and after completion, rinsed 3 times with PBS, 3min each time.

(3) The membrane is broken and the holes are punched for 15min by using 0.5% Triton X-100, and after the membrane is broken, PBS is used for rinsing for 3 times, each time for 3 min.

(4) Blocking was performed with 2% BSA for 30 min.

(5) Primary antibody was formulated with 1% BSA and incubated overnight in a refrigerator at 4 ℃ and after completion washed three times with PBS for 3min each.

(6) A secondary antibody 594-mouse with a fluorophore of a rat species was prepared using 1% BSA, incubated in an incubator at 37 ℃ for 1h in the dark, and then washed three times with PBS for 3min each time.

(7) Nuclei were stained with DAPI for 10min and washed 3 times with PBS for 3min each.

(8) And sealing with a sealing agent, and observing and photographing under a fluorescence microscope after the sealing agent is dried.

The results show that the natural human-derived selective autophagy linker protein Sequestosome-1(SQSTM1) protein and the tag-labeled SQSTM1 protein both mainly aggregate in cytoplasm and are in a punctate distribution, indicating that the M tag/3B 9 monoclonal antibody system can indicate the correct localization of SQSTM1, i.e., in the chelated bodies. From figure 5 it can be observed that no additional background was stained red, in addition to the red fluorescence of co-localized SQSTM1, demonstrating the good specificity of the M-tag/3B 9 monoclonal antibody system in immunofluorescence localization. Furthermore, the M-tag appeared to be brighter than the red fluorescence of the FLAG tag, demonstrating that the use of the M-tag system in immunofluorescence localization was somewhat more sensitive than FLAG.

Application example 3, application of C-terminal M-containing tag carrier in immunoprecipitation experiment

1. Preparation of monoclonal antibody coupled glyoxal agarose beads.

(1) Preparing reagents and materials required in the experiment;

TABLE 8

(2) Calculating the volume of agarose beads required for coupling according to the quantity of the cloned antibody required for the experiment;

(3) using ddH₂O agarose beads were washed twice, centrifuged to remove supernatant, and washed with prepared 0.1M NaHCO₃pH10 agarose beads were resuspended to 1 mL;

(4) suspending the corresponding monoclonal antibody to 9 mL;

(5) adding the heavy suspension obtained in the steps 3 and 4 into the same 15mL centrifuge tube, uniformly mixing, incubating on a rotary shaking table at 4 ℃, and incubating until the light absorption value at 280nm does not change, wherein 1-6h is probably needed, so that the monoclonal antibody is coupled with the activated agarose beads;

(6) transferring the incubated liquid to a 50mL beaker, adding 10mg of sodium borohydride, stirring gently for 30min, and sealing the residual active groups of the agarose beads;

(7) transferring to a 15mL centrifuge tube, removing supernatant through centrifugation, recovering the supernatant, and washing the coupled agarose beads with 25mM PBS pH 7 for 3 times to remove residual sodium borohydride if residual antibodies can be used in a protein immunoblotting experiment;

(8) the monoclonal antibody-conjugated agarose beads were resuspended in 20% ethanol and stored at 4 ℃.

2. Immunoprecipitation experiments

(1) Inoculating a certain number of cells into a 6-well plate according to experiment requirements in the day before transfection;

(2) the next day when the cell density reaches about 60-70%, adding pQFC-no tag-GFP and pQFC-FLAG₃GFP and pQFC-FLAG₃-M₃GFP was transfected into three wells separately;

(3) 24h after transfection, the medium was aspirated off by vacuum pump, 500. mu.L of 1 × TAP lysis buffer was added, and cells were lysed on a shaker for 30 min;

(4) collecting cells in 1.5mL EP tube, 4 ℃, 15000rpm, centrifugation for 10 min;

(5) adding 10 μ L of 5 XLDS loading buffer into 40 μ L of lysis supernatant as input sample, and decocting at 70 deg.C for 15 min;

(6) adding a proper amount of agarose beads combined with the 3B9 monoclonal antibody into the residual lysate, sealing, and rotating a shaking table at 4 ℃ for overnight incubation for 16 h;

(7) taking the incubated sample, centrifuging at 4 ℃ and 15000rpm for 10min, and removing the supernatant;

(8) centrifuging at 15000rpm at 4 deg.C for 5min, and removing supernatant;

(9) adding 480. mu.L of IP wash buffer and 20. mu.L of 5M NaCl into the beads, washing for 5min at 4 ℃ by a rotary table, centrifuging for 5min at 4 ℃ at 15000rpm, discarding the supernatant, and repeating the step once;

(10) adding 480. mu.L of IP wash buffer and 20. mu.L of 5M NaCl into the beads, washing the beads for 30min at 4 ℃ by a rotary table, centrifuging the beads for 5min at 4 ℃ at 15000rpm, and removing supernatant;

(11) adding 480. mu.L of IP wash buffer and 20. mu.L of 5M NaCl into the beads, washing for 1h at 4 ℃ by a rotary table concentrator, centrifuging for 5min at 4 ℃ at 15000rpm, and removing supernatant;

(12) adding 500 μ L IP wash buffer L to beads, washing with a rotary shaker at 4 deg.C for 5min, centrifuging at 4 deg.C and 15000rpm for 5min, and discarding the supernatant;

(13) centrifuging at 15000rpm at 4 deg.C for 5min, and removing supernatant;

(14) adding 20 μ L of 1 × LDS loading buffer, and boiling at 95 deg.C for 15 min;

(15) WB verification results.

The results show that western blot analysis of these cell lysates using anti-FLAG monoclonal antibody as input control (fig. 6, lanes 1, 2 and 3) enables detection of GFP expression.

Immunoprecipitation was performed with agarose beads conjugated with the 3B9 monoclonal antibody, followed by immunoblot analysis with an anti-FLAG monoclonal antibody to detect immunoprecipitation. When the DNA fragment is reacted with No tag-GFP and GFP-FLAG₃When comparing the immunoprecipitates of the control lysates (FIG. 6, lanes 4 and 5), it was observed that the anti-FLAG monoclonal antibody clearly detected the FLAG-tagged and M-tagged proteins after immunoprecipitation of 3B9 agarose beads, i.e., GFP-FLAG₃-M₃Immunoprecipitate (FIG. 6, lane 6).

Application example 4, application of C-terminal M-containing tag vector in flow cytometry experiment

(1) Inoculating a certain number of cells into a 6-well plate according to experiment requirements in the day before transfection;

(2) after the cell density reaches about 60-70%, pQFC-M is transfected according to the experimental requirements₃-a GFP plasmid;

(3) after transfection for 48 hours, removing the culture medium, adding a proper amount of pancreatin for digestion, and adding the mixture into a 1.5mL centrifuge tube for cell collection after heavy suspension by using DMEM;

(4) centrifuging at 4 deg.C and 300g for 5min, and removing DMEM and pancreatin;

(5) adding 200 μ L precooled PBS, washing for 1 time at 4 deg.C and 300g, centrifuging for 5min, and removing PBS;

(6) adding 4% paraformaldehyde, mixing, and fixing cells at room temperature for 15 min;

(7) adding 200 μ L precooled PBS, washing for 2 times, 3 min/time, 4 deg.C, 300g, centrifuging for 5min, and removing the stationary liquid;

(8) adding 0.1% Triton X-100, and performing permeabilization on ice for 10 min;

(9) adding 200 μ L precooled PBS, washing for 2 times, 3 min/time, 4 deg.C, 300g, centrifuging for 5min, and removing the permeabilization solution;

(10) adding Blocking buffer, and sealing at room temperature for 30 min;

(11) preparing primary anti-FLAG and anti-M antibodies by using FASC buffer, incubating for 1h at room temperature, and washing for 3 times of PBS (3 min/time) after incubation is completed;

(12) preparing a secondary antibody with a corresponding fluorescent group by using FASC buffer, incubating for 30min in a shading mode at room temperature, and washing for 3 times and 3 min/time by using PBS after the incubation is finished;

(13) add 500. mu.L PBS to resuspend the cells;

(14) filtering the cells in the centrifugal tube into a flow type by using a nylon net film, and marking;

(15) detection was performed by flow cytometry.

To apply the M tag/3B 9 monoclonal antibody system to flow cytometry analysis of fusion proteins, pQFC-M was used₃GFP transfection into HEK293 cells. After staining with 3B9 monoclonal antibody, cells were analyzed by flow cytometry (fig. 7). HEK293 blank cells not transfected with any plasmid served as negative controls; as GFP emits green fluorescence, FITC is used for detecting the proportion of recombinant protein cells and is used as a positive control group; the proportion of recombinant protein cells was measured by APC as experimental group due to staining 3B9 monoclonal antibody-labeled GFP protein with 647 fluorescent secondary antibody. No marker was observed in the negative control, and pQFC-M was detected in the positive control₃41.19% of cells of the GFP recombinant protein, respectively, and pQFC-M detected by the 3B9 monoclonal antibody in the experimental group₃17.47% cells of GFP recombinant protein.

Finally, it should also be noted that the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus.

While preferred embodiments of the present invention have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. Therefore, it is intended that the appended claims be interpreted as including preferred embodiments and all such alterations and modifications as fall within the scope of the invention.

It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.

Sequence listing

<110> Wuhan university

<120> expression vector with epitope tag M at C-terminal, and construction method and application thereof

<160> 25

<170> SIPOSequenceListing 1.0

<210> 1

<211> 6

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Pro Pro Tyr Asp Asp Asp

1 5

<210> 2

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

cctccgtatg acgatgac 18

<210> 3

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ccctcgaggc caccatggtg agcaagggcg aggag 35

<210> 4

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atttgcggcc gccttgtaca gctcgtccat gc 32

<210> 5

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ggccgcacct ccgtatgacg atgactaag 29

<210> 6

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gatccttagt catcgtcata cggaggtgc 29

<210> 7

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ggccgcacct ccgtatgacg atgaccctcc gtat 34

<210> 8

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

catcgtcata cggagggtca tcgtcatacg gaggtgc 37

<210> 9

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gacgatgacc ctccgtatga cgatgactaa g 31

<210> 10

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gatccttagt catcgtcata cggagggt 28

<210> 11

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

tcgagaccgg tttaattaac ggatcc 26

<210> 12

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

gcggccgcgg atccgttaat taaaccggtc 30

<210> 13

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

gcggccgcac ctccgtatga cgatgactaa g 31

<210> 14

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

aattcttagt catcgtcata cggaggt 27

<210> 15

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

aattcttagt catcgtcata cggagggt 28

<210> 16

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

ccctcgagat gtcggaagcg ggcgaggag 29

<210> 17

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

atttgcggcc gcgtatggct tgtagttatt ctgatg 36

<210> 18

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

ccctcgaggc caccatgacc accgagcagc gac 33

<210> 19

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

atttgcggcc gctttggaca tttctgctgg atc 33

<210> 20

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

ccctcgaggc caccatgccc cactccagcc tgcatc 36

<210> 21

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

atttgcggcc gcagagaaat ccgtgcggag ag 32

<210> 22

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

ccctcgaggc caccatgcag agcacttcta atcatc 36

<210> 23

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

atttgcggcc gcaagacagt caacgttgcg aag 33

<210> 24

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

ccctcgaggc caccatggga accccaaagc cacg 34

<210> 25

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

atttgcggcc gcgctctccc cagggccctg 30