1. A vector system for simultaneously knocking out a CD163 gene and an MSTN gene, comprising a CD163 gene knock-out vector and an MSTN gene knock-out vector, wherein:

the CD163 gene knockout vector comprises a vector framework and a first DNA segment connected to the vector framework, wherein the nucleotide sequence of the first DNA segment is shown as SEQ ID NO: 1 is shown in the specification;

the MSTN gene knockout vector comprises a vector skeleton and a second DNA segment connected to the vector skeleton, wherein the nucleotide sequence of the second DNA segment is shown as SEQ ID NO: 2 is shown in the specification;

and the vector frameworks of the CD163 gene knockout vector and the MSTN gene knockout vector are CRISPR/Cas 9.

2. The vector system for simultaneously knocking out a CD163 gene and an MSTN gene according to claim 1, wherein the CRISPR/Cas9 is pX 330.

3. A method for preparing pig fibroblasts with CD163 gene and MSTN gene knocked-out simultaneously, which comprises the following steps:

(1) constructing a vector system for simultaneously knocking out a CD163 gene and an MSTN gene according to any one of claims 1-2;

(2) transferring the vector system into pig fibroblasts, and obtaining the monoclonal cells of homozygous knockout CD163 gene and MSTN gene by screening and identification.

4. The method for preparing pig fibroblasts with the CD163 gene and the MSTN gene knocked out simultaneously according to claim 3, wherein the pig fibroblasts are pig fetal fibroblasts.

5. The method for preparing the pig fibroblasts with the CD163 gene and the MSTN gene knocked out simultaneously according to claim 3, wherein the step (1) is specifically as follows:

annealing the complementary oligonucleotide single strand to form a double strand, connecting the double strand with a vector skeleton subjected to enzyme digestion, and screening to obtain positive clone to obtain the CD163 gene knockout vector, wherein the sequence of the complementary oligonucleotide single strand is shown as SEQ ID NO: 3-4;

annealing the complementary oligonucleotide single strand to form a double strand, connecting the double strand with a vector skeleton subjected to enzyme digestion, and screening to obtain positive clone to obtain the MSTN gene knockout vector, wherein the sequence of the complementary oligonucleotide single strand is shown as SEQ ID NO: 5-6;

obtaining a vector system comprising the CD163 gene knockout vector and the MSTN gene knockout vector.

6. The method for preparing the pig fibroblasts with the CD163 gene and the MSTN gene knocked out simultaneously according to claim 3, wherein the step (2) is specifically as follows: transferring the CD163 gene knockout vector and the MSTN gene knockout vector obtained in the step (1) into pig fibroblasts by an electrotransfection method, screening to obtain monoclonal cells by a limiting dilution method, and identifying whether the monoclonal cells are positive monoclonal cells of CD163 gene and MSTN gene homozygous knockout, so as to obtain the monoclonal cells of the CD163 gene and the MSTN gene homozygous knockout.

7. The method for preparing pig fibroblasts with the CD163 gene and the MSTN gene knocked out simultaneously according to claim 6, wherein the identification in the step (2) is specifically as follows: extracting the genome DNA of the monoclonal cell of homozygous knockout CD163 gene and MSTN gene, and respectively using the DNA sequences shown in SEQ ID NO: 7-8 and SEQ ID NO: 9-10, sequencing the amplification product, and judging whether the monoclonal cell is a positive monoclonal cell homozygous and knocked out for the CD163 gene and the MSTN gene according to the sequencing result.

8. The method for preparing pig fibroblasts with simultaneous CD163 and MSTN gene knock-outs according to claim 7, wherein in the identification of step (2), the nucleotide sequence shown in SEQ ID NO: 7-8 is the annealing temperature of the PCR amplification of the primer of 57-59 ℃, and the cycle number is 32-38; using SEQ ID NO: the annealing temperature of PCR amplification with 9-10 primers is 60-62 ℃, and the cycle number is 32-36.

9. The porcine fibroblast prepared by the method according to any one of claims 3-8 and simultaneously knocked out of CD163 gene and MSTN gene.

10. A method of gene editing a pig comprising the steps of:

the porcine fibroblast as defined in claim 9 is used as a nuclear transfer donor cell, the nucleus thereof is transferred into an enucleated oocyte, a recombinant cloned embryo is prepared and transferred into a mother body to obtain a gene-edited pig with both the CD163 gene and the MSTN gene being knocked out through pregnancy.

Background

Porcine Reproductive and Respiratory Syndrome (PRRS) is a highly contagious disease characterized primarily by anorexia, fever, reproductive disorders such as premature pregnancy in pregnant sows, late abortion, stillbirth, weak and mummy, and respiratory diseases and high mortality in piglets and growing pigs, caused by the PRRSV. The disease is also called "blue-ear disease" because it is clinically manifested as cyanosis of the ear skin.

PRRSV primarily infects well differentiated Porcine Alveolar Macrophages (PAM) in vivo. A prerequisite for PRRSV infection of target cells is adsorption to the host cell, and receptors on the surface of the host cell are essential for this adsorption process. Heparan Sulfate (HS), Sialoadhesin (Sn) and CD163(Cluster of Differentiation 163) molecules were found to be three important receptor molecules present on PAM that bind PRRSV. Among them, CD163 is a cysteine-rich scavenger receptor, a typical type I glycosylated protein, and also an antigen for macrophage differentiation, and has a molecular size of 130kD, and is also called M130 protein. CD163 was originally recognized as a specific identifying protein for macrophages and monocytes and was expressed in macrophages in lung, spleen, liver, lymphoid mass and thymus tissue. It has been shown that transfection and expression of CD163 molecules in PRRSV non-susceptible cell lines (e.g., BHK-21 and PK-15) can cause these cell lines to infect PRRSV and produce progeny virions intracellularly, and antibodies against human CD163 can block infection with PRRSV, indicating that CD163 is an essential receptor for the virus. The CD163 protein domain SRCR5 is essential for viral infection of cells, while the amino-terminal 4 SRCR and cytoplasmic tail are not essential, with the SRCR5 domain being encoded by the CD163 exon 7. Therefore, studying CD163 genetically modified pigs may provide necessary evidence whether the CD163 receptor is an important role in the PRRSV infection process.

Another aspect of the invention relates to the muscle production of pigs. Muscle growth is regulated by a number of factors, with myostatin playing a major negative regulatory role. Myostatin (MSTN) or growth differentiation factor-8 (GDF-8), which belongs to transforming growth factor-beta (TGF-beta) superfamily, is the major negative regulatory factor of muscle. The mouse with the myostatin gene knocked out undergoes extensive hyperplasia and hypertrophy, the amount of skeletal muscle is remarkably increased, and the average body weight exceeds 261% of that of a normal mouse, but no other phenotypic difference exists. Furthermore, the phenotype of muscle mass increase in myostatin knockout mice can be maintained throughout life, and older myostatin knockout mice have increased muscle mass and muscle strength over control mice.

In the pig industry, the improvement of meat yield and disease resistance are important requirements of the industry, and the characters are one of the difficulties of traditional selective breeding. The invention adopts the genetic engineering modification technology to directionally modify the corresponding gene loci of the pig-related traits, establishes a rapid and simple multi-gene simultaneous editing scheme, gives various phenotypes to animals at one time, provides a convenient scheme for establishing dominant pig breeding materials, and has positive promotion effect on the breeding industry.

Based on the method, the method for quickly, accurately and effectively knocking out the porcine CD163 gene and the MSTN gene simultaneously is established, and the obtained porcine fibroblast or pig with the porcine CD163 gene and the MSTN gene knocked out has important significance in research on improvement of porcine reproductive and respiratory syndrome resistance, improvement of lean meat percentage of the pig and new variety breeding of the pig.

Disclosure of Invention

The technical problem to be solved by the invention is as follows: provides a carrier system capable of quickly, accurately and effectively knocking out the porcine CD163 gene and the MSTN gene simultaneously, a method for preparing porcine fibroblasts capable of knocking out the porcine CD163 gene and the MSTN gene simultaneously and a method for gene editing pigs.

In order to solve the technical problems, the invention adopts the technical scheme that: providing a vector system for knocking out a CD163 gene and an MSTN gene simultaneously, the vector system comprising a CD163 gene knock-out vector and an MSTN gene knock-out vector, wherein:

the CD163 gene knockout vector comprises a vector framework and a first DNA segment connected to the vector framework, wherein the nucleotide sequence of the first DNA segment is shown as SEQ ID NO: 1 is shown in the specification;

the MSTN gene knockout vector comprises a vector skeleton and a second DNA segment connected to the vector skeleton, wherein the nucleotide sequence of the second DNA segment is shown as SEQ ID NO: 2 is shown in the specification;

and the vector frameworks of the CD163 gene knockout vector and the MSTN gene knockout vector are CRISPR/Cas 9.

Preferably, in the above vector system for simultaneously knocking out CD163 gene and MSTN gene, the CRISPR/Cas9 is pX 330.

The other technical scheme provided by the invention is as follows: provided is a method for preparing porcine fibroblasts with CD163 gene and MSTN gene knockout simultaneously, comprising the following steps:

(1) constructing a vector system for simultaneously knocking out the CD163 gene and the MSTN gene;

(2) transferring the vector system into pig fibroblasts, and obtaining the monoclonal cells of homozygous knockout CD163 gene and MSTN gene by screening and identification.

Preferably, in the method for preparing the pig fibroblast with the CD163 gene and the MSTN gene knocked out simultaneously, the pig fibroblast is a pig fetal fibroblast.

Preferably, in the method for preparing the pig fibroblast with the CD163 gene and the MSTN gene knocked out simultaneously, the step (1) is specifically:

annealing the complementary oligonucleotide single strand to form a double strand, connecting the double strand with a vector skeleton subjected to enzyme digestion, and screening to obtain positive clone to obtain the CD163 gene knockout vector, wherein the sequence of the complementary oligonucleotide single strand is shown as SEQ ID NO: 3-4;

annealing the complementary oligonucleotide single strand to form a double strand, connecting the double strand with a vector skeleton subjected to enzyme digestion, and screening to obtain positive clone to obtain the MSTN gene knockout vector, wherein the sequence of the complementary oligonucleotide single strand is shown as SEQ ID NO: 5-6;

obtaining a vector system comprising the CD163 gene knockout vector and the MSTN gene knockout vector.

Preferably, in the method for preparing the pig fibroblast with the CD163 gene and the MSTN gene knocked out simultaneously, the step (2) is specifically: transferring the CD163 gene knockout vector and the MSTN gene knockout vector obtained in the step (1) into pig fibroblasts by an electrotransfection method, screening to obtain monoclonal cells by a limiting dilution method, and identifying whether the monoclonal cells are positive monoclonal cells of CD163 gene and MSTN gene homozygous knockout, so as to obtain the monoclonal cells of the CD163 gene and the MSTN gene homozygous knockout.

Preferably, in the method for preparing the pig fibroblast with the CD163 gene and the MSTN gene knocked out simultaneously, the identification in the step (2) is specifically as follows: extracting the genome DNA of the monoclonal cell of the homozygous knockout CD163 gene and MSTN gene, and respectively using the DNA sequences shown as SEQ ID NO: 7-8 and SEQ ID NO: 9-10, sequencing the amplification product, and judging whether the monoclonal cell is a positive monoclonal cell homozygous and knocked out for the CD163 gene and the MSTN gene according to the sequencing result.

Preferably, in the method for preparing the pig fibroblast with the CD163 gene and the MSTN gene knocked out simultaneously, in the identification of the step (2), the gene sequence of seq id no: 7-8 is the annealing temperature of the PCR amplification of the primer of 57-59 ℃, and the cycle number is 32-38; using SEQ ID NO: 9-10 is the primer, the annealing temperature of PCR amplification is 60-62 ℃, and the cycle number is 32-36. Further, in the identification of step (2), the sequence of seq id no: 7-8 is the annealing temperature of the PCR amplification of the primer, and the cycle number is 34; using SEQ ID NO: the annealing temperature of the PCR amplification with primers 9-10 was 60 ℃ and the cycle number was 34.

The invention provides another technical scheme as follows: provides the pig fibroblast which is prepared by the method and simultaneously knocks out the CD163 gene and the MSTN gene.

The invention provides another technical scheme as follows: a method for gene editing pigs is provided, which comprises the following steps:

the pig fibroblast as claimed in claim is used as a nuclear transfer donor cell, the nucleus of the pig fibroblast is transferred into a denucleated oocyte, a recombinant cloned embryo is prepared and is transferred into a mother body, and a gene editing pig with the CD163 gene and the MSTN gene simultaneously knocked out is obtained through pregnancy.

The invention has the beneficial effects that: the invention provides a carrier system for simultaneously knocking out a porcine CD163 gene and an MSTN gene, a method for preparing a porcine fibroblast for simultaneously knocking out the porcine CD163 gene and the MSTN gene and a method for preparing a gene editing pig. The traditional gene knockout system is mainly based on a homologous recombination system, has too low efficiency for the species such as pigs needing gene operation based on fibroblasts, is difficult to effectively edit target gene loci, and can knockout target genes only by complex operation and a great deal of energy. The vector system and the method have the advantages of reducing the difficulty of gene operation, improving the knockout efficiency and quickly knocking out the CD163 gene and the MSTN gene in a short time. The invention adopts a double-plasmid cotransfection scheme and then uses low-density monoclonal culture to obtain the unicellular clone with double genes edited simultaneously. Meanwhile, the efficiency of double gene knockout is in an acceptable range, a cell line with double gene deletion can be obtained at one time, and the preparation process of double/multiple gene editing animals is greatly shortened. In the aspect of characters, the cell is deficient in both CD163 (PRRSV resistance) and MSTN (muscle yield increase), and has two excellent economic characters, and the produced cloned pig is an excellent breeding material for breeding pigs, so that the economic benefit can be obviously improved in industrial application.

Drawings

FIG. 1 is a diagram of the backbone of pX330 vector in example 1 of the present invention;

FIG. 2 is a diagram showing an effect analysis of the gene targeting system of example 2 of the present invention;

FIG. 3 is a photograph of cells obtained by double gene knock-out screening in example 2 of the present invention;

FIG. 4 is a schematic diagram of PCR amplification of MSTN and CD163 target sites of example 2 of the present invention;

FIG. 5 is a schematic representation of the CD163 or MSTN knock-out genotype of the identified partial cell clones of example 2 of the present invention;

fig. 6 is a schematic representation of the PCR of DKO14 cells at the CD163 editing target in example 2 of the invention;

fig. 7 is a schematic representation of the PCR of DKO14 cells at the MSTN editing target in example 2 of the invention.

Detailed Description

In order to explain technical contents, achieved objects, and effects of the present invention in detail, the following description is made with reference to the accompanying drawings in combination with the embodiments.

Porcine fetal fibroblasts (PEFs) in the following examples were prepared as follows: the head, tail, limbs, internal organs and bones of the embryo of the big white pig of 35 days old are removed, and the blood is cleaned. Continuously shearing the fetus for 5min by using an elbow ophthalmic scissors to ensure sufficient shearing, sucking the sheared fetal tissue into a 15mL centrifuge tube by using a large-size gun head of the shearing head, adding 5mL complete culture medium, centrifugally settling cells and tissue blocks, removing the culture solution of the supernatant, adding a DMEM culture solution containing 15% fetal calf serum and 2% double antibody into the lower layer cell tissue block to blow off the cells and the tissue blocks, flatly paving the cells and the tissue blocks in 5 10cm culture dishes for culture, and supplementing the culture solution to 5 mL. After the cells are attached to the wall for 6-8h, the culture solution is added to 10mL for continuous culture. Changing the liquid 1 time every day, and freezing and storing the cells for later use after the cells grow full of the culture dish. Wherein, the big white pig is provided for the wenshi group breeding farm.

Example 1 construction of CRISPR/Cas9 targeting vector targeting CD163 gene and MSTN gene

1. Firstly, an exon of a coding porcine CD163 gene and an exon of an MSTN gene are locked as targeting regions, and a plurality of gRNAs aiming at the CD163 and the MSTN, namely targeting sites, are respectively designed by using software. Wherein, the target site aiming at the CD163 is CD 163-gRNA: GGTCGTGTTGAAGTACAACA (SEQ ID NO: 1); the targeting site aiming at MSTN is MSTN-gRNA: GTCGAGTCCAAAATCTCTCC (SEQ ID NO: 2).

2. Complementary paired oligonucleotides were synthesized according to the gRNA sequences described above, as shown in table 1 below, table 1 being oligonucleotides complementary paired with gRNA sequences, lower case letters being matching vector enzyme cleavage site sequences.

TABLE 1

Name (R)	Sequence 5 '-3'
		CD163-gRNA-F-1(SEQ ID NO：3)	caccGGTCGTGTTGAAGTACAACA
CD163-gRNA-R-1(SEQ ID NO：4)	aaacTGTTGTACTTCAACACGACC
		MSTN-gRNA-F-1(SEQ ID NO：5)	cacc GTCGAGTCCAAAATCTCTCC
MSTN-gRNA-R-1(SEQ ID NO：6)	aaac GGAGAGATTTTGGACTCGAC

3. Constructing a CRISPR/Cas9 targeting vector targeting CD163 gene and MSTN gene,

the pX330 vector backbone is shown in FIG. 1. The specific construction method comprises the following steps:

(1) respectively treating 2 pairs of oligonucleotides synthesized in the table 1 at 98 ℃ for 5min, naturally cooling to room temperature, and annealing;

(2) carrying out enzyme digestion on a pX330 skeleton vector containing a Cas9 sequence for 2h at 37 ℃ by using a restriction endonuclease BbsI, and carrying out gel cutting to recover a linearized fragment;

(3) then, the linearized fragment was ligated with the annealed oligonucleotide at 16 ℃ for 1h, followed by transformation of Top10 or DH 5. alpha. competent cells, plated on LB plates containing ampicillin for growth;

(4) single colonies were picked for expanded culture and sequenced with the sequencing primer U6-FWD. After the comparison sequence is correct, carrying out amplification culture on the bacterial liquid;

(5) plasmids were extracted using the method provided by the plasmid deindothepsin maxikit (endofreplamid maxikit), and the plasmids were used for transfection of cells.

Example 2 establishment of Large white pig fetal fibroblast cell line with simultaneous CD163 and MSTN gene knock-outs

1. Cell transfection the plasmid obtained in example 1

The primary large white pig fetal fibroblasts were revived to a 6cm dish the day before transfection and cell transfection was performed when the cells reached 70-80% confluence. The transfection procedure was performed strictly according to the instructions of the BasicPrimaryFibroplasts NucleofectoKit (Lonza) kit.

2. Detection of targeting efficiency

After electrotransfection, a part of the cells are cultured, plated at low density to form single cell clones, and the other part is cultured in a complete mixed culture to identify the gene editing efficiency of the vector. A part of cells in mixed culture is collected after 48 hours, cell genomes are extracted, PCR amplification is carried out, and the targeting efficiency is identified by T7E 1. The results show that: the targeting efficiency of the CD163 gene gRNA is about 40 percent; the targeting efficiency of the MSTN gene gRNA is about 17%.

Referring to FIG. 2, FIG. 2 is a diagram illustrating the effect analysis of the gene targeting system according to the present invention. Wherein: 1 is DNA ladder; 2, analyzing the effect of T7E1 of the MSTN knockout plasmid; 3 is MSTN restriction enzyme digestion control; 4 is the effect analysis of T7E1 of CD163 knockout plasmid, and 5 is CD163 non-restriction control.

Using the extracted cell genome as a template, and carrying out PCR by using PremixTaq DNA polymerase, wherein PCR amplification primers are shown as follows:

wherein the amplification primer of the CD163 gene is CD 163-F: 5'-gaattgtctccagggaagga-3' (SEQ ID NO: 7) and CD 163-R: 5'-agcccagatctgtccacttc-3' (SEQ ID NO: 8). The amplification conditions were 95 ℃ for 5 min; at 95 ℃ for 30 s; at 58 ℃ for 30 s; 72 ℃ for 30 s; 72 ℃ for 10 min; bands were visualized by electrophoresis on a 2% agarose gel for 34 cycles.

Wherein the amplification primers of the MSTN gene are MSTN-F: 5'-tagggtaggaaagtgattcagg-3' (SEQ ID NO: 9) and MSTN-R: 5'-tggagacatctttgtgggagta-3' (SEQ ID NO: 10). The amplification conditions were 95 ℃ for 5 min; at 95 ℃ for 30 s; 30s at 60 ℃; 72 ℃ for 30 s; 72 ℃ for 10 min; bands were visualized by electrophoresis on a 2% agarose gel for 34 cycles.

3. Screening of Positive monoclonal cell lines

Low-density culture part of the cells the medium was changed every 3 days (DMEM + 15% FBS). After plating, the cells were cultured for about 10 days, and colony formation of cell colonies of appropriate size was observed. And (3) selecting the monoclonal cells for amplification culture, and simultaneously taking part of the cells for extracting the genome to identify the genotype.

Referring to fig. 3, fig. 3 is a photograph of the screened double gene knockout cells, which are numbers of two cells with better double gene knockout effect, and are respectively named DKO13 cells and DKO14 cells, and table 2 shows the statistical results of genotype analysis of the screened cells.

TABLE 2

Genotype(s)	Ratio of
		Homozygous for CD163	8/72＝11.1％
CD163 shuffling	20/72＝27.8％
		CD163 wild	44/72＝61.1％
Homozygous for MSTN	5/72＝7％
		MSTN hybrids	18/72＝25％
MSTN wild type	49/72＝68％
		Double allele Deletion (DKO)	4/72＝5.6％

4. Identification of Positive monoclonal cell lines

Identification of the single clones of the cells picked: PCR was performed using Pre mixTaq DNA polymerase using the extracted cell genome as a template.

Wherein the amplified fragment of the CD163 gene is 300bp, and the primers are CD 163-F: 5'-gaattgtctccagggaagga-3' (SEQ ID NO: 7) and CD 163-R: 5'-agcccagatctgtccacttc-3' (SEQ ID NO: 8). The amplification conditions were 95 ℃ for 5 min; at 95 ℃ for 30 s; at 58 ℃ for 30 s; 72 ℃ for 30 s; 72 ℃ for 10 min; 34 cycles.

The target fragment amplified by the MSTN gene is 300bp, and the primers are MSTN-F: 5'-tagggtaggaaagtgattcagg-3' (SEQ ID NO: 9) and MSTN-R: 5'-tggagacatctttgtgggagta-3' (SEQ ID NO: 10). The amplification conditions were 95 ℃ for 5 min; at 95 ℃ for 30 s; 30s at 60 ℃; 72 ℃ for 30 s; 72 ℃ for 10 min; 34 cycles.

And (3) observing the bands by 1% agarose gel electrophoresis, sending the PCR product to Huada gene company for sequencing, and screening a cell line with double genes simultaneously subjected to frame shift mutation to serve as a donor cell during nuclear transplantation according to the sequencing result.

Referring to FIG. 4, FIG. 4 is a schematic diagram of PCR amplification of MSTN and CD163 target sites. All single cell clones were individually subjected to PCR detection and Sanger sequencing to identify genotypes.

Referring to FIG. 5, a schematic representation of the CD163 or MSTN knockout genotype of the identified partial cell clones is shown.

Referring to fig. 6, fig. 6 is a schematic diagram of the PCR of DKO14 cells at the CD163 editing target.

Referring to fig. 7, fig. 7 is a schematic diagram of the PCR of DKO14 cells at the MSTN editing target.

5. Results of the experiment

Sequencing results show that a porcine fetal fibroblast line with a plurality of knocked-out CD163 genes and MSTN genes is successfully obtained, and the obtained cells generate homozygous frameshift mutation at CD163 and MSTN sites, so that the expression of the two genes can be completely eliminated.

Example 3 method of genome editing pigs

The homozygous knockout positive cell obtained in the example 2 is taken as a nuclear transfer donor cell, a young pig oocyte matured in vitro for 40 hours is taken as a nuclear transfer receptor cell, the nuclear transfer donor cell is transferred into the enucleated oocyte, and the recombined cloned embryo is constructed through electrofusion and activation, and the cloned recombined embryo with good development state is selected and transferred into the uterus of a naturally estrus multiparous sow by an operation method for pregnancy. The embryo transplantation step by the operation method is anesthesia of a breathing machine and is accompanied with 2 percent chloral hydrate maintenance anesthesia, the embryo is kept in a supine position on an operation frame, an operation incision with the length of about 10cm is made on the middle line of the abdomen, the ovary, the oviduct and the uterus are exposed, an embryo transplantation glass tube enters about 5cm along the umbrella part of the oviduct, and the cloned and recombined embryo with good development state is transplanted to the junction of the ampulla part-isthmus part of the oviduct. After embryo transplantation, technicians pay attention to observe the return situation and regularly check the pregnancy situation of recipient sows by B-type ultrasonic waves. The produced offspring are genome editing pigs with the CD163 gene and the MSTN gene knocked out.

The above description is only an embodiment of the present invention, and not intended to limit the scope of the present invention, and all equivalent changes made by using the contents of the present specification and the drawings, or applied directly or indirectly to the related technical fields are included in the scope of the present invention.

SEQUENCE LISTING

<110> Wen's food group, Inc., south China university of agriculture

<120> a vector system, method for preparing pig fibroblast and gene-edited pig

<160> 10

<170> PatentIn version 3.5

<210> 1

<211> 20

<212> DNA

<213> Artificial sequence

<400> 1

ggtcgtgttg aagtacaaca 20

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence

<400> 2

gtcgagtcca aaatctctcc 20

<210> 3

<211> 24

<212> DNA

<213> Artificial sequence

<400> 3

caccggtcgt gttgaagtac aaca 24

<210> 4

<211> 24

<212> DNA

<213> Artificial sequence

<400> 4

aaactgttgt acttcaacac gacc 24

<210> 5

<211> 24

<212> DNA

<213> Artificial sequence

<400> 5

caccgtcgag tccaaaatct ctcc 24

<210> 6

<211> 24

<212> DNA

<213> Artificial sequence

<400> 6

aaacggagag attttggact cgac 24

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence

<400> 7

gaattgtctc cagggaagga 20

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence

<400> 8

agcccagatc tgtccacttc 20

<210> 9

<211> 22

<212> DNA

<213> Artificial sequence

<400> 9

tagggtagga aagtgattca gg 22

<210> 10

<211> 22

<212> DNA

<213> Artificial sequence

<400> 10

tggagacatc tttgtgggag ta 22