1. A method for producing a reference DNA for absolute quantification of a microorganism, comprising:

using human genome DNA as a template, and carrying out amplification and purification by using an amplification primer pair carrying microorganism binding sites to obtain reference DNA for absolute quantification of the microorganism;

wherein, the amplification primer pair carrying the microorganism binding site is a microorganism reference primer pair, and the sequence of the amplification primer pair comprises nucleotide sequences shown as SEQ ID NO. 1-SEQ ID NO. 6.

2. A reference DNA for absolute quantification of a microorganism prepared by the method according to claim 1.

3. A detection method for absolute quantification of metagenome, the detection method comprising:

(1) synthesizing a microbial reference primer pair, and using the microbial reference primer pair to amplify by using the human genome DNA as a template to obtain a reference DNA for absolute quantification of the microorganism according to claim 2;

the microbial reference primer pair comprises a prokaryotic reference primer pair, a eukaryotic reference primer pair and a fungal reference primer pair, and the sequence of the microbial reference primer pair comprises nucleotide sequences shown as SEQ ID NO. 1-SEQ ID NO. 6;

(2) extracting DNA of a sample to be detected, quantifying, and adding a known amount of the reference DNA sequence in the step (1);

(3) synthesizing a microorganism identification primer pair, amplifying the DNA sample obtained in the step (2) by using the microorganism identification primer pair, and purifying;

(4) and (3) amplifying the sample obtained in the step (3) by using a PCR primer compatible with a sequencing platform, sequencing by using the sequencing platform, and comparing genome sequences to realize absolute quantification of the content of the microorganisms in the sample to be detected.

4. The detection method according to claim 3, wherein the pair of microorganism identification primers of step (3) comprises: a prokaryotic identification primer pair, a eukaryotic identification primer pair and a fungal identification primer pair;

preferably, the sequences of the microorganism identification primer pair in the step (3) comprise nucleotide sequences shown as SEQ ID NO. 7-SEQ ID NO. 12.

5. The detection method according to claim 3 or 4, wherein the PCR primer of step (4) comprises a nucleotide sequence shown as SEQ ID No.13 to SEQ ID No. 16;

preferably, the read length of the sequencing platform in the step (4) is 150-300 bp.

6. The detection method according to any one of claims 3 to 5, wherein the amplification in step (1) is the same as the amplification method in step (3), and the amplification procedure is 95 to 98 ℃ for 2 to 3 min; 15-20 s at 94-96 ℃, 3-4 min at 55-60 ℃ and 30-35 cycles; storing at 4-10 deg.c;

preferably, the amplification procedure in the step (4) is 96-98 ℃ for 2-3 min; 8-12 s at 94-96 ℃, 25-35 min at 55-60 ℃, 25-35 s at 72 ℃ and 10-15 cycles; storing at 4-10 deg.C.

7. The method of detecting according to any one of claims 3 to 6, wherein the method of aligning the genomic sequences in step (4) comprises:

classifying the sequence obtained by sequencing according to the universal primer, and classifying the sequence into a microorganism group according to the base composition of the sequence;

and counting by using the reference DNA sequence through the absolute quantification of the microorganisms, and carrying out absolute quantification on the content of the microorganisms in a unit mass sample.

8. A kit comprising the reference DNA for absolute quantification of a microorganism according to claim 2.

9. The kit according to claim 8, wherein the kit comprises the nucleotide sequences shown in SEQ ID No.1 to SEQ ID No. 12.

10. Use of the preparation method according to claim 1, the reference DNA for absolute quantification of microorganisms according to claim 2, the detection method according to any one of claims 3 to 7, or the kit according to claim 8 or 9 for identification of a microorganism sample.

Background

Microbiota (microbiota) affects many aspects of human and animal disease and immunity, geochemical nutrient cycle and plant productivity. Researchers amplify specific groups, including bacteria, archaea, eukaryotes, or fungi, by PCR to assess the relative abundance of subgroups (e.g., genera). However, this neither revealed the absolute abundance of the subgroups, nor compared the different amplicon families (i.e. OTUs derived from a particular pair of PCR primers, e.g. bacterial 16S, eukaryotic 18S or fungal ITS). This prevents the determination of absolute abundance of a particular population and changes in the domain levels of microbial population abundance may not be detectable.

In the past decade, amplicon DNA sequencing has shown that microbiota affects human immunity, digestion, mental health, and plant growth and development. These different field studies reveal subtle relationships between different microbial populations, highlighting the importance of soil microbial communities to plant health in terms of plants. Environmental microbial communities have a rich variety of constituents and are commonly studied by PCR amplification of marker genes. However, in most studies, only a certain class (domain) of a microbiome, such as bacteria, is studied. Furthermore, most microbiome studies are limited by the use of domain-specific primers to generate PCR amplicons (amplified genes from a single environmental sample), which in turn results in a loss of quantitative comparison between any two or more sets of PCR amplicons.

However, in order to reveal the real complexity of the gut, soil and other environments, the quantitative relationship between the major microbiota must be determined. At present, in 16s and metagenomic sequencing research, the number and structure of floras are mainly represented by relative abundance, but the floras analysis method based on relative values is more limited.

Disclosure of Invention

Aiming at the defects in the prior art, the invention aims to provide a metagenome absolute quantitative detection method and application thereof.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect, the present invention provides a method for preparing a reference DNA for absolute quantification of a microorganism, the method comprising:

and (3) amplifying and purifying by using human genome DNA as a template and using an amplification primer pair carrying microorganism binding sites to obtain the reference DNA for absolute quantification of the microorganism.

The present invention contemplates short chimeric synthetic DNA fragments that contain universal primer binding sites specific for three major microbial domains (prokaryotes, eukaryotes, and fungi). Therefore, the amplification primer pair includes a prokaryotic reference primer pair, a eukaryotic reference primer pair and a fungal reference primer pair, wherein the length of each primer is 37-46 bp (for example, 37bp, 38bp, 39bp, 40bp, 41bp, 42bp, 43bp, 44bp, 45bp or 46bp, etc.), and the GC content is 40-60% (for example, 40%, 42%, 44%, 45%, 46%, 48%, 50%, 52%, 55%, 56%, 57%, 58% or 60%, etc.).

The amplification primer pair carrying the microorganism binding sites is a microorganism reference primer pair, and the sequence of the amplification primer pair comprises nucleotide sequences shown as SEQ ID NO. 1-SEQ ID NO. 6.

SEQ ID NO.1：

CCTACGGGNGGCWGCAGGCAACTACAAGAGGCTGAATGC

SEQ ID NO.2：

GACTACHVGGGTATCTAATCCGGAGAAATGAGAGGCCTGATG

SEQ ID NO.3：

AGTTAAAAAGCTCGTAGTTGAAAGCCCAGCACCTCTCACC

SEQ ID NO.4：

GTGCCCTTCCGTCAATTCCATTCCATTGTGCCCTGTG

SEQ ID NO.5：

GCATCGATGAAGAACGCAGCTGTCTGAAGGCTGACTGAATAATCAAC

SEQ ID NO.6：

TCCTCCGCTTATTGATATGCACAGAGCCCTCCCACAGAGG

Wherein base N represents A, C, G or T; base W represents A or T; base H represents A, C or T; base V represents either A, C or G.

During PCR, these synthetic DNA molecules will produce the respective expected amplicon sizes due to the presence of the synthetic stuffer. Adding a known number of synthetic DNA spikes directly to the environmental sample and calculating their relative abundance in the sequencing output, the absolute abundance of a particular biological population can be determined within and between amplicon categories.

In a second aspect, the present invention provides a reference DNA for absolute quantification of a microorganism prepared by the preparation method according to the first aspect.

In a third aspect, the present invention further provides a method for detecting absolute quantification of metagenome, the method comprising:

(1) synthesizing a microbial reference primer pair, and amplifying by using the microbial reference primer pair and using the human genome DNA as a template to obtain a reference DNA for absolute quantification of the microorganism according to the second aspect;

the microbial reference primer pair comprises a prokaryotic reference primer pair, a eukaryotic reference primer pair and a fungal reference primer pair, and the sequence of the microbial reference primer pair comprises nucleotide sequences shown as SEQ ID NO. 1-SEQ ID NO. 6;

(2) extracting DNA of a sample to be detected, quantifying, and adding a known amount of the reference DNA sequence in the step (1);

(3) synthesizing a microorganism identification primer pair, amplifying the DNA sample obtained in the step (2) by using the microorganism identification primer pair, and purifying;

(4) and (3) amplifying the sample obtained in the step (3) by using a PCR primer compatible with a sequencing platform, and then sequencing by using the sequencing platform and comparing the genome sequence to realize absolute quantification of the content of the microorganisms in the sample to be detected.

As a preferred technical scheme of the invention, the microorganism identification primer pair in the step (3) comprises: a prokaryotic identification primer pair, a eukaryotic identification primer pair and a fungal identification primer pair;

preferably, the sequences of the microorganism identification primer pair in the step (3) comprise nucleotide sequences shown as SEQ ID NO. 7-SEQ ID NO. 12.

SEQ ID NO.7：

ACACTCTTTCCCTACACGACGCTCTTCCGATCTCCTACGGGNGGCWGCAG

SEQ ID NO.8：

GACTGGAGTTCAGACGTGTGCTCTTCCGATCTGACTACHVGGGTATCTAATCC

SEQ ID NO.9：

ACACTCTTTCCCTACACGACGCTCTTCCGATCTAGTTAAAAAGCTCGTAGTTG

SEQ ID NO.10：

GACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTGCCCTTCCGTCAATT

SEQ ID NO.11：

ACACTCTTTCCCTACACGACGCTCTTCCGATCTGCATCGATGAAGAACGCAGC

SEQ ID NO.12：

GACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCCTCCGCTTATTGATATGC

The PCR primer comprises a label sequence with the length of several to tens of bases, and amplification products from different samples can be amplified by the PCR primer with different label sequences, so that the amplification products of different samples can be mixed together, and the sequence obtained by sequencing can be classified into different samples according to the label sequence in subsequent high-throughput sequencing data.

As a preferred technical scheme of the invention, the PCR primer in the step (4) comprises a nucleotide sequence shown as SEQ ID NO. 13-SEQ ID NO. 16.

The method comprises the following specific steps:

UNIPCRF(SEQ ID NO.13)：

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC

UDIR0001(SEQ ID NO.14)：

CAAGCAGAAGACGGCATACGAGATAACCGCGGGTGACTGGAGTTCAGACGTG

UDIR0002(SEQ ID NO.15)：

CAAGCAGAAGACGGCATACGAGATGGTTATAAGTGACTGGAGTTCAGACGTG

UDIR0003(SEQ ID NO.16)：

CAAGCAGAAGACGGCATACGAGATCCAAGTCCGTGACTGGAGTTCAGACGTG

in the invention, the amplification in the step (1) is the same as the amplification method in the step (3), and the amplification procedure can be 95-98 ℃ for 2-3 min; 15-20 s at 94-96 ℃, 3-4 min at 55-60 ℃ and 30-35 cycles; storing at 4-10 deg.c;

in the invention, the amplification procedure in the step (4) can be 96-98 ℃ for 2-3 min; 8-12 s at 94-96 ℃, 25-35 min at 55-60 ℃, 25-35 s at 72 ℃ and 10-15 cycles; storing at 4-10 deg.C.

As a preferred technical scheme of the invention, the amplification in the step (1) is the same as the amplification method in the step (3), and the amplification procedure is 98 ℃ for 2 min; 32 cycles of 20s at 96 ℃ and 4min at 60 ℃; storing at 10 deg.C.

Preferably, the amplification procedure of step (4) is 98 ℃ for 2 min; at 96 ℃ for 10s, at 60 ℃ for 30min and at 72 ℃ for 30s, for 12 cycles; storing at 10 deg.C.

As a preferred technical scheme of the invention, the method for aligning the genome sequences comprises the following steps:

classifying the sequence obtained by sequencing according to the universal primer, and classifying the sequence into a microorganism group according to the base composition of the sequence;

and counting by using the reference DNA sequence through the absolute quantification of the microorganisms, and carrying out absolute quantification on the content of the microorganisms in a unit mass sample.

In a fourth aspect, a kit comprising a reference DNA for absolute quantification of a microorganism according to the second aspect.

The kit comprises nucleotide sequences shown by SEQ ID NO. 1-SEQ ID NO. 12.

In a fifth aspect, the preparation method according to the first aspect, the reference DNA for absolute quantification of a microorganism according to the second aspect, the detection method according to the third aspect, or the kit according to the fourth aspect is used for identification of a microorganism sample.

As used herein, the abbreviation OTU refers to the Operational taxonmiC unit, taxon unit.

It should be noted that the "test sample" or "test sample" as used herein refers to a substance to be analyzed for single cells, which may be from an individual (e.g., a human or animal, more specifically, blood of a patient, pleural effusion, etc.), or may be from other sources, such as some processed or unprocessed laboratory material, environmental sample, or artificially synthesized test sample. It is to be understood that the detection of a "sample" or "specimen" is not solely directed to diagnostic and therapeutic purposes, but may be directed to other non-diagnostic and therapeutic purposes.

The recitation of numerical ranges herein includes not only the above-recited values, but also any values between any of the above-recited numerical ranges not recited, and for brevity and clarity, is not intended to be exhaustive of the specific values encompassed within the range.

Compared with the prior art, the invention has the beneficial effects that:

(1) the invention overcomes the defects of the prior art and provides a metagenome absolute quantitative detection method, which uses a primer pair with proper length and GC content to amplify and synthesize to obtain reference DNA; then, adding a certain amount of the reference DNA into a microbial environment sample with known quality, carrying out OTU cluster statistics through amplicon amplification and high-throughput high-depth sequencing and data analysis, and carrying out absolute quantification on the microbial content in a unit mass sample;

(2) the method for detecting the absolute quantification of the metagenome can quickly establish a detection system of prokaryotes, eukaryotes and fungi, reduces the detection cost, greatly reduces the detection cost and has higher detection flux compared with the traditional QPCR platform, and simultaneously, the method adopts digital counting for quantification, so the accuracy is greatly improved, and the sensitivity of the detection method can be greatly improved by adopting sequence identification of single-molecule amplification product sequencing and a digital counting quantification method, thereby realizing the accurate and reliable method for absolutely quantifying the content of microorganisms in a unit mass sample.

Drawings

FIG. 1 is a schematic flow chart of the detection method for absolute quantification of metagenome according to the present invention.

Detailed Description

The technical solutions of the present invention are further described in the following embodiments with reference to the drawings, but the following examples are only simple examples of the present invention and do not represent or limit the scope of the present invention, which is defined by the claims.

In the following examples, reagents and consumables used were obtained from conventional reagent manufacturers in the field unless otherwise specified; unless otherwise indicated, all experimental methods and technical means are conventional in the art.

Example 1

This example provides a reference DNA for absolute quantification of microorganisms, which is prepared by a method comprising the steps of:

(1) designing three pairs of amplification primers with appropriate optimized sequences in length and GC content based on a human genome;

nucleotide sequences of primer binding sites for identifying prokaryotes, eukaryotes and fungi are respectively added to the 5' ends of the three pairs of primers, and the obtained microbial reference sequence is shown as SEQ ID NO. 1-6;

the primer information is shown in Table 1;

TABLE 1

(2) Respectively diluting a prokaryotic reference primer F/R mixed solution, a eukaryotic reference primer F/R mixed solution and a fungal reference primer F/R mixed solution, wherein the concentration of each primer is 2 mu M; taking 100ng of human genome DNA as a template (the mass of the template can be 10-100 ng) to carry out PCR reaction, wherein the reaction system is 20 mu L and comprises 10 mu L of 2 xHIFI multi PCR master mix, 2 mu L of Pmix primer mixture, 2 mu L of template and 6 mu L of sterile water;

the amplification system is shown in table 2:

TABLE 2

Reagent	Volume (μ L)
		2×HIFI multi PCR master mix	10
Pmix primer mixture	2
		Human genomic DNA	2
Sterile water	6
		Total volume	20

The PCR procedure is shown in Table 3 below:

TABLE 3

(3) Purifying the reaction product by using a DNA purification magnetic bead kit according to the proportion of 1.8 multiplied by the obtained product, and accurately quantifying the purified product obtained by using the Nanodrop (wherein the accurate quantification method can also be a method such as qubit and QPCR); obtaining the reference DNA for absolute quantification of the microorganism.

Example 2

In this example, the reference DNA provided in example 1 was used to perform absolute quantitative detection on a microbial environment sample, as shown in fig. 1, the detection method includes the following steps:

s1, preparing a reference DNA for absolute quantification of a microorganism, namely, the step shown in example 1;

s2, extracting DNA in the sample to be detected and quantifying;

s3, adding a known amount of reference DNA for absolute quantification of microorganisms into the DNA of a sample to be detected;

s4, synthesizing a microorganism identification primer pair;

s5, amplifying the mixed sample by using the microorganism identification primer pair and purifying;

s6, synthesizing a PCR primer compatible with a sequencing platform;

s7, amplifying the purified product by using a PCR primer compatible with a sequencing platform;

and S8, sequencing by using a sequencing platform and comparing genome sequences to realize absolute quantification of the content of the microorganisms in the sample to be detected.

The detection method provided in the embodiment specifically includes the following steps:

(1) extracting and quantifying the DNA of the environmental sample of the microorganism to be detected, and marking the sample M1;

dividing the total DNA into three parts, and adding 5pg, 20pg and 80pg of the reference DNA described in example 1, labeled as M1-1, M1-2 and M1-3, respectively, to each 1. mu.g of the total DNA;

(2) amplifying, purifying and recovering the extracted DNA by using a microorganism identification primer pair, wherein each piece of primer information of the microorganism identification primer pair is shown in a table 4;

TABLE 4

(3) Respectively diluting prokaryotic identification primer F/R mixed liquor, eukaryotic identification primer F/R mixed liquor and fungus identification primer F/R mixed liquor, wherein the concentration of each primer is 2 mu M;

respectively carrying out PCR reaction on 200ng of M1-1, M1-2 and M1-3 (the mass of the template can be 100-200 ng), wherein the reaction system is 20 mu L and comprises 10 mu L of 2 XHIFI multi PCR master mix, 2 mu L of Pmix primer mixture, 2 mu L of template and 6 mu L of sterile water;

the amplification system is shown in table 5:

TABLE 5

The PCR program is as follows: 2min at 98 ℃; 32 × (96 ℃ C. for 20s, 60 ℃ C. for 4 min); storing at 10 deg.C;

purifying the reaction product by using a DNA purification magnetic bead kit according to the proportion of 1.8 multiplied by the obtained product;

(4) using PCR primers UNIPCRF and UDIR 0001-0003 compatible with the illiminia sequencing platform with different tag sequences, wherein the concentration of each primer is 2 mu M;

the PCR primer sequences used in this example are as follows:

UNIPCRF(SEQ ID NO.13)：

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC

UDIR0001(SEQ ID NO.14)：

CAAGCAGAAGACGGCATACGAGATAACCGCGGGTGACTGGAGTTCAGACGTG

UDIR0002(SEQ ID NO.15)：

CAAGCAGAAGACGGCATACGAGATGGTTATAAGTGACTGGAGTTCAGACGTG

UDIR0003(SEQ ID NO.16)：

CAAGCAGAAGACGGCATACGAGATCCAAGTCCGTGACTGGAGTTCAGACGTG

taking 2 mu L of the purified product as a template to carry out PCR reaction, wherein the reaction system is 20 mu L and comprises 10 mu L of 2 XHIFI PCR master mix, 2 mu L of Pmix, 2 mu L of the purified product and 6 mu L of sterile water;

the PCR procedure is shown in Table 6 below:

TABLE 6

Performing high-throughput double-end sequencing on the second round PCR amplification product, wherein the sequencing read length can be PE300 bp;

(5) analyzing sequencing data, realizing sample classification of sequencing sequences, and comparing genome sequences: firstly, sequences obtained by sequencing are classified into corresponding samples according to tag sequences, then the sequences are classified into different microbial communities according to the base composition of each sequence, and the content of microorganisms in a unit mass sample is absolutely quantified by counting according to a reference DNA sequence;

and (4) analyzing results: the three sample clustering statistics and the quantitative results are shown in table 7;

TABLE 7

In conclusion, the proportion relation of the copy number of each reference DNA is consistent with the proportion of the actually added reference DNA, no significant difference exists, and the quantitative determination result is accurate, namely the detection method provided by the invention realizes the absolute quantification of the metagenome sample.

The applicant declares that the above description is only a specific embodiment of the present invention, but the scope of the present invention is not limited thereto, and it should be understood by those skilled in the art that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope of the present invention are within the scope and disclosure of the present invention.

SEQUENCE LISTING

<110> Suzhou Saifu medical laboratory Co., Ltd

<120> detection method for absolute quantification of metagenome and application thereof

<130> 20210628

<160> 16

<170> PatentIn version 3.3

<210> 1

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<221> misc_feature

<222> (9)..(9)

<223> n is a, c, g, or t

<400> 1

cctacgggng gcwgcaggca actacaagag gctgaatgc 39

<210> 2

<211> 42

<212> DNA

<213> Artificial sequence

<400> 2

gactachvgg gtatctaatc cggagaaatg agaggcctga tg 42

<210> 3

<211> 40

<212> DNA

<213> Artificial sequence

<400> 3

agttaaaaag ctcgtagttg aaagcccagc acctctcacc 40

<210> 4

<211> 37

<212> DNA

<213> Artificial sequence

<400> 4

gtgcccttcc gtcaattcca ttccattgtg ccctgtg 37

<210> 5

<211> 47

<212> DNA

<213> Artificial sequence

<400> 5

gcatcgatga agaacgcagc tgtctgaagg ctgactgaat aatcaac 47

<210> 6

<211> 40

<212> DNA

<213> Artificial sequence

<400> 6

tcctccgctt attgatatgc acagagccct cccacagagg 40

<210> 7

<211> 50

<212> DNA

<213> Artificial sequence

<220>

<221> misc_feature

<222> (42)..(42)

<223> n is a, c, g, or t

<400> 7

acactctttc cctacacgac gctcttccga tctcctacgg gnggcwgcag 50

<210> 8

<211> 53

<212> DNA

<213> Artificial sequence

<400> 8

gactggagtt cagacgtgtg ctcttccgat ctgactachv gggtatctaa tcc 53

<210> 9

<211> 53

<212> DNA

<213> Artificial sequence

<400> 9

acactctttc cctacacgac gctcttccga tctagttaaa aagctcgtag ttg 53

<210> 10

<211> 49

<212> DNA

<213> Artificial sequence

<400> 10

gactggagtt cagacgtgtg ctcttccgat ctgtgccctt ccgtcaatt 49

<210> 11

<211> 53

<212> DNA

<213> Artificial sequence

<400> 11

acactctttc cctacacgac gctcttccga tctgcatcga tgaagaacgc agc 53

<210> 12

<211> 52

<212> DNA

<213> Artificial sequence

<400> 12

gactggagtt cagacgtgtg ctcttccgat cttcctccgc ttattgatat gc 52

<210> 13

<211> 45

<212> DNA

<213> Artificial sequence

<400> 13

aatgatacgg cgaccaccga gatctacact ctttccctac acgac 45

<210> 14

<211> 52

<212> DNA

<213> Artificial sequence

<400> 14

caagcagaag acggcatacg agataaccgc gggtgactgg agttcagacg tg 52

<210> 15

<211> 52

<212> DNA

<213> Artificial sequence

<400> 15

caagcagaag acggcatacg agatggttat aagtgactgg agttcagacg tg 52

<210> 16

<211> 52

<212> DNA

<213> Artificial sequence

<400> 16

caagcagaag acggcatacg agatccaagt ccgtgactgg agttcagacg tg 52