Use of PLPP1 for the prevention and treatment of solid tumors using CAR-T technology, characterized in that PLPP1 is used to enhance the ability of T cells to secrete killer factors and at the same time to enhance the proliferative capacity of T cells when used for the prevention and treatment of solid tumors using CAR-T technology.

2. A CAR-T vector constructed by utilizing PLPP1 is characterized in that the vector is based on pCDH-EF1A-MCS-T2A-copGFP and recombines a PLPP1 sequence and a MSLN-CAR-P2A sequence;

the sequence of the PLPP1 is as follows:

Atgtttgacaagacgcggctgccgtacgtggccctcgatgtgctctgcgtgttgctggcttccatgcctatggctgttctaaaattgggccaaatatatccatttcagagaggctttttctgtaaagacaacagcatcaactatccgtaccatgacagtaccgtcacatccactgtcctcatcctagtgggggttggcttgcccatttcctctattattcttggagaaaccctgtctgtttactgtaaccttttgcactcaaattcctttatcaggaataactacatagccactatttacaaagccattggaacctttttatttggtgcagctgctagtcagtccctgactgacattgccaagtattcaataggcagactgcggcctcacttcttggatgtttgtgatccagattggtcaaaaatcaactgcagcgatggttacattgaatactacatatgtcgagggaatgcagaaagagttaaggaaggcaggttgtccttctattcaggccactcttcgttttccatgtactgcatgctgtttgtggcactttatcttcaagccaggatgaagggagactgggcaagactcttacgccccacactgcaatttggtcttgttgccgtatccatttatgtgggcctttctcgagtttctgattataaacaccactggagcgatgtgttgactggactcattcagggagctctggttgcaatattagttgctgtatatgtatcggatttcttcaaagaaagaacttcttttaaagaaagaaaagaggaggactctcatacaactctgcatgaaacaccaacaactgggaatcactatccgagcaatcaccagcc；

the MSLN-CAR-P2A sequence is shown as SEQ ID No. 1.

3. The CAR-T vector of claim 2, constructed in particular by the steps of:

firstly, obtaining the sequence of human PLPP1 open reading frame

First, primer sequences for PCR cloning were designed as follows:

PLPP1-F: 5’-atgtttgacaagacgcggct-3’，

PLPP1-R: 5’-aggctggtgattgctcggat-3’；

then, taking cDNA prepared by reverse transcription of the extracted human peripheral blood mononuclear cell RNA as a template, and carrying out PCR amplification by using the primer; carrying out electrophoresis detection on the PCR amplification product, cutting the gel and recovering the PCR amplification product to obtain a human PLPP1 open reading frame sequence;

(II) constructing a cloning vector containing a PLPP1 open reading frame

First, the primer sequences for PCR cloning of PLPP1 sequences were designed as follows:

F: 5’-actctagagctagcgaattcatgtttgacaagacgcggct-3’，

R: 5’-atccgagcaat caccagcctggatccgcggccgctgaggg-3’；

then, taking the PLPP1 open reading frame sequence extracted in the step (I) as a template, utilizing the designed primer to amplify the PLPP1 sequence again, after the amplification is finished, carrying out electrophoresis detection on the PCR amplification product, cutting gel to recover the PCR amplification product,

then, the amplification product extracted above was ligated with the linearized pCDH-EF1A-MCS-T2A-copGFP plasmid vector

Finally, transforming the ligation product into DH5 alpha competent cells, screening and identifying to obtain a cloning vector with correct recombination for later use;

(III) construction of PLPP1-MSLN CAR Lentiviral plasmid

First, when the MSLN-CAR-P2A sequence was PCR-amplified, primer sequences for PCR amplification were designed as follows:

F: 5’-actctagagctagcgaattcatggccttaccagtg accgc-3’，

R: 5’-agccgcgtcttgtcaaacataggtccagggttctcctcca-3’；

meanwhile, when the sequence of PLPP1 was amplified, the primer sequences for PCR amplification were designed as follows:

F: 5’-tggaggagaaccctggacctatgtttgacaagacgcggct-3’，

R: 5’-ccctcagcggccgcggatccaggctggtgattgctc ggat-3’；

then, respectively carrying out PCR amplification by using the recombinant plasmid containing the MSLN-CAR-P2A and the recombinant plasmid containing the PLPP1 sequence in the step (II) as templates by using the primers, and carrying out electrophoresis on the PCR amplification product and recovering fragments MSLN-CAR-P2A and PLPP 1;

then, MSLN-CAR-P2A and PLPP1 which are obtained by cloning are connected with a linearized pCDH-EF1A-MCS-T2A-copGFP plasmid vector by utilizing a NovoRec one-step PCR cloning kit,

and finally, transforming the ligation product into DH5 alpha competent cells, screening and sequencing to ensure correct recombination, wherein the recombinant DNA is the CAR-T vector PLPP1-MSLN CAR lentiviral plasmid.

4. Use of a CAR-T vector according to claim 2 or 3 for the preparation of a medicament for the prevention or treatment of a tumor associated with a non-small cell carcinoma, colorectal cancer or esophageal cancer, after transfection of T cells with the CAR-T vector.

Background

Malignant tumors are a big killer of human health, and the current main treatment methods include: surgery, radiotherapy and chemotherapy, targeted therapy and various combination therapies, but the treatment effect varies with the disease. In recent years, immunotherapy developed based on the human immune system is considered to be a tumor prevention and treatment method with an optimal technical prospect due to the advantages of wide application range, small side effect, no drug resistance and the like.

The CAR-T cell therapy is a novel tumor immunotherapy method generated by further combining gene therapy with adoptive cell feedback based on the principle of immunotherapy, and in the CAR-T cell therapy, the specific recognition capability of an antibody and an activation signal of a T cell are fused, so that the T cell is endowed with MHC-independent antigen specificity, and therefore, the CAR-T cell therapy has stronger tumor pertinence and better prevention and treatment effects.

Clinically, tumors can be classified into solid tumors and non-solid tumors according to their morphological characteristics. Solid tumors, i.e., solid tumors, can be detected by clinical examination such as X-ray radiography, CT scanning, B-ultrasound, or palpation, while tumors that cannot be detected by X-ray, CT scanning, B-ultrasound, or palpation, such as leukemia in hematological tumors, are non-solid tumors.

In the prior art, CAR-T therapy has good application prospect in the prevention and treatment of tumors in the blood system, but in the prevention and treatment of solid tumors, the CAR-T therapy still has more problems, and the main influencing factors comprise: heterogeneity, infiltration disorder, toxic response, CAR-T amplification and persistence of solid tumor target protein expression.

It has been suggested that solid tumors are often infiltrated by a number of different types of non-malignant cells, such as regulatory T cells, Myeloid Derived Suppressor Cells (MDSCs), tumor-associated macrophages (TAMs) and tumor-associated fibroblasts, which are capable of supporting tumor growth, promoting angiogenesis and tumor metastasis while suppressing anti-tumor immune responses. Therefore, the influence of the tumor microenvironment is also one of the main differences between the prevention and treatment of solid tumors and the prevention and treatment of tumors in the blood system, and is also one of the most main factors influencing the prevention and treatment effects of CAR-T. On the other hand, the high metabolic rate of malignant cells leading to local nutrient deficiency of tumors and the accumulation of immunosuppressive metabolic wastes are also one of the important features of the tumor microenvironment.

Cellular metabolism is the basis for the normal functioning of cells. The realization of foreign body recognition, signal transduction, clonal expansion and further killing function of T cells depends on the normal proceeding of metabolism. Studies have shown that intracellular fatty acid metabolism has a particular role in the performance of T cell functions. Fatty acids are not only one of the major components constituting cell membrane phospholipids, but also can supply energy to cells through fatty acid oxidation and participate in cell signal molecule synthesis and signal transmission.

Phosphosphatase 1 (PLPP 1), a multifunctional phosphophospholipase, catalyzes the hydrolysis of various fatty acid phospholipids, including LPA, S1P, PA, CRE-P, and the like. It has been reported that PLPP1 is down-regulated in most malignant tumors, resulting in accumulation of LPA at the tumor site, which serves as a growth factor to promote tumor cell growth. In addition, S1P plays an important role in T cell homing, while PA is an intracellular catalytic substrate of PLPP1, and can be hydrolyzed by PLPP1 into DAG, which is in turn an important second messenger for TCR downstream signaling, and is very important for T cell proliferation. It can be seen that although PLPP1 has a very important effect on cell metabolism and tumor microenvironment, it is very important to study and clarify whether PLPP1 has a direct effect on T cell immune function.

Disclosure of Invention

Based on the application of the PLPP1 in cell metabolism, the application aims to provide a new tumor prevention and treatment strategy, thereby laying a certain technical foundation for related tumor prevention and treatment.

The technical solution adopted in the present application is detailed as follows.

The application of the PLPP1 in preventing and treating the solid tumors by using the CAR-T technology, wherein the PLPP1 can enhance the capability of T cells to secrete killing factors and enhance the proliferation capability of the T cells when the CAR-T technology is used for preventing and treating the solid tumors.

A CAR-T vector constructed by utilizing PLPP1 is specifically constructed by the following steps:

firstly, obtaining the cloning sequence of human PLPP1 open reading frame

First, primer sequences for PCR cloning were designed as follows:

PLPP1-F: 5’-atgtttgacaagacgcggct-3’，

PLPP1-R: 5’-aggctggtgattgctcggat-3’；

then, taking cDNA prepared by reverse transcription of the extracted human peripheral blood mononuclear cell RNA as a template, and carrying out PCR amplification by using the primer; carrying out electrophoresis detection on the PCR amplification product, cutting the gel and recovering the PCR amplification product to obtain a human PLPP1 open reading frame sequence;

the human PLPP1 open reading frame sequence (854 bp) is specifically referred to as follows:

Atgtttgacaagacgcggctgccgtacgtggccctcgatgtgctctgcgtgttgctggcttccatgcctatggctgttctaaaattgggccaaatatatccatttcagagaggctttttctgtaaagacaacagcatcaactatccgtaccatgacagtaccgtcacatccactgtcctcatcctagtgggggttggcttgcccatttcctctattattcttggagaaaccctgtctgtttactgtaaccttttgcactcaaattcctttatcaggaataactacatagccactatttacaaagccattggaacctttttatttggtgcagctgctagtcagtccctgactgacattgccaagtattcaataggcagactgcggcctcacttcttggatgtttgtgatccagattggtcaaaaatcaactgcagcgatggttacattgaatactacatatgtcgagggaatgcagaaagagttaaggaaggcaggttgtccttctattcaggccactcttcgttttccatgtactgcatgctgtttgtggcactttatcttcaagccaggatgaagggagactgggcaagactcttacgccccacactgcaatttggtcttgttgccgtatccatttatgtgggcctttctcgagtttctgattataaacaccactggagcgatgtgttgactggactcattcagggagctctggttgcaatattagttgctgtatatgtatcggatttcttcaaagaaagaacttcttttaaagaaagaaaagaggaggactctcatacaactctgcatgaaacaccaacaactgggaatcactatccgagcaatcaccagcc；

(II) constructing a cloning vector containing a PLPP1 open reading frame

First, based on the subsequent requirement of Ecori and BamHI double digestion, the primer sequences for PCR cloning PLPP1 sequence were redesigned as follows (i.e., 20bp homologous sequences matching the ends of the linearized plasmid were added upstream and downstream respectively):

F: 5’-actctagagctagcgaattcatgtttgacaagacgcggct-3’，

R: 5’-atccgagcaat caccagcctggatccgcggccgctgaggg-3’；

then, taking the PLPP1 open reading frame sequence extracted in the step (I) as a template, utilizing the designed primer (introducing a homologous arm) to amplify the PLPP1 sequence again, after the amplification is finished, carrying out electrophoresis detection on a PCR amplification product, cutting gel and recovering the PCR amplification product,

then, the amplified product is connected with a linearized pCDH-EF1A-MCS-T2A-copGFP vector which is subjected to EcoRI and BamHI double enzyme digestion;

finally, transforming the ligation product into DH5 alpha competent cells, culturing overnight, selecting a single colony for sequencing verification, selecting a strain with a correct sequence, and extracting plasmids after amplification culture or freezing for later use;

(III) construction of PLPP1-MSLN CAR Lentiviral plasmid

First, based on the need to introduce the linearized vector homology arm upstream, PLPP1 homology sequence downstream, and the need to obtain the MSLN-CAR-P2A sequence from the amplification of a recombinant plasmid containing the MSLN-CAR-P2A-GFP sequence, primer sequences for PCR amplification were designed as follows:

F: 5’-actctagagctagcgaattcatggccttaccagtg accgc-3’，

R: 5’-agccgcgtcttgtcaaacataggtccagggttctcctcca-3’；

meanwhile, based on the upstream introduction of 20bp MSLN-CAR-P2A homology arm, the downstream introduction of linearized vector homology arm, and the amplification of PLPP1 sequence by using the recombinant plasmid containing PLPP1 sequence in step (1) as a template, the primer sequences for PCR amplification are designed as follows:

F: 5’-tggaggagaaccctggacctatgtttgacaagacgcggct-3’，

R: 5’-ccctcagcggccgcggatccaggctggtgattgctcggat-3’；

then, respectively carrying out PCR amplification by using the primers, carrying out electrophoresis on PCR amplification products, and recovering fragments MSLN-CAR-P2A (about 1500 bp) and PLPP1 (about 850 bp);

the MSLN-CAR-P2A sequence (1539 bp) is as follows:

atggccttaccagtgaccgccttgctcctgccgctggccttgctgctccacgccgccaggccgcaggtgcagctggtgcagtctggggctgaggtgaagcggcctggggcctcagtgcaggtttcctgcagggcatctggatactccatcaacacctactatatgcaatgggtgcgacaggcccctggagcagggcttgagtggatgggagtaatcaaccctagtggtgtcacaagctacgcacagaagttccagggcagagtcaccttgaccaatgacacgtccacgaacacagtctacatgcagctgaacagcctgacatctgcagacacggccgtgtattactgtgcgagatgggcattgtggggggatttcgggatggacgtctggggcaagggaaccctggtcaccgtctcctcaggtggtggtggttctggtggtggtggttctggtggtggtggttccggtggtggtggttccgacatccagatgacccagtctccttccaccctgtctgcatctattggagacagagtcaccatcacctgccgggccagtgagggtatttatcactggttggcctggtatcagcagaagccagggaaagcccctaaactcctgatctataaggcctctagtttagccagtggggccccatcaaggttcagcggcagtggatctgggacagatttcactctcaccatcagcagcctgcagcctgatgattttgcaacttattactgccaacaatatagtaattatccgctcactttcggcggagggaccaagctggagatcaaaaccacaacacccgccccccggccccccacacccgcccccacaatcgccagccagcccctgagcctgaggcccgaggcctgccggcccgccgccgggggggccgtgcacacaagggggctggatttcgcctgcgatatctacatctgggcccccctggccggcacctgcggcgtgctgctgctgagcctcgtgatcacactgtactgcaagagggggcggaagaagctgctgtacatcttcaagcagcccttcatgaggcccgtgcagaccacccaggaggaggacggctgttcctgtaggtttcctgaggaggaggaaggaggatgtgagttgcctagagtgaagttcagcaggagcgcagacgcccccgcgtaccagcagggccagaaccagctctataacgagctcaatctaggacgaagagaggagtacgatgttttggacaagagacgtggccgggaccctgagatggggggaaagccgagaaggaagaaccctcaggaaggcctgtacaatgaactgcagaaagataagatggcggaggcctacagtgagattgggatgaaaggcgagcgccggaggggcaaggggcacgatggcctttaccagggtctcagtacagccaccaaggacacctacgacgcccttcacatgcaggccctgccccctcgcggaagcggagctactaacttcagcctgctgaagcaggctggagacgtggaggagaaccctggacct；

then, the MSLN-CAR-P2A and PLPP1 sequences obtained by the cloning are connected with the linearized pCDH-EF1A-MCS-T2A-copGFP after double enzyme digestion of EcoRI and BamHI by utilizing a NovoRec one-step PCR cloning kit,

and finally, transforming the ligation product into DH5 alpha competent cells, screening and sequencing to ensure correct recombination (namely PLPP1-MSLN CAR lentiviral plasmid), and extracting the plasmid from the strain with correct sequencing or freezing for later use.

The CAR-T vector is used for preventing and treating related tumors after being transfected by T cells, wherein the tumors are non-small cell cancer, colorectal cancer or esophageal cancer related tumors.

It should be explained and illustrated that, in the present application, the sequence of PLPP1 and the sequence of MSLN-CAR-P2A involved in constructing CAR-T vector are all based on the sequences cited in the prior art, therefore, the related sequences are not the main innovation points of the present application, and the present application mainly aims to evaluate, verify and examine the improvement and promotion effect of PLPP1 on CAR-T related applications, thereby laying a foundation for further improvement of CAR-T technology. At the same time, it is to be explained that the associated CAR-

The T construction process is also carried out based on the factors of convenience and operability of experiments, relevant experimental conditions, relevant results and the like of the inventor and the applicant, and does not need to be carried out according to the route. In practical application, the relevant operation steps can be further adjusted and optimized according to practical conditions.

In the present application, by comparing the differences between activated T cells in peripheral blood and activated T cells in tumor tissue, and through careful analysis by the inventors, it was preliminarily thought that abnormalities in T cell lipid metabolism in the tumor microenvironment, which were the main cause of these abnormalities, were caused by PLPP1 molecules. The lack of PLPP1 expression in the tumor microenvironment may be the key to the metabolic changes on T cells that are caused by the complex immunosuppressive microenvironment acting on T cells in the tumor microenvironment, which in turn affects the function and activity of T cells. Based on the research, the inventor selects MSLN-CAR of a solid tumor target as a model to research the influence of PLPP1 on CAR-T function, and preliminary research results show that the function and proliferation capacity of CAR-T cells in a tumor microenvironment can be obviously enhanced after the modification of PLPP1, so that a good technical basis can be laid for the prevention and control of related diseases, and certain reference and reference are provided for the application of CAR-T technology in solid tumors and the prevention and control of other types of tumors.

Drawings

FIG. 1 is a graph showing the abnormal lipid metabolism of tumor-infiltrating T cells caused by the absence of PLPP1 expression, wherein:

a is HPLC-MS detection of the content of partial phospholipid Lipd-P and free Lipid Lipid of CD8+ CD69+ T cells in peripheral blood and a tumor microenvironment of a tumor patient;

b is a reaction schematic diagram of catalyzing hydrolysis of Lipid-P to generate Lipid by a PLPP family;

c is CD8+ T cell RNA-seq result in GEO database PLPP1, PLPP2, PLPP3 expression level;

d is the expression of CD69+ CD8+ T cell PLPP1 for detecting the peripheral blood and the tumor infiltration of the tumor patient by utilizing fluorescent quantitative PCR;

in the figure, TIL is Tumor infiltrating lymphocytes (Tumor infiltrating lymphocytes), PB is Peripheral blood derived CD8 of periphytol blood⁺ CD69⁺T cells, CA is tumor tissue-derived CD8⁺ CD69⁺A T cell;

FIG. 2 shows PLPP1 in CD8⁺Expression in T cells was analyzed for correlation with T cell proliferation and function; wherein:

a is the correlation of PLPP1 expression and T cell proliferation related gene expression in tumor infiltrating T cells in a GEO database;

b is correlation analysis of tumor infiltration T cell PLPP1 expression and T cell functional molecule expression in a GEO database;

FIG. 3 is a graph showing the effect of PLPP1 expression on T cell function and proliferative capacity in tumor-infiltrating T cells of patients with lung cancer; wherein:

a is the HIGH-expression PLPP1-HIGH of PLPP1 and the LOW-expression PLPP1-LOW of PLPP1 which classify the tumor-infiltrated T cells according to the expression level of PLPP1

B is T cell function related molecules IL-2, granzyme B and Perforin expression peak shape chart and average fluorescence intensity statistical result on tumor infiltration T cells of PLPP1-HIGH and PLPP 1-LOW;

c is the result of flow analysis of cell proliferation related molecule Ki67 expression on tumor infiltrating T cells of PLPP1-HIGH and PLPP1-LOW groups;

FIG. 4 shows the construction of PLPP1-CAR lentiviral vector and CAR-T production, where:

a is a schematic structure diagram of MSLN-CAR and MSLN-PLPP 1-CAR;

b is the CAR-T infection efficiency of flow detection 3 days after the lentivirus infection;

c, detecting the PLPP1 gene expression level in the CAR-T cells 5 days after infection by using a fluorescent quantitative PCR method;

d is the expression of the PLPP1 protein of the CAR-T cell detected by western blot after 5 days of infection;

figure 5 is a graph of the effect of PLPP1 modification on expression of related molecules on CAR-T cells, wherein:

a is a peak shape chart of expression of related molecules CD69, 41BB and PD1 in flow detection after CAR-T infected for 3 days is activated for 48 hours by CD3/CD28 monoclonal antibody;

b is the expression statistical result of CD69, 41BB and PD1 in MSLN and MSLN-PLPP1 group cells;

FIG. 6 is a graph of the effect of PLPP1 expression on the ability to secrete CAR-T cytokines; wherein:

a is a peak shape diagram of functional molecule expression of flow-type internal factor detection T cells after PMA ionomycin and BFA are treated for 6 hours;

b is the flow detection CAR-T cell functional molecule expression statistical result;

figure 7 is a graph of the effect of PLPP1 expression on CAR-T cell proliferative capacity, wherein:

a is proliferation condition of proliferation dye marked CAR-T cells after 72h of activation;

b is CAR-T cell activation for 48h, and Ki67 expression is detected by flow;

c is 1X 10⁵ Cell count results 72 hours after CAR-T cell activation;

FIG. 8 is a graph showing the effect of PLPP1 modification on killing ability of MSLN-CAR-T tumor cells; wherein:

a is the expression condition of a lung cancer cell line H322 target antigen mesothelin;

b, ANNEXINV marks apoptotic cells, and the killing capacity of different effective target ratios CAR-T on tumor cells is detected in a flow mode;

c is the expression of CAR-T cell CD107a after 6h of co-incubation with tumor cells;

d is the activity condition of the tumor cells after the luciferase activity detection and CAR-T are incubated for 24 h;

e is the proliferation condition of the CAR-T cells marked by the proliferation dye after being incubated with the target cells for 72 hours;

FIG. 9 shows the tumor growth inhibitory capacity of PLPP1 modification on MSLN-CAR-T in a mouse tumor model; wherein:

a is a schematic diagram of mouse model construction and treatment strategies;

b is the mouse tumor growth curve after CAR-T cell reinfusion;

c is tumor size after mice were sacrificed on day 21;

d is pathological staining of main organs of the mouse;

FIG. 10 is a graph of PLPP1 on CAR-T function and proliferative capacity in the tumor microenvironment; wherein:

a is a pattern of expression peaks of CAR-T cell functional molecules IL-2, Perforin and IFN-G, TNF-A for flow detection of tumor infiltration;

b is the expression statistical result of CAR-T cell functional molecules IL-2, Perforin and IFN-G, TNF-A for flow detection of tumor infiltration;

c is a flow detection tumor infiltration CAR-T cell proliferation correlator Ki67 expression peak shape chart and a statistical result.

Detailed Description

The present application is further illustrated by the following examples. Before describing the specific embodiments, a brief description will be given of some experimental background cases in the following embodiments.

Biological material:

peripheral blood and tumor tissues of tumor patients are from the first subsidiary hospital of Zhengzhou university, related research schemes are approved by the ethical committee of the first subsidiary hospital of Zhengzhou university, and informed consent signed by the patients is obtained;

peripheral blood of healthy people, from the blood center of the red cross in Henan province;

lung cancer cell line H322 and human embryonic kidney cell 293T, purchased from shanghai cell bank of chinese academy of sciences;

competent Escherichia coli DH5 alpha, competent Escherichia coli Tstbl3, purchased from Biotechnology Ltd of Kyogqing Okagaku;

the main reagents are as follows:

DMEM high-sugar medium, RPIM1640 medium, PBS buffer, protease inhibitor, phosphatase inhibitor DMSO (dimethyl sulfoxide), PMSF (phenylmethylsulfonyl fluoride), etc., all of which are products of Sigma company of America;

Opti-MEM medium, fetal bovine serum, etc., which are products of Gibco corporation, USA;

x-vivo15 medium, a product of LONZA biotechnology, switzerland;

human peripheral blood lymphocyte separation medium, Tianjin, a product of third-class Biotechnology Ltd;

human CD8 microbeads, Human CD3 microbeads, MACS buffer, magnetic separation LS column, Germany product of Meitian and whirlwind company;

RIPA lysate, product of shanghai bi yunnan biotechnology limited;

RNAiso Plus, a product of Thermo corporation, usa;

a reverse transcription kit, a Gt-551 culture medium, EcoRI restriction enzyme, BamHI restriction enzyme, a product of Nippon Baori biotechnology Limited company;

immunohistochemical kit, product of gold bridge biotechnology limited of sequoia in Beijing;

protein electrophoresis gel kit, Beijing Dake is a product of biotechnology limited company;

a one-step directional cloning kit, a product of Shanghai offshore science and technology Limited;

DNA gel recovery kit, Axygen, USA products;

ELISA kit, Hangzhou union biotechnology products of GmbH;

100x mixed solution of penicillin and streptomycin, trypsin powder, 0.25% trypsin digestion solution, 0.05% trypsin digestion solution, 20 xTBST, 50xTAE buffer solution and the like which are all products of Beijing Solebao scientific and technological Limited company;

linear PEI transfection reagent, product of Polysciences, usa;

recombinant human IL-2, CD28 monoclonal antibody, CD3 monoclonal antibody, annexin V binding buffer solution, 10x membrane breaking agent, PE-anti-human CD69, APC-CY7 anti-human CD8, APC anti-human Ki67, APC-A700 anti-human TNF-A, Percp anti-human Granzyme B, FITC anti-human IFN-G, APC anti-human IL-2, APC-A700 anti-human Perforin and the like which are all products of the American biolegend company;

SYBER Green fluorescent quantitative premix, product of BCS, Australia;

NC membranes, products of GE corporation, usa;

PE anti-PLPP1, Wuhan Boohot Biotech Ltd

The rest 10% FBS-DMEM high-sugar complete culture medium, 10% FBS-RPIM1640 complete culture medium, T cell culture medium (GT-T511 culture medium and X-vivo15 culture medium are mixed at a ratio of 1:2, 1% streptomycin mixed solution is added, 500IU recombinant human IL-2 is added into each 1ml before use), cell freezing solution, protein lysate, electrophoresis solution, membrane transferring solution, 1 xTBST buffer solution, Western blocking solution, 5% BSA solution and the like are prepared conventionally according to the prior art;

the main apparatus comprises:

PCR instrument, gel imaging system, product of Bio-Rad company, USA;

dxFLEX flow analysis system, Moflo-XDP high-speed flow sorting system, Beckmann Coulter, USA;

ivis in vivo imaging system, PerkinElmer, usa;

miltenyi magnetic sorting field, product of Meitian and whirly, Germany.

Example 1

In view of the important role of phospholipidase 1 (PLPP 1) on the influence of cellular metabolism, in this example, based on relevant experiments, the inventors first conducted preliminary studies on the role of PLPP1 in the tumor microenvironment. The following is a brief description of relevant experiments and results of specific experiments.

Before describing the specific experimental procedures, the following brief description of the relevant general experimental procedures is provided.

(1) Cell culture

Both H322 and 293T cell lines are cultured by a DMEM high-sugar medium containing 10% FBS +1% penicillin-streptomycin mixed solution, and when the cell fusion rate reaches about 90% during culture, cell passage is carried out, specifically:

discarding the culture medium in a super clean bench, and washing the cells for 2 times with sterile PBS to remove the residual culture medium;

for the H322 cell line, 1mL of 0.25% pancreatin was added to the flask, and for 293T cells, 1mL of 0.05% pancreatin solution was added, followed by digestion of the cells in an incubator at 37 ℃ (293T digestion for 2min, H322 digestion for 5 min);

after digestion, the cells were removed, 10ml of complete medium was added to neutralize the pancreatin, and the cells were blown up with a pipette to form a single cell suspension;

the cells were then transferred to a 50ml centrifuge tube and centrifuged at 1000rpm for 3min to remove cell debris;

resuspend the cells to about 4X 10 by adding the appropriate media⁵At each ml, 10ml of cells were transferred to a T75 cell culture flask for further culture.

(2) Preparation of single cell suspension of tumor tissue

Cutting the collected tumor tissue (preserved in tissue preservation solution on ice in advance) into small pieces, then resuspending the tumor tissue in 2.7ml of serum-free 1640 medium, and adding 300. mu.l of 10 Xtissue digestion three-enzyme mixture;

subsequently, after dissociation by a tissue dissociation instrument, placing on a micro-shaker, digesting for 30min at 37 ℃, and repeating the operation to ensure complete dissociation and digestion;

after the last digestion, 5ml of RPMI1640 complete culture medium is added to neutralize the three enzymes, the mixture is filtered twice by a 70-micron filter screen to remove tissue fragments, and finally, after 500g of the mixture is centrifuged for 5min, the cells are washed twice by PBS, and finally, the suspension is resuspended as required to obtain the tumor tissue single cell suspension.

(3) Peripheral blood mononuclear cell isolation

Centrifuging 10ml of peripheral blood at 500g and 22 ℃ for 5min, sucking plasma (or storing at-80 ℃ for later use), and diluting with PBS (1 time of volume) for later use;

taking a 50ml centrifuge tube, adding 20ml of lymphocyte separation liquid, uniformly blowing the diluted peripheral blood and gently adding the peripheral blood to the upper layer of the lymphocyte separation liquid;

centrifuging at 22 deg.C and 1100g for 25min, carefully sucking lymphocyte layer, adding PBS (with the same volume as the sucked lymphocyte layer), and centrifuging at 1800rpm for 5min to clean cells; and discarding the supernatant again, adding 5ml of PBS to wash the cells once, centrifuging and discarding the PBS, and obtaining the precipitate, namely the peripheral blood mononuclear cells.

(4) Activated CD8⁺ T cell sorting

Peripheral blood mononuclear cells (or single cell suspension of tumor tissue) were centrifuged at 500g for 5min, and then the cells were resuspended in 3ml of MACs (magnetic activated cell lysis) buffer and centrifuged at 500g for 5 min; cells were again re-selected with 3ml of MACs buffer and counted;

each 1 × 10⁷Adding 10 μ l of human CD8 magnetic beads and 40 μ l of MACs buffer solution into the cells, vortexing and mixing, incubating at 4 ℃ in the dark for 15min, and mixing uniformly every 3 min;

after the last time of mixing, placing the MS magnetic separation column in a corresponding magnetic field, and adding 1ml of MACs buffer solution to rinse the column; after the incubation operation is finished, adding all the cells into a magnetic separation column, after the cells completely pass through the column, adding 1ml of MACs buffer solution to wash so as to remove the unbound cells, and repeating twice;

after the liquid completely passes through the column, adding 3ml of MACs buffer solution, taking the column out of the magnetic field, and then quickly pumping the cells into a sterile centrifuge tube by using a piston; after counting the cells, centrifuging for 5min at 500g, discarding the liquid, and washing the cells for 2 times with a flow buffer;

resuspend the cells in 100. mu.l flow buffer and add 10. mu.l of PE-anti-human CD69 flow antibody, incubate at 4 ℃ for 30min in the dark;

then washing the cells with 1ml of flow buffer, centrifuging at 4 ℃ and 500g for 5min (repeating the operation twice); and finally, sorting positive cells by using a Moflo-XDP flow cytometric sorter and recording the cell number.

(5) Real-time fluorescent quantitative PCR

In the case of fluorescence quantitative PCR, a 20. mu.l reaction system was designed as follows:

cDNA template, 0.2. mu.l;

upstream primer, 0.5. mu.l (10. mu.M);

downstream primer, 0.5. mu.l (10. mu.M);

2 x PCR mix（2x SYBER green PCR mix），10μl；

ddH2O，8.8μl；

PCR procedure: 95 deg.C for 3 min; at 95 deg.C, 10s, 60 deg.C, 30s, 40 cycles; the dissolution curve is 65-95 ℃ and 0.5 ℃/5 s; b-actin is used as an internal reference.

After the operation is finished, the operation is carried out by 2^-∆∆CTValues represent the relative of the target genes in different samplesRelative gene expression levels in control groups.

(6) Fully quantitative detection of lipidomics

Taking the flow-sorted T cells, and accurately counting; then take 1X 10⁶ Cells were centrifuged to discard the supernatant and cells were resuspended in 100 μ l of pre-cooled PBS;

500 mul of precooled anti-quencher is quickly added into the cell suspension, the mixture is slightly shaken and centrifuged for 5min at the temperature of 4 ℃ and at the speed of 500g, the supernatant is discarded, and the precipitate (stored at the temperature of-80 ℃) is subjected to HPLC-MS lipidomics full-quantitative detection by Shanghai Baiqu biology company.

Research has shown that infiltrating T cells in the tumor microenvironment have tumor recognition capability, but at the same time, a large number of immunosuppressive molecules and immunosuppressive metabolites of immunosuppressive cells exist in the tumor microenvironment, and both of these substances cause T cell dysfunction (T cell depletion). On the other hand, the lipid metabolism state of T cells plays a crucial role in the normal functioning of cells. Therefore, the research on the function exhaustion mechanism of the tumor-infiltrating T cells and the research on the abnormal change of the T cells in the tumor microenvironment from the perspective of T cell lipid metabolism lay a certain technical foundation for exploring a cell gene modification strategy of targeted T cell lipid metabolism.

Based on the above considerations, the inventors have conducted preliminary studies on the lipid metabolism of T cells under tumor infiltration conditions, and the details are briefly described below.

First, tumor tissue and CD69 in peripheral blood were sorted⁺CD8⁺And (4) carrying out full-lipidosome HPLC-MS detection on the T cells, so as to comparatively analyze and investigate the change of lipid metabolism of the T cells under the condition of tumor infiltration (the related operation refers to the general experimental operation, and the description is omitted). The results of the specific experiments are summarized below.

The detection result of the related metabolic data shows that:

CD8 in tumor microenvironment⁺Abnormal accumulation of Phosphatidic Acid (PA), Phosphatidylinositol (PI), Phosphatidylethanolamine (PE), Phosphatidylserine (PS), and hexose ceramide (HEXCER) in T cells, and Diacylglycerol (DG), Sphingosine (SPH), and Ceramide (CER) contentsReduction (FIG. 1A is summarized based on the results of the determination of the relevant components by Baiqu Bio Inc.);

further analysis of the lipid metabolism pathway (fig. 1B) revealed that: the PLPPs as a multifunctional phosphophospholipase can catalyze the dephosphorylation of molecules such as PA, S1P, Cer1P and the like, so that the changes of the PLPP1, the PLPP2 and the PLPP3 can be the cause of the related metabolic abnormality;

based on the above analysis, the CD8 of the lung cancer patient in the GEO (Gene Expression Omnibus) database⁺Analysis of the expression levels of PLPP1, PLPP2 and PLPP3 in T cells (as shown in fig. 1C) revealed that only PLPP1 was highly expressed in T cells, and thus it was preliminarily presumed that PLPP1 was the main cause of the associated lipid metabolism disorder;

to further verify the significance of PLPP1 expression in T cells, the results showed that PLPP1 was significantly positively correlated with T cell proliferation (fig. 2A) and functional molecule (fig. 2B) expression by analyzing the correlation between T cell proliferation-related genes and T cell function-related molecules and PLPP1 expression based on RNAseq data collected from 36 tumor-infiltrating T cells in the GEO database; this also initially suggests that: the PLPP1 is expressed and deleted in a tumor microenvironment to cause abnormal T cell metabolism, so that the proliferation capacity and the tumor killing function of the T cells are influenced.

Based on the above-mentioned results, the inventors further investigated CD69 in the peripheral blood and tumor infiltration conditions of tumor patients by the fluorescent quantitative PCR technique⁺CD8⁺PLPP1 expression was detected in T cells (fig. 1D), and the results showed: CD8 in tumor infiltration⁺The significant reduction of PLPP1 expression in T cells was confirmed, and this result preliminarily confirmed that the lack of expression of PLPP1 resulted in CD8 in the case of tumor infiltration⁺T cell lipid metabolism is abnormal, and therefore certain reference and guidance can be provided for relevant treatment strategies based on the result.

Based on the above results, to further determine whether the high expression of PLPP1 has further enhanced T cell proliferation and tumor killing ability in tumor infiltration, the inventors infiltrated CD8 in tumors according to PLPP1 expression level⁺Somatic cells were classified as PLPP1-HIGH and PLPP1-LOW (FIG. 3A). PLPP1-HIGH and PLPP1-LOW cells were analyzed by flow cytometry for the expression of the T cell functional molecules IL-2, GrzymeB, Perforin (FIG. 3. B) and the proliferation marker molecule Ki67 in the cells (FIG. 3C). The results showed CD8 of the PLPP1-HIGH group⁺The proliferation and the functional molecule expression of the T cells are obviously higher than that of CD8 of PLPP1-LOW group⁺ T cells. Based on the results, it can be preliminarily determined that the high expression of PLPP1 has further enhancement effect on T cell proliferation ability and tumor killing ability in tumor infiltration.

Example 2

Based on the preliminary results of example 1, in combination with the CAR-T technique, the inventors further constructed relevant recombinant plasmids and performed relevant experiments using the lentiviral transfection technique. The specific experimental procedures are briefly described as follows.

Firstly, obtaining the cloning sequence of human PLPP1 open reading frame

Firstly, extracting RNA of healthy human peripheral blood mononuclear cells, and carrying out reverse transcription to prepare a cDNA template;

subsequently, based on the known sequence of the PLPP1 open reading frame, primer sequences for PCR cloning were designed as follows:

PLPP1-F: 5’-atgtttgacaagacgcggct-3’，

PLPP1-R: 5’-aggctggtgattgctcggat-3’；

finally, the prepared cDNA is used as a template for PCR amplification, the designed primer is used for PCR amplification, and a 50-microliter amplification system is designed as follows during PCR amplification:

cDNA template, 2. mu.l;

PLPP1-F primer, 2. mu.l (10 uM);

PLPP1-R primer, 2. mu.l (10 uM);

primer star mix，25μl；

deionized water, 19 μ l;

in the PCR instrument, the reaction procedure was as follows:

95 deg.C for 5 min; 95 ℃, 15s, 58 ℃, 15s, 72 ℃, 1min, 35 cycles; 72 deg.C, 5 min.

After the PCR is finished, carrying out 1% agarose gel electrophoresis detection on the PCR product, and recovering a band product of about 850bp to obtain the PLPP1 open reading frame sequence.

The sequence (854 bp) of the PLPP1 open reading frame is as follows:

Atgtttgacaagacgcggctgccgtacgtggccctcgatgtgctctgcgtgttgctggcttccatgcctatggctgttctaaaattgggccaaatatatccatttcagagaggctttttctgtaaagacaacagcatcaactatccgtaccatgacagtaccgtcacatccactgtcctcatcctagtgggggttggcttgcccatttcctctattattcttggagaaaccctgtctgtttactgtaaccttttgcactcaaattcctttatcaggaataactacatagccactatttacaaagccattggaacctttttatttggtgcagctgctagtcagtccctgactgacattgccaagtattcaataggcagactgcggcctcacttcttggatgtttgtgatccagattggtcaaaaatcaactgcagcgatggttacattgaatactacatatgtcgagggaatgcagaaagagttaaggaaggcaggttgtccttctattcaggccactcttcgttttccatgtactgcatgctgtttgtggcactttatcttcaagccaggatgaagggagactgggcaagactcttacgccccacactgcaatttggtcttgttgccgtatccatttatgtgggcctttctcgagtttctgattataaacaccactggagcgatgtgttgactggactcattcagggagctctggttgcaatattagttgctgtatatgtatcggatttcttcaaagaaagaacttcttttaaagaaagaaaagaggaggactctcatacaactctgcatgaaacaccaacaactgggaatcactatccgagcaatcaccagcct。

related operations conventional biomedical operations are available or can be referred to as the following operational description.

(1) RNA extraction

Taking not less than 1 × 10⁵Centrifuging the cells at 4 deg.C and 500g for 5min, discarding supernatant, adding 1ml trizol and 500 μ l chloroform, reversing the upper and lower parts, mixing for 30s, and standing at room temperature for 10 min;

after standing, centrifuging at 4 ℃ and 12000rpm for 15min, carefully absorbing the upper organic phase after centrifugation, adding the upper organic phase into an isopropanol tube containing 500 microliter, turning upside down and uniformly mixing for 30s, and standing at room temperature for 10 min;

centrifuging at 4 deg.C and 12000rpm for 10min, and discarding supernatant;

adding 1ml of precooled 75% ethanol to clean RNA, centrifuging at 4 ℃ and 12000rpm for 2min, and repeating the step once;

sucking the liquid as much as possible, airing at room temperature for about 20min, adding 15 mu l of DEPC water to dissolve RNA, detecting the RNA concentration by using nanodrop2000 to ensure that the use requirement is met, and then directly carrying out reverse transcription or storing at-80 ℃ for later use.

(2) Reverse transcription

Adding 1000ng of RNA into an EP tube, adding DEPC water to 7 mu l, adding 1 mu l of gDNA Eraser and 2 mu l of gDNA Eraser buffer solution, mixing uniformly by vortex, centrifuging instantaneously, and incubating at room temperature for 5min to digest genomic DNA;

mu.l RT Primer MIX, 1. mu.l Prime Script RT Enzyme MIX I and 4. mu.l DEPC water were added, mixed well and placed in a PCR apparatus according to the following: the procedure of '37 ℃, 15min, 85 ℃, 5s and 4 ℃ storage' is carried out, and after the reaction is finished, the reverse transcription product is directly applied or stored at-20 ℃.

(3) Electrophoresis

Adding 50ml of TAE buffer solution and 0.5g of agarose into a 300ml conical flask, heating until the agarose is completely dissolved, adding 2 mu l of GOD View II nucleic acid dye, cooling to about 60 ℃, pouring the gel into a mold, and cooling and solidifying at room temperature for about 30 min;

after the PCR is finished, 5 mul of 10 XDNA loading buffer solution is added into each 50 mul of product, mixed evenly and added into a lane, and electrophoresis is carried out for 50min at a constant voltage of 120 v;

after the electrophoresis, the gel imager was exposed to light, and a band of about 850bp was cut out with an operating blade on a blue light gel imager for recovery.

(4) DNA gel recovery

Weighing the cut target gel strip, adding a gel dissolving buffer solution A with the volume 3 times that of the gel, dissolving the gel in a water bath kettle at 75 ℃ for 6-8min, adding a reagent B with the volume 1.5 times that of the gel after the gel is completely dissolved, and adding the solution into a gel recovery column after uniformly mixing;

centrifuging at 12000rpm for 1min, discarding the filtrate, and washing the column with 500. mu.l WA + 700. mu.l WB;

centrifuging at 12000rpm for 2min to remove residual liquid; adding 30 μ l of deionized water into the recovery column, and standing at room temperature for 2 min;

centrifuging at 12000rpm for 1min, filtering to obtain DNA solution, and detecting the concentration of the recovered DNA with nanodrop2000 to meet the use requirement.

(II) construction of recombinant vector

The pCDH-EF1A-MCS-T2A-copGFP (BioFeng product) plasmid belongs to a lentiviral vector, which uses human EF1A (human elongation factor 1 a) as a promoter, has moderate expression level and low cytotoxicity in eukaryotic cells, wherein the T2A sequence encodes T2A peptide segment, can mediate self-shearing of translated peptide chain, and avoids fusion expression of expressed target protein and tag protein. In the present application, a recombinant vector is constructed based on this plasmid. The specific process is briefly described as follows.

(1) Cloning vector for constructing PLPP1 open reading frame

Firstly, based on the requirement of subsequent two enzyme digestions of Ecori and BamHI, the primer sequences for the sequence of the PCR clone PLPP1 are redesigned as follows (namely, 20bp of homologous sequences matched with the ends of the linearized plasmid pCDH-EF1A-MCS-T2A-copGFP are added at the upstream and the downstream respectively):

F: 5’-actctagagctagcgaattcatgtttgacaagacgcggct-3’，

R: 5’-atccgagcaat caccagcctggatccgcggccgctgaggg-3’；

subsequently, using the extracted PLPP1 open reading frame sequence as a template, the PLPP1 sequence was amplified again using the primers designed above (introducing homology arms), and the amplification system was performed according to the procedure described above, and the PCR procedure was as follows:

95 deg.C for 5 min; 95 ℃, 15s, 62 ℃, 15s, 72 ℃, 1min, 35 cycles; at 68 deg.C for 5 min;

then, after the PCR is finished, carrying out agarose gel electrophoresis, purifying a band of about 850bp, and detecting the DNA concentration by using nanodrop2000 to ensure that the use requirement is met;

then, the amplification product extracted above was ligated with the EcoRI, BamHI double digested linearized pCDH-EF1A-MCS-T2A-copGFP plasmid vector, and 20. mu.l ligation system was designed as follows:

PLPP1 (PCR product), 50 ng;

linearized plasmid vector, 50 ng;

5 × reaction buffer, 4 μ l;

NovoRec，2μl；

adding water to make up to 20 μ l;

mixing, and incubating at 50 deg.C for 15 min;

and finally, transforming the ligation product into DH5 alpha competent cells, culturing overnight, selecting a single colony for sequencing verification, selecting a strain with a correct sequence, carrying out amplification culture, and extracting a plasmid, or freezing and storing for later use.

(2) Construction of PLPP1-MSLN CAR Lentiviral plasmid

Firstly, based on the requirement of introducing a linearized vector homology arm at the upstream and introducing a PLPP1 homology sequence at the downstream, and based on the requirement of amplifying the MSLN-CAR-P2A sequence from the MSLN-CAR-P2A-GFP plasmid (the pCDH-EF1A-MCS-T2A-copGFP plasmid is taken as the basis in the application, the conventional construction can be carried out, and of course, other plasmids can be adopted for construction), the primer sequence for PCR amplification is designed as follows:

F: 5’-actctagagctagcgaattcatggccttaccagtg accgc-3’，

R: 5’-agccgcgtcttgtcaaacataggtccagggttctcctcca-3’；

meanwhile, based on the upstream introduction of 20bp MSLN-CAR-P2A homology arm, the downstream introduction of linearized vector homology arm, and the amplification of PLPP1 sequence by using the recombinant plasmid containing PLPP1 sequence in step (1) as a template, the primer sequences for PCR amplification are designed as follows:

F: 5’-tggaggagaaccctggacctatgtttgacaagacgcggct-3’，

R: 5’-ccctcagcggccgcggatccaggctggtgattgctc ggat-3’；

then, respectively carrying out PCR amplification by using the primers, carrying out electrophoresis on PCR amplification products, and recovering fragments MSLN-CAR-P2A (about 1500 bp) and PLPP1 (about 850 bp);

the MSLN-CAR-P2A sequence (1539 bp) is as follows:

atggccttaccagtgaccgccttgctcctgccgctggccttgctgctccacgccgccaggccgcaggtgcagctggtgcagtctggggctgaggtgaagcggcctggggcctcagtgcaggtttcctgcagggcatctggatactccatcaacacctactatatgcaatgggtgcgacaggcccctggagcagggcttgagtggatgggagtaatcaaccctagtggtgtcacaagctacgcacagaagttccagggcagagtcaccttgaccaatgacacgtccacgaacacagtctacatgcagctgaacagcctgacatctgcagacacggccgtgtattactgtgcgagatgggcattgtggggggatttcgggatggacgtctggggcaagggaaccctggtcaccgtctcctcaggtggtggtggttctggtggtggtggttctggtggtggtggttccggtggtggtggttccgacatccagatgacccagtctccttccaccctgtctgcatctattggagacagagtcaccatcacctgccgggccagtgagggtatttatcactggttggcctggtatcagcagaagccagggaaagcccctaaactcctgatctataaggcctctagtttagccagtggggccccatcaaggttcagcggcagtggatctgggacagatttcactctcaccatcagcagcctgcagcctgatgattttgcaacttattactgccaacaatatagtaattatccgctcactttcggcggagggaccaagctggagatcaaaaccacaacacccgccccccggccccccacacccgcccccacaatcgccagccagcccctgagcctgaggcccgaggcctgccggcccgccgccgggggggccgtgcacacaagggggctggatttcgcctgcgatatctacatctgggcccccctggccggcacctgcggcgtgctgctgctgagcctcgtgatcacactgtactgcaagagggggcggaagaagctgctgtacatcttcaagcagcccttcatgaggcccgtgcagaccacccaggaggaggacggctgttcctgtaggtttcctgaggaggaggaaggaggatgtgagttgcctagagtgaagttcagcaggagcgcagacgcccccgcgtaccagcagggccagaaccagctctataacgagctcaatctaggacgaagagaggagtacgatgttttggacaagagacgtggccgggaccctgagatggggggaaagccgagaaggaagaaccctcaggaaggcctgtacaatgaactgcagaaagataagatggcggaggcctacagtgagattgggatgaaaggcgagcgccggaggggcaaggggcacgatggcctttaccagggtctcagtacagccaccaaggacacctacgacgcccttcacatgcaggccctgccccctcgcggaagcggagctactaacttcagcctgctgaagcaggctggagacgtggaggagaaccctggacct。

then, the cloned linearized pCDH-EF1A-MCS-T2A-copGFP plasmid vector is connected by using a NovoRec one-step PCR cloning kit, wherein the plasmid vector is obtained by double enzyme digestion of MSLN (MSLN-CAR-P2A), PLPP1, EcoRI and BamHI, and a 20-microliter connection system is as follows:

linearized vector, 50 ng;

MSLN fragment, 100 ng;

PLPP1，100ng；

5 × reaction buffer, 4 μ l;

NovoRec，2μl；

adding water to make up to 20 μ l;

incubate at 50 ℃ for 15 min.

And finally, transforming the ligation product into DH5 alpha competent cells, plating and culturing overnight, then selecting a positive single colony, transferring the positive single colony to an LB culture medium containing 200 mu g/ml ampicillin, shaking the colony overnight, taking 1ml of a bacterial liquid sample for plasmid sequencing to ensure correct recombination (namely the PLPP1-MSLN CAR lentiviral plasmid), and extracting the plasmid from the strain with correct sequencing or freezing and storing the strain for later use.

In the above process, the conventional operations such as plasmid transformation and plasmid extraction may be referred to, or specifically referred to as follows.

When the plasmid is transformed: dissolving competent cells 100 μ l on ice, adding the ligation system (or plasmid 10 ng) into the competent cells, flicking for 2-3 times, mixing, and incubating on ice for 30 min; heat shock at 42 deg.C for 45s, and standing on ice for 2 min; adding 400 μ l LB culture medium without antibiotics, shaking at 37 deg.C and 200rpm for 30 min; spreading 100 μ l of the bacterial liquid on LB plate containing 200 μ g/ml ampicillin, and culturing overnight at 37 deg.C; further picking positive single colony for amplification culture.

When extracting the plasmid, extracting the plasmid by adopting a small-extraction medium-amount kit of Tiangen plasmid, and referring to the specification or the following specific references:

taking 15ml of bacteria liquid to be extracted, centrifuging at 3000rpm for 10min, discarding the culture medium, re-suspending the bacteria liquid by using saline water, transferring the bacteria liquid into a 2ml centrifuge tube, centrifuging at 12000rmp for 3min, and discarding the supernatant;

adding 500. mu.l of reagent P1, vortexing until the cells are fully suspended, mixing, and then adding 500. mu.l of cell lysate P2. Turning upside down gently and mixing for 8 times, adding reagent P4500 μ l, and mixing immediately;

standing at room temperature for 10min, and centrifuging at 12000rmp for 10 min; sucking supernatant fluid, adding the supernatant fluid into a filter column for removing endotoxin, and centrifuging; adding 0.3 volume times of isopropanol into the filtrate, mixing, adding the liquid into plasmid binding column (adding 500 μ l of balance buffer into the plasmid binding column in advance, centrifuging at 12000rpm for 1min to activate the column), and centrifuging at 12000rpm for 1 min;

washing the column 1 times with 500. mu.l of protein removing solution PD, washing the column 2 times with PW, and centrifuging at 12000rpm for 2min to remove the remaining liquid;

placing the plasmid binding column in a new 1.5ml centrifuge tube, adding 200 μ l sterile deionized water to the center of the DNA binding column, and standing at room temperature for 2 min;

the plasmid was eluted by centrifugation at 12000rpm for 1min and the plasmid concentration was checked.

(III) preparation of CAR-T cells

First, lentiviral packaging was performed, where lentiviruses:

well-grown 293T cells were plated in 10cm cell culture dishes at 6X 10 cells per dish⁶Culturing the wall to stay overnight;

in a 1.5ml centrifuge tube, add: 250 μ l of Opti-MEM medium, 5ug of master plasmid (i.e., the last plasmid prepared in step (II)), 3ug of packaging plasmid PsPAX2, 1.5ug of packaging plasmid pMD2.G, vortex and mix; then adding 250 ul of Opti-MEM and 20 ul of linear PEI 4000 transfection reagent (mixed uniformly in advance), blowing gently and mixing uniformly, and standing for 20min at room temperature;

dripping the transfection system into the 293T cell, and continuously culturing for 6 h;

replacing a fresh DMEM medium containing 10% FBS, and continuing to culture for 48 h;

centrifuging at 16 deg.C and 3000rpm for 10min to remove cell debris, and collecting supernatant as packaged lentivirus.

Subsequently, T cell infection was performed using the above lentiviruses to prepare CAR-T cells, in particular:

taking CD3 from peripheral blood of healthy people⁺T cells, resuspended to 3X 10 with T cell Medium⁶/ml；

Adding 5ug/ml of CD3 monoclonal antibody and 2ug/ml of CD28 monoclonal antibody, mixing, and spreading to 12-well cell culture plate with 2ml per well;

collecting T cells after 48h, centrifuging at 1500rpm for 5min, and discarding supernatant; resuspend cells with fresh 1640 medium and count;

centrifuging 500g of the taken cells for 5min, and resuspending and adjusting to 1X 10⁶Laying in 12-hole plate with 1ml per hole;

2ml of viral supernatant (supernatant prepared after packaging the aforementioned virus) and 3. mu.l of 10mg/ml polybrene infection-assisting agent were added; placing the 12-hole plate in a horizontal rotor centrifuge, and centrifuging for 2h at 32 ℃ and 1000 g;

after centrifugation is finished, the culture medium is carefully discarded, 1ml of fresh T cell culture medium is added, and the step is repeated once;

the cells were placed in an incubator for further culture, and after 72h the GFP positive rate was detected by flow cytometry to determine the transfection efficiency of the CAR.

Experimental example 1

Using the prepared CAR-T cells, the inventors further performed an in vitro killing experiment, and the specific experimental conditions are briefly described below.

Respectively digesting and counting H322 tumor cells (human non-small cell lung cancer cells) or H322 cells (which are conventionally constructed and mainly used for visual observation) of over-expressed luciferase, respectively taking a proper amount of cells, and respectively adjusting the cell concentration to 3 x 10 by using an RPMI1640 culture medium⁵/ml；

The prepared CAR-T cells were counted and adjusted to 3X 10 with RPMI1640⁵、1.5×10⁶、3×10⁶Per ml; add 100. mu.l per well and mix with H322 cells.

Putting the cells into an incubator for co-incubation for 6 h; after incubation, taking out a 96-well plate, placing the 96-well plate on ice, collecting suspended cells into a 1.5ml centrifuge tube, washing adherent cells by using precooled PBS (phosphate buffer solution), and collecting supernatant into a corresponding centrifuge tube;

adding 50 μ l of 0.25% trypsin, digesting at 37 ℃ for 5min, collecting digested cells into corresponding centrifuge tubes after digestion is finished, adding 100 μ l of 1640 complete culture medium into each hole to clean residual cells, and collecting into corresponding centrifuge tubes;

centrifuging at 4 deg.C and 700g for 5min, and removing supernatant; add 100. mu.l annexin V binding buffer per tube to resuspend the cells;

centrifuging at 4 deg.C and 700g for 5min, discarding supernatant, adding 100 μ l annexin V binding buffer solution, 2 μ l APC-annexin V and 2 μ l 7AAD into each tube, and incubating at 4 deg.C in dark place for 30 min; after the incubation was completed, flow detection was performed immediately.

When the CAR-T cells are subjected to degranulation detection, the effective target ratio of collecting and incubating for 6h is 5: 1, washing the cells 2 times with flow buffer, after staining resuspending the cells with 100 μ l flow buffer and adding 2 μ l PE anti-human CD107 a; after incubation at 4 ℃ in the dark for 30min, the cells were washed 2 times with flow buffer and then tested on the machine.

In the luciferase analysis, the ratio of CAR-T to H322-effective target expressing luciferase is set to be 1: 1, incubating for 24h, and detecting the activity of the tumor cells by using an Ivis imaging system.

Experimental example 2

In vitro killing experiments, the inventors performed in vivo animal experiments using severely immunodeficient NOD-SCI type mice (which can be directly inoculated with a human derived tumor cell line and made tumors) using the CAR-T cells described above, and the specific experimental procedures are briefly described below.

NOD-SCID mice 5-6 weeks old (about 25 g) were inoculated subcutaneously with 1X 10 on day 0⁶Human lung cancer cell line H322, 7 days later, 5X 10 of caudal vein infusion⁶ CAR-T cells were treated, after which tumor size was measured every 3 days.

In the above experimental process, the related experimental operation is referred to the prior art or the following operation can be specifically referred to.

(1) Western blot analysis

When the immunoblotting analysis is carried out, the total cell protein is extracted, and then SDS-PAGE gel electrophoresis, wet membrane transfer and immunological detection are carried out, and the relevant operations are referred to as follows.

And (3) extracting total cell protein: 2X 10 CAR-T cells cultured for 5 days were taken⁶Centrifuging at 500g for 5min, and discarding the supernatant; washing the cells with pre-cooled PBS for 2 times, completely removing residual PBS after the second washing, and adding 50 mul of protein lysate into each sample; vortex and shake for 30s, quickly freezing the sample at-80 deg.C for 5min, dissolving on ice, and repeating for 3 times;

centrifuging at 12000g for 15min at 4 deg.C to remove impurities, and sucking 40 μ l of supernatant into a new 1.5ml centrifuge tube;

detecting the protein concentration by using a BCA method, and adjusting by using a protein lysate to ensure that the concentrations of all samples are consistent;

finally, 1/4 protein volume of protein loading buffer was added and mixed well and the protein was denatured at 95 ℃ for 15 min.

Gel electrophoresis: preparing a 10% polyacrylamide gel using a rapid gel preparation kit, with reference to the instructions thereof;

incubating and denaturing the protein sample in a boiled water bath for 3 min;

add 15. mu.l protein sample (or 5. mu.l protein standard molecular weight marker); setting an electrophoresis apparatus, and carrying out electrophoresis for 2.5h at a constant voltage of 80V.

Wet film transfer: shearing NC membrane, and wetting in membrane transfer buffer solution for 5 min; in the membrane transferring liquid, the following steps are carried out: placing the negative electrode, the sponge, the filter paper, the gel, the NC membrane, the filter paper, the sponge and the positive electrode in sequence, adjusting an electrophoresis apparatus, and flowing the membrane for 2 hours at a constant current of 200 mA.

And (3) immunological detection: after the membrane transfer is finished, washing the membrane for 3 times by TBST, 5min each time; blocking with 5% BSA at room temperature 60rpm for 2h with shaking;

the blocking solution was discarded and carefully added with primary antibody diluted with 5% BSA and incubated overnight at 4 ℃ at 50 rpm;

recovering the primary antibody after the room temperature is recovered for 1 h;

washing the membrane with TBST for 5min for 3 times; completely discarding TBST, carefully adding a secondary antibody diluted by 5% BSA, and incubating at room temperature for 1 h; discarding the secondary antibody, and washing the membrane for 3 times by using TBST;

and preparing ECL luminous liquid, uniformly dripping the ECL luminous liquid on an NC membrane, and placing the NC membrane in a gel imaging system to acquire images.

(2) Flow-through intrinsic factor staining

Washing the cells of the sample to be detected twice by using a flow buffer solution, discarding the supernatant as much as possible after the washing is finished, and adding 100 mu l of flow buffer solution into each sample to resuspend the cells;

adding 2 μ l of APC-CY7 anti-human CD8 into each sample, vortexing, mixing, and incubating at 4 deg.C in dark for 30 min;

after the incubation is finished, washing the cells for 2 times by using 1ml of flow buffer solution, adding 200 mu l of histiocyte fixing solution into each sample after the washing is finished, and incubating for 30min at 4 ℃ after vortex mixing;

after the incubation is finished, centrifuging for 5min at 4 ℃ under 1000g, discarding the supernatant, and washing the cells twice by 400 mu l of perm buffer solution; after washing, the supernatant was discarded as much as possible and the cells were resuspended in 200. mu.l perm buffer;

adding 2 mu l of PE anti-PLPP1, APC anti-human Ki67, APC-A700 anti-human TNF-A, PERCP anti-human Granzyme B and FITC anti-human IFN-gamma into each sample, vortexing, mixing uniformly, and incubating at 4 ℃ for 30 min;

after incubation was complete, cells were washed 2 times with 500 μ l flow buffer and flow-detected using Beckmann analysis.

(3) Paraffin embedding and pathological staining for tumor tissue

When embedding paraffin: taking a fixed tissue with the thickness of about 3mm, putting the tissue block into an embedding mold, soaking for 1 hour by using 70% ethanol, 80% ethanol and 90% ethanol respectively, and soaking for two times by using 95% ethanol and absolute ethanol respectively, wherein each time is one hour; soaking in ethanol and xylene for 40min, soaking in xylene for 25min, and soaking in new xylene for 15 min;

soaking paraffin wax at 65 deg.C for 1 hr, repeating for 3 times;

embedding the tissue with the cut surface facing downwards, and taking out the wax block from the mold for finishing after the wax block is completely cooled;

placing the wax block on a freezing table for precooling for 30min, and slicing by using a slicing machine to obtain a slice with the thickness of 4 mu m; the cut paraffin pieces were transferred to water with a writing brush to spread them, and the paraffin pieces were carefully adhered from one side with an adhesive slide after being flattened.

During pathological staining, putting the glass slide adhered with the paraffin section on a baking sheet machine for baking moisture, and then baking the sheet for 1 hour at 65 ℃;

taking out the slices, soaking in xylene for 10min, and repeating twice; soaking in 50% xylene-containing ethanol for 2min, soaking in 100% ethanol for 5min, and repeating the above steps; soaking in 80% ethanol for 5min, and washing with water for 5 min;

transferring the section into hematoxylin staining solution, soaking and staining for 5min, and washing with tap water for 5 min;

soaking and differentiating the mixture for 1s in ethanol differentiation solution of hydrochloric acid, soaking and rewarding the mixture for 10s in ammonia water rewarding solution, and washing the mixture for 30s with tap water; soaking and dyeing the eosin dye solution for 3min, and washing with tap water for 30 s;

differentiating with 80% ethanol (observing under light microscope), soaking with 95% ethanol for 1min, and repeating twice; 100% ethanol (soaking twice for 3 min; xylene soaking twice for 3 min; carefully dropping neutral resin sealing piece on the tissue part, carefully covering the tissue sealing piece with a cover glass from one side, observing under a light microscope and taking a picture.

The following is a brief introduction of the relevant experimental results for PLPP1-CAR lentiviral vector construction, CAR-T cells, and the effect of PLPP1 expression on CAR-T cells.

Construction of PLPP1-CAR lentiviral vector and CAR-T cell production

To explore the effect of PLPP1 expression on CAR-T function and proliferative capacity, in the present application, the PLPP1 coding sequence was inserted into the MSLN-CAR lentiviral plasmid and separated from the CAR by the self-cleaving peptide P2A (schematic as in fig. 4A).

After 293T transfection of MSLN-CAR and MSLN-PLPP1-CAR, PLPP1 enzyme activity was detected at the LPA dissociation rate, and the results demonstrated that MSLN-PLPP1-CAR has stronger PLPP1 enzyme activity.

Infection of the lentivirus-packaged MSLN-CAR and MSLN-PLPP1-CAR with CD3 of healthy human origin, respectively⁺After T cells, CAR-T cells cultured for 3 days are collected and the infection efficiency of the CAR-T cells is detected by flow, and the result shows that: the infection efficiency of both MSLN-CAR and MSLN-PLPP1-CAR was 35-40% (FIG. 4B), and there was no significant difference in infection efficiency.

Additional CAR-T cells cultured for 5 days were taken, RNA was extracted and PLPP1 expression levels were detected using real-time fluorescent quantitative qPCR, showing that PLPP1 expression was significantly increased in MSLN-PLPP1-CAR-T group compared to MSLN-CAR-T group (fig. 4C).

Another 5-day-infected CAR-T cell was taken to extract protein, and the expression of PLPP1 was analyzed using western blot, indicating that the expression of PLPP1 was significantly increased in MSLN-PLPP1-CAR-T (FIG. 4D).

Effect of (di) PLPP1 expression on CAR-T cell activation in vitro

CAR-T cells up-regulate the expression of a variety of surface molecules during in vitro activation, such as: CD69, 41-BB, PD-1, etc. Expression of surface activation-related molecules upon activation of CAR-T in vitro reflects CAR-T function. The CAR-T is activated by CD3/CD28 monoclonal antibody after 3 days of infection, and the expression level of the T cell activation related molecules is detected after 48 hours, and the result is shown in figure 5, and the MSLN-PLPP1-CAR-T group related molecules are remarkably higher than the MSLN-CAR-T, which shows that PLPP1 can remarkably promote the activation of the CAR-T cells.

(III) Effect of PLPP1 expression on the Capacity of expression of CAR-T functional molecule

Like T cells, CAR-T cells kill target cells by releasing IFN-G, TNFA, IL-2, Perforin, granzyme B, and other functional molecules. Thus, the CAR-T cell functional molecule secretory capacity is an embodiment of CAR-T cell function. Meanwhile, PMA and ionomycin can rapidly activate the cytokine expression secretion capacity of the CAR-T cell, and BFA can block the cytokine from being transported to the outside of the cell. Therefore, in related experiments, CAR-T cells activated by CD3/CD28 monoclonal antibody for 48 hours are taken, treated with PMA ionomycin and BFA for 6 hours, and then stained with flow-type intrinsic factor to detect the expression of CAR-T cells IFN-G, GranzymeB and Perforin.

The results are shown in fig. 6A and fig. 6B, and it can be seen that the secretion capacity of the MSLN-PLPP1-CAR-T cell functional molecule is obviously improved, which indicates that the expression of PLPP1 significantly enhances the secretion capacity of the MSLN-CAR-T functional molecule.

(IV) Effect of PLPP1 expression on CAR-T cell proliferative Capacity

The proliferative capacity of CAR-T cells is a prerequisite for CAR-T cells to exert tumor killing capacity. To explore the effect of PLPP1 on the proliferative capacity of CAR-T cells, we stained CAR-T cells with a proliferation dye and flow-assayed CAR-T cell proliferation 72h after activation with CD3/CD28 mab.

The results are shown in FIG. 7A, while cells were counted (shown in FIG. 7C); ki67 expression was also detected by flow assay on 48h activated CAR-T cells (FIG. 7B). From these results, it can be seen that MSLN-PLPP1-CAR-T has a significantly stronger proliferative capacity than MSLN-CART.

(V) Effect of PLPP1 modification on the killing Capacity of CAR-T cells in vitro

It has been shown that the MSLN-CAR-T target antigen mesothelin (i.e., mesothelin is the target antigen for MSLN-CAR-T) is highly expressed in many solid tumors, and statistical studies have shown that abnormally high mesothelin expression can be detected in more than 60% of lung adenocarcinoma patients. To test the tumor killing ability of MSLN-CAR-T, we used the lung cancer cell line H322 as the target cell and flow-tested the H322 cell line MSLN-CAR to be strongly positive for mesothelin expression (fig. 8A).

After the CAR-T cells and H322 cells are incubated for 6H with different effective target ratios, the apoptosis condition of the tumor cells is detected in a flow mode. The results show that: the tumor killing ability of MSLN-PLPP1-CAR-T was significantly higher than that of MSLN-CAR-T (FIG. 8B).

On the other hand, the detection effective target ratio is 5: CAR-T cell degranulation molecule CD107a expression level at 1, results show: the degranulation level of the MSLN-PLPP1-CAR-T group was significantly stronger than that of the MSLN-CAR-T (FIG. 8C).

CAR-T cells were compared to luciferase-expressing H322 cell line at an effective target ratio of 5: 1 for 24H, fluorescein was added and detected with an Ivis imaging system and the fluorescence intensity reflected H322 cell activity (fig. 8D).

Proliferation dye-labeled CAR-T cells were compared to H322 cell line at an effective target ratio of 1: 1 co-incubation for 72 hours, the results show: MSLN-PLPP1-CAR-T proliferated significantly higher than MSLN-CAR-T (FIG. 8E).

(VI) Effect of PLPP1 modification on tumor growth ability

The mouse tumor model was prepared as shown in FIG. 9A and the tumor size was shown in FIG. 9B, and it can be seen that PLPP1 modified CAR-T significantly delayed tumor growth compared to MSLN-CAR-T.

After sacrifice of the mice on day 21, tumors were removed and it can be seen that the tumor volume in the MSLN-PLPP1-CAR-T treated group was significantly smaller than in the MSLN-CAR-T treated group (figure 9C).

Different from traditional medicines, CAR-T is a living cell, has extremely strong proliferation capacity in vivo, and has the risk of off-target effect and further possibly causing systemic immune activation, and based on the reason, in order to detect whether the modification of PLPP1 can cause systemic immune activation or generate tissue damage caused by off-target effect, the HE staining is used for detecting important organs of mice (fig. 9D). As can be seen from the analysis, the modification of PLPP1 did not have off-target effects and did not cause systemic immune activation.

(hepta) impact of PLPP1 modification on CAR-T functional proliferative capacity in tumor microenvironment

To further verify the effect of PLPP1 modification on CAR-T cell antitumor ability, after sacrifice, a portion of mouse tumor tissue was taken and tumor-infiltrating lymphocytes were extracted and CAR-T proliferation ability and function were analyzed using flow cytometry.

Staining the internal factors related to the T cell functions, and analyzing to find that: MSLN-PLPP1-CAR-T in the tumor microenvironment still had high functional molecule expression (fig. 10A, fig. 10B); proliferation markers were performed on tumor-infiltrated CAR-T cells and molecular staining revealed that the expression of MSLN-PLPP1-CAR-T proliferation marker was also significantly higher than MSLN-CAR-T.

In the related research process, the inventor has found that the tumor infiltration of the colorectal cancer and the esophageal cancer is CD69⁺CD8⁺In the T cell research, the deletion of PLPP1 expression is found to exist, so it can be preliminarily considered that abnormal T cell lipid metabolism caused by the deletion of PLPP1 expression is one of the common mechanisms of the microenvironment of the solid tumor to inhibit T cells, that is, the tumor microenvironment is a technical obstacle which needs to be overcome firstly by killing the solid tumor by the CAR-T cells.

In combination with the results of examples 1 and 2, it can be seen that: the loss of PLPP1 expression in the tumor microenvironment is one of the main factors causing abnormal T cell lipid metabolism and further causing the reduction of T cell killing function and proliferation function. Based on this, the inventors modified CAR-T with PLPP1 and restricted PLPP1 expression to T cells, thereby reducing the impact on non-tumor tissues while enhancing CAR-T anti-tumor ability. Relevant experiments show that MSLN-CAR-T stably expressing PLPP1 can increase the in vitro activation level of T-cell, and can better inhibit tumor growth in vitro killing and mouse solid tumor model tumor infiltration research. Based on the result, a new prevention and treatment reference strategy can be provided for the prevention and treatment of related tumors.

SEQUENCE LISTING

<110> Zhengzhou university

Application of <120> PLPP1 in prevention and treatment of solid tumors by CAR-T technology

<130> none

<160> 1

<170> PatentIn version 3.5

<210> 1

<211> 1539

<212> DNA

<213> Artificial design

<400> 1

atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60

ccgcaggtgc agctggtgca gtctggggct gaggtgaagc ggcctggggc ctcagtgcag 120

gtttcctgca gggcatctgg atactccatc aacacctact atatgcaatg ggtgcgacag 180

gcccctggag cagggcttga gtggatggga gtaatcaacc ctagtggtgt cacaagctac 240

gcacagaagt tccagggcag agtcaccttg accaatgaca cgtccacgaa cacagtctac 300

atgcagctga acagcctgac atctgcagac acggccgtgt attactgtgc gagatgggca 360

ttgtgggggg atttcgggat ggacgtctgg ggcaagggaa ccctggtcac cgtctcctca 420

ggtggtggtg gttctggtgg tggtggttct ggtggtggtg gttccggtgg tggtggttcc 480

gacatccaga tgacccagtc tccttccacc ctgtctgcat ctattggaga cagagtcacc 540

atcacctgcc gggccagtga gggtatttat cactggttgg cctggtatca gcagaagcca 600

gggaaagccc ctaaactcct gatctataag gcctctagtt tagccagtgg ggccccatca 660

aggttcagcg gcagtggatc tgggacagat ttcactctca ccatcagcag cctgcagcct 720

gatgattttg caacttatta ctgccaacaa tatagtaatt atccgctcac tttcggcgga 780

gggaccaagc tggagatcaa aaccacaaca cccgcccccc ggccccccac acccgccccc 840

acaatcgcca gccagcccct gagcctgagg cccgaggcct gccggcccgc cgccgggggg 900

gccgtgcaca caagggggct ggatttcgcc tgcgatatct acatctgggc ccccctggcc 960

ggcacctgcg gcgtgctgct gctgagcctc gtgatcacac tgtactgcaa gagggggcgg 1020

aagaagctgc tgtacatctt caagcagccc ttcatgaggc ccgtgcagac cacccaggag 1080

gaggacggct gttcctgtag gtttcctgag gaggaggaag gaggatgtga gttgcctaga 1140

gtgaagttca gcaggagcgc agacgccccc gcgtaccagc agggccagaa ccagctctat 1200

aacgagctca atctaggacg aagagaggag tacgatgttt tggacaagag acgtggccgg 1260

gaccctgaga tggggggaaa gccgagaagg aagaaccctc aggaaggcct gtacaatgaa 1320

ctgcagaaag ataagatggc ggaggcctac agtgagattg ggatgaaagg cgagcgccgg 1380

aggggcaagg ggcacgatgg cctttaccag ggtctcagta cagccaccaa ggacacctac 1440

gacgcccttc acatgcaggc cctgccccct cgcggaagcg gagctactaa cttcagcctg 1500

ctgaagcagg ctggagacgt ggaggagaac cctggacct 1539