1. An infectious cloning vector of a mulberry leaf dwarf-related virus MMDaV, which is characterized in that: the MMDaV full-length sequence is obtained by fusing two copies of MMDaV full-length sequences to a pBinPLUS vector, and the MMDaV full-length sequence is shown in SEQ ID No. 6.

2. The method for preparing the infectious cloning vector of the mulberry leaf-type dwarf-related virus MMDaV according to claim 1, comprising the following steps:

(1) extraction of total plant DNA: extracting plant genome total DNA from collected mulberry infected with MMDaV by adopting a CTAB method;

(2) cloning and sequencing of the full-length sequence of MMDaV: utilizing a PCR amplification system, taking mulberry DNA containing MMDaV virus as a template, taking MMDaV FL/SalI-F and MMDaV FL/KpnI-R as primers to carry out PCR amplification, inserting a PCR product into a pEasy-T1 vector, and screening to obtain pEasy T1-MMDaV-PL;

using the MMDaV FL/KpnI-F and the MMDaV FL/KpnI-R as primers to amplify a target fragment, inserting a PCR product into a pEasy-T1 vector, and screening to obtain pEasy T1-MMDaV-FL;

the gene sequences of the primers MMDaV FL/SalI-F, MMDaV FL/KpnI-F and MMDaV FL/KpnI-R are respectively SEQ ID NO 1, SEQ ID NO 2 and SEQ ID NO 3;

(3) cloning of pBinPLUS-MMDaV-PL: carrying out enzyme digestion on the T1-MMDaV-PL plasmid with correct sequencing by using SalI and KpnI restriction enzymes, and recovering a target fragment; meanwhile, the binary plant expression vector pBinPLUS is cut by SalI and KpnI restriction enzymes, recovered and purified, and then an MMDaV fragment cut by the SalI and KpnI restriction enzymes is connected with the pBinPLUS by utilizing T4 DNA ligase to obtain pBinPLUS-MMDaV-PL;

(4) cloning of pBin-MMDaV 2A: cutting the T1-MMDaV-FL plasmid with correct sequencing by using KpnI restriction enzyme, and recovering a target fragment; meanwhile, the pBinPLUS-MMDaV-PL plasmid was digested with KpnI restriction enzyme, recovered and purified, and then the MMDaV fragment recovered by the same restriction enzyme digestion with KpnI was ligated with the pBinPLUS-MMDaV-PL fragment using T4 DNA ligase, and the plasmid pBin-MMDaV2A containing 2 tandem repeats was obtained by screening.

3. Use of the infectious cloning vector of claim 1 in pathogenicity analysis and virus gene function study of MMDaV.

4. An agrobacterium strain carrying MMDaV infectious clones characterized by: the agrobacterium containing the MMDaV infectious clone can be obtained by transferring the infectious clone vector of claim 1 into an EHA105 agrobacterium competent cell by an electric shock transformation method.

5. The use of the Agrobacterium strain of claim 4 in pathogenicity analysis and viral gene function studies of MMDaV.

Background

Mulberry leaf dwarf virus (MMDaV) is a single-component geminivirus which seriously influences the growth of Mulberry and the yield of Mulberry leaves, and when the disease occurs, the Mulberry shows symptoms of dwarfing, yellowing and shrinking of leaves, and the like. The genome of MMDaV is a single-stranded circular DNA molecule of size 2952nt, the viral chain containing 5 ORFs (V1, V2, V3, V4 and V5): v1 may encode capsid protein, V2 encodes protein as RNA silencing inhibitor, and the homology of V3, V4 and V5 with known geminivirus sequence is very low, and the function of the encoded protein is not clear; the complementary strand contains 2 ORFs (C1 and C1: C2), and the encoded proteins are probably involved in viral replication. The viral strand of MMDaV is intergenic with the complementary strand, containing the initiation site of viral replication and transcription. At present, the biological properties and pathogenic mechanism of MMDaV are not clear.

Infectious cloning of plant viruses is a fundamental tool in plant virology research. The virus genome can be modified and reformed in vitro by utilizing molecular operations such as mutation, recombination and the like; by analyzing the phenotypic and characteristic changes of the recombinant virus, the structure of the viral genome can be researched, the functions of viral genes and products can be determined, and the interaction between the virus and a host can be understood. In addition, the infectious clone of the virus can be used for evaluating the resistance of the plant, and provides an important means for screening antiviral plants and controlling the virus.

Disclosure of Invention

The first object of the present invention is to provide an MMDaV infectious cloning vector and a method for preparing the same.

A second object of the present invention is to provide Agrobacterium strains carrying MMDaV infectious clones and uses thereof.

The invention takes MMDaV as a material, utilizes a molecular biology method to construct 2.0 forward repeated MMDaV full-length gene groups on a plant expression vector pBinPLUS with high replication capacity, and transfers the recombinant vector into an agrobacterium strain by an electric shock method to obtain a virus vector which has infection capacity to plants by agrobacterium mediation.

In order to achieve the purpose, the technical scheme adopted by the invention is as follows:

an infectious cloning vector of MMDaV is prepared by constructing 2.0 forward-repeated MMDaV full-length gene groups on a plant expression vector pBinPLUS with high replication capacity, wherein the MMDaV full sequence is shown as SEQ ID NO: and 6.

The preparation method of the MMDaV infectious cloning vector comprises the following steps:

(1) extraction of total plant DNA: extracting plant genome total DNA from collected mulberry infected with MMDaV by adopting a CTAB method;

(2) cloning and sequencing of the full-length sequence of MMDaV: PCR amplification is carried out by using a PCR amplification system and using mulberry DNA containing MMDaV as a template and MMDaV FL/SalI-F and MMDaV FL/KpnI-R (inserting SalI and KpnI sites) as primers, a PCR product is inserted into a pEasy-T1 vector, and pEasy T1-MMDaV-PL (containing SalI and KpnI specific enzyme cutting sites) is obtained by screening. Amplifying a target fragment (2952bp) by using the MMDaV FL/KpnI-F and the MMDaV FL/KpnI-R (inserting KpnI sites) as primers, inserting the PCR product into a pEasy-T1 vector, and screening to obtain pEasy T1-MMDaV-FL (containing KpnI specific enzyme cutting sites);

the gene sequences of the primers MMDaV FL/SalI-F, MMDaV FL/KpnI-F and MMDaV FL/KpnI-R are respectively SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3;

(3) cloning of pBinPLUS-MMDaV-PL: the correctly sequenced T1-MMDaV-PL plasmid was digested with SalI and KpnI restriction enzymes by a conventional digestion and collection method, and the desired fragment (about 3000 bp) was collected. Meanwhile, after the binary plant expression vector pBinPLUS is subjected to enzyme digestion by using SalI and KpnI restriction enzymes, an MMDaV fragment subjected to enzyme digestion by using the SalI and KpnI restriction enzymes is connected with the pBinPLUS by using T4 DNA ligase to obtain pBinPLUS-MMDaV-PL;

(4) cloning of pBin-MMDaV 2A: the T1-MMDaV-FL plasmid with the correct sequence was digested with KpnI restriction enzyme by a conventional digestion and collection method, and the desired fragment (about 3000 bp) was collected. Meanwhile, the pBinPLUS-MMDaV-PL plasmid was digested with KpnI restriction enzyme, recovered and purified, and then the MMDaV fragment recovered by the same restriction enzyme digestion with KpnI was ligated with the pBinPLUS-MMDaV-PL fragment using T4 DNA ligase, and the plasmid pBin-MMDaV2A containing 2 tandem repeats was obtained by screening.

The infectious cloning vector disclosed by the invention is applied to pathogenicity analysis and virus gene function research of MMDaV.

An agrobacterium strain carrying the MMDaV infectious clone is prepared by transferring the pBin-MMDaV2A plasmid into EHA105 agrobacterium-infected competent cells by an electric shock transformation method to obtain the agrobacterium containing the MMDaV infectious clone.

The agrobacterium strain disclosed by the invention is applied to pathogenicity analysis and virus gene function research of MMDaV.

Compared with the prior art, the invention has the outstanding effects that:

(1) the invention constructs 2 copies of MMDaV genome to plant expression vector pBinPLUS, and transfers the recombinant vector into agrobacterium strain through electric shock transformation, to obtain virus vector with infection ability.

(2) The agrobacterium strain provided by the invention can produce large amount of MMDaV infectious clones.

(3) The infectious clone vector provided by the invention can cause necrosis reaction on the Nicotiana benthamiana, and has the advantages of simple operation and good repeatability.

(4) The infectious cloning vector provided by the invention can be effectively used for plant disease resistance reaction analysis.

The infectious cloning vector of MMDaV, the construction method and application thereof are further described in the following description and specific examples in conjunction with the accompanying drawings.

Drawings

FIG. 1 is a schematic diagram of the construction of an MMDaV infectious cloning vector.

FIG. 2 is a graph of the phenotype of MMDaV infectious clone Agrobacterium infiltrated with Nicotiana benthamiana. A: MMDaV infectious clone Agrobacterium infiltration inoculated 3 days later phenotype (white light); b: MMDaV infectious clone Agrobacterium infiltration inoculated with 3 days after the Nicotiana benthamiana phenotype (ultraviolet light); c: MMDaV infectious clone Agrobacterium was infiltrated with the 3 day old phenotype from Nicotiana benthamiana (photographed under white light after DAB staining).

FIG. 3 is a PCR assay of Nicotiana benthamiana inoculated with MMDaV infectious clones; m: DNAmarker; 1: a PCR negative control; 2-5: MMDaV infectious clone inoculated plants.

Detailed Description

The examples provided herein were performed according to conventional experimental conditions, wherein the primer sequences used are shown in Table 1.

TABLE 1 MMDaV infectious cloning vector construction primers

Numbering	Primer and method for producing the same	Sequences (5'-3')	SEQ ID No.
				1	MMDaV FL/SalI-F	gggtcgacatttgacccattttgaccatgg	SEQ ID No:1
2	MMDaV FL/KpnI-F	ggggtaccatttgacccattttgacc	SEQ ID No:2
				3	MMDaV FL/KpnI-R	ggggtacccattaccaccagtatg	SEQ ID No:3
4	V4 GW-F	caccatgttttcaaggagaaaaaaag	SEQ ID No:4
				5	C1C2 GW-F	caccatggcttcaagttctaacttcag	SEQ ID No:5

Example 1 construction of infectious clone pBin-MMDaV2A of Mulberry leaf-type dwarf-related Virus

(1) Extraction of total plant DNA: extracting plant genome total DNA from collected mulberry infected with MMDaV by CTAB method.

The specific operation method comprises the following steps: taking 0.1g of plant leaves, putting the plant leaves into a 2mL centrifuge tube, adding a steel ball with the diameter of 5mm, putting the centrifuge tube into liquid nitrogen for quick freezing, putting the centrifuge tube into a grinding instrument, grinding the plant leaves for 60s at 40HZ, and grinding the plant leaves into powder. Adding 500 μ L CTAB extractive solution preheated at 65 deg.C (2% beta-mercaptoethanol is added when using) into the ground powder, mixing, heating in 65 deg.C metal bath for 1h, and mixing by reversing for 3-4 times. The same volume of 24:1 chloroform: isoamyl alcohol (ready-to-use) was shaken up and down to mix well and centrifuged at 10000rpm for 5min at 4 ℃. Sucking the supernatant with a pipette gun, placing in a 1.5mL centrifuge tube, adding 1/10 volumes of 3M sodium acetate solution (pH5.2) and equal volume of anhydrous ethanol precooled at-20 deg.C, mixing, and standing at-20 deg.C for 1 h. Centrifuging at 12000rpm for 5min at 4 deg.C, discarding supernatant, washing precipitate with 500mL 70% ethanol for three times, centrifuging at 10000rpm for 3min each time at 4 deg.C. The supernatant was discarded, dried at room temperature for about 10min, added with 30 μ L of 65 ℃ preheated deionized water, and pipetted and mixed well. The total DNA sample was stored at-20 ℃.

(2) Cloning and sequencing of the full-length sequence of MMDaV: PCR amplification is carried out by using mulberry DNA containing MMDaV virus as a template and MMDaV FL/SalI-F and MMDaV FL/KpnI-R (SalI and KpnI sites are inserted) as primers by using a PCR amplification system: mu.L of ddH2O, 5. mu.L of 5 XStart FastPfu buffer, 0.5. mu.L of 5 'end primer (10. mu. mol/L), 2. mu.L of 2.5mM dNTPs, 0.5. mu.L of 3' end primer (10. mu. mol/L), 1. mu.L of TransStart FastPfu DNApolymerase, 1. mu.L of template, with a final total volume of 25. mu.L. The reaction parameters are as follows: carrying out circular reaction after pre-denaturation at 95 ℃ for 2 min: denaturation at 95 ℃ for 20s, annealing at 50 ℃ for 20s, extension at 72 ℃ for 2kb/min, and extension at 72 ℃ for 10min after 35 cycles. And (3) carrying out agarose gel electrophoresis on the amplified PCR product, purifying, inserting the purified PCR product into a pEasy-T1 vector, screening to obtain pEasy T1-MMDaV-PL (containing SalI and KpnI specific enzyme cutting sites), sequencing and splicing to obtain a full-length sequence of 1 copy of MMDaV. And (3) amplifying the MMDaV full-length sequence (2952nt) by using the MMDaV FL/KpnI-F and the MMDaV FL/KpnI-R (inserting KpnI sites) as primers, similarly inserting the PCR product into a pEasy-T1 vector, screening to obtain pEasy T1-MMDaV-FL (containing KpnI specific enzyme cutting sites), sequencing and splicing to obtain another 1 copy of the MMDaV full-length sequence. The gene sequences of the primers MMDaV FL/SalI-F, MMDaV FL/KpnI-F and MMDaV FL/KpnI-R are respectively SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3; the complete sequence of MMDaV is shown in SEQ ID NO: and 6.

(3) Cloning of pBinPLUS-MMDaV-PL: the plasmid pEasy T1-MMDaV-PL which had been correctly sequenced was digested with SalI and KpnI restriction enzymes by the digestion and recovery method, and the desired fragment (about 3000 bp) was recovered. The enzyme cutting system is as follows: 25 μ L plasmid, 8 μ L ddH₂O, 1. mu.L SalI, 1. mu.L KpnI, 5. mu.L 10 XBuffer, the final total volume is 40. mu.L, after mixing and short centrifugation, the reaction is carried out for 30-40min at 37 ℃. Meanwhile, the binary plant expression vector pBinPLUS is cut by SalI and KpnI restriction enzymes and purified, and then an MMDaV fragment cut by the SalI and KpnI restriction enzymes is connected with the pBinPLUS by using T4 DNA ligase to obtain pBinPLUS-MMDaV-PL. The connecting system is as follows: 250ng of MMDaV fragment, 1. mu.L of 10 XT 4 ligation buffer, 1. mu. L T4 ligation buffer, 100ng of digested pBinPLUS vector and supplement ddH₂And O to the total volume of 10 mu L, mixing the samples uniformly, centrifuging the mixture for a short time, and reacting the mixture for 30min at the temperature of 22 ℃.

(4) Cloning of pBin-MMDaV 2A: the pEasy T1-MMDaV-FL plasmid with the correct sequence was digested with KpnI restriction enzyme, and the target fragment of about 3000bp was recovered. Simultaneously, cutting the pBinPLUS-MMDaV-PL plasmid by KpnI restriction enzyme, recovering and purifying agarose gel, and connecting the MMDaV fragment which is also cut and recovered by the KpnI restriction enzyme with the pBinPLUS-MMDaV-PL fragment by using T4 DNA ligase, wherein the specific operation system refers to (3); clones containing 2 tandem repeats were selected, plasmids containing 2 tandem repeats were extracted, and the invasive clone of MMDaV constructed in this way was named pBin-MMDaV2A (shown in FIG. 1).

Example 2 pBin-MMDaV2A infectious clone inoculation

The plasmid pBinPLUS-MMDaV 2A is transferred into an agrobacterium strain EHA105 by an electric shock transformation method to obtain agrobacterium containing MMDaV infectious clones. Inoculating agrobacterium containing a mulberry leaf type dwarf-related virus recombinant plant expression vector into an LB culture medium containing kanamycin (50mg/L) and rifampicin (50mg/L) resistance, and performing shake culture at the temperature of 28 ℃ and the rpm of 220 until OD600 is 0.8-1.2; centrifuging at 10000rpm for 5min, discarding the supernatant, and adding 10mM MgCl₂The cells were resuspended in an infiltration buffer containing 10mM MES and 100mM acetosyringone, OD600 was adjusted to 1.2, and the cells were allowed to stand at room temperature for 3 hours to infiltrate the plants. Selecting 4-6 true leaves of the Nicotiana benthamiana, slightly pricking a plurality of small holes on the back of each leaf by using a needle, slowly penetrating and injecting bacterial liquid into the tissue gaps by using a 1mL injector without the needle, and inoculating the plants to be cultured in an isolation greenhouse at 25 ℃.

EXAMPLE 3 infectious assay of pBin-MMDaV2A infectious clones

The inoculated plants were observed for symptoms at regular intervals and the changes caused by the MMDaV infectious clones on the plants were monitored. When the inoculated B.benthamiana was observed under white light and ultraviolet light, it was found that 3 days after the Agrobacterium pBin-MMDaV2A had infiltrated the B.benthamiana, the inoculated leaves exhibited a marked necrotic phenotype (FIGS. 2A and 2B). The leaves of the cultivars were stained with DAB and the leaves inoculated with the MMDaV infectious clone were found to appear visibly brown.

The specific operation is as follows: the inoculated leaves were cut off and placed in a 50mL centrifuge tube, and gently handled. Prepared DAB-HCl solution (1mg/mL, pH 3.8) was added thereto, and the leaves were washed. Standing under light at room temperature for 8 hr while shaking. Pouring out DAB-HCl solution, adding 96% ethanol, boiling for 5-10min until the green color is removed to obtain H₂O₂Position ofThe color will change to brown. After natural cooling, 70% alcohol was added for preservation, and the picture was taken for recording (fig. 2C).

The inoculated plants were tested by PCR to identify their infectivity: PCR detection can be carried out by using primers V4 GW-F and C1C2 GW-F, and the amplification size is about 1500 bp; the gene sequences of the primers V4 GW-F and C1C2 GW-F are SEQ ID NO. 4 and SEQ ID NO. 5 respectively, and the results are shown in figure 3, and specific target bands can be detected by the plant leaves inoculated with the MMDaV infectious clone.

The above results demonstrate that: the constructed MMDaV infectious clone has biological activity, and can quickly activate the defense reaction of plants after infecting Nicotiana benthamiana to cause leaf necrosis.

The above-mentioned embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solution of the present invention by those skilled in the art should fall within the protection scope defined by the claims of the present invention without departing from the spirit of the present invention.

Sequence listing

<110> institute of plant protection of Chinese academy of agricultural sciences

<120> mulberry leaf type dwarf associated virus MMDaV infectious clone vector and construction method and application thereof

<130> DS211-018

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 30

<212> DNA

<213> MMDaV FL/SalI-F(Artificial Sequence)

<400> 1

gggtcgacat ttgacccatt ttgaccatgg 30

<210> 2

<211> 26

<212> DNA

<213> MMDaV FL/KpnI-F(Artificial Sequence)

<400> 2

ggggtaccat ttgacccatt ttgacc 26

<210> 3

<211> 24

<212> DNA

<213> MMDaV FL/KpnI-R(Artificial Sequence)

<400> 3

ggggtaccca ttaccaccag tatg 24

<210> 4

<211> 26

<212> DNA

<213> V4 GW-F(Artificial Sequence)

<400> 4

caccatgttt tcaaggagaa aaaaag 26

<210> 5

<211> 27

<212> DNA

<213> C1C2 GW-F(Artificial Sequence)

<400> 5

caccatggct tcaagttcta acttcag 27

<210> 6

<211> 2952

<212> DNA

<213> Mulberry leaf type dwarf-associated virus (Artificial Sequence)

<400> 6

acagccccct cgcttggtgg cgccacgtgg cgcccgtgga ttggccccga aggggcccac 60

cattaattgc gccgaaggcg caatgtgaac ccgacaaaag gaggcggccg acaaaagaaa 120

aagaaaaaga aaagtaaaaa gaaaaaggga aaagttaaag cagattcgcc gacagttttt 180

aaaagtgggt cccatgaata attattaaag aggttgcttg cgcagcaagg aaccgatgag 240

ctataaatac ccccctgccc caaatatttt taaaatgtct gagtattgcg aacttgccga 300

agacagtaag tactgtacaa cgattttaat tgttcaattt attgttattg ccctagccat 360

tctcagttat gtctttgtgg agtaccaaat taggagagtt gcctcagagc ttgcaaggct 420

gcgtaattat gctagcctgc aagcaattaa tggcaatgga agaccagatt ctggcccaga 480

aaatagacat gagaaccgag accgggttcg agacttcagt ggaccacttg gtccacctta 540

ctcagtgccg tagactgttg agactgataa gacgtttttc tagggtaaag gatcgtgctg 600

cagtaaatgg tgattaccag gagctctgct ctgagatcaa ggcggggatg gaatccagga 660

accattccac ggaggcccag gactgttcga gtcacgcggg ttgcaagtgc catgcgaacc 720

ccgtggagaa gaagaggccc aaggtcgagt ttggcaagaa ggaagagacg gcccataaat 780

gcgttgggcc cagtgaaacg tggcacattt ggaattaaat tagccagtat aaatcatact 840

ggtggtaatg ggtaccattt gacccatttt gaccatgggg atgacacaaa ccaaagaacc 900

ggaagaaaaa taaaaattaa tggaataaac attaggggaa aactgtacct aaataatcct 960

aggactaatt cttatcacat tgtcaggctg tggataatca gggataccag accggggtcg 1020

gaaccggtgt ctttcagctc gttcatggac atgcacgaca acgagccgat gacagcgatg 1080

gtgaagaagg actgggggga acggtttcaa gttctcaagg atctgacctt tcatttagtg 1140

ggagccaatg gtttatcctt caacgaagac gtggtcgagg agtattttaa atttaaggga 1200

tatgttttgt ataatcacga ggattctgga tccttggcaa atgtacttga gaatggcata 1260

tttttgtacg cagcaacttc acatccttct gagaacgtga ctttgactgc taattgtcgt 1320

gtttattttt atgacgcaga ataagtaata aagtttataa ttttttttac agattaagtt 1380

gaatgttttc aaggagaaaa aaagataaaa aggatgccgg aagctctcga cgattggacg 1440

atcatacctc tggatgggag tccccacagt caggaggata tgaatccgga tccgttagat 1500

ctaattatgg tacagatgga agagataatt cacaatctga atttaataga acagagattg 1560

aacgtgcagt tagagctgtt atccctgtta ctgggtcggg agttttgtcc cagccagaac 1620

agtggcaaag acccagtaga tcattacggg aagcacaaca aagagaagaa agacttaaag 1680

aaacgcagag gagattagat gaggaatttg aaaaggttgt tttttcatta ataattttaa 1740

tagaatttat cactagcaga catgtaataa actagtacat tatcatcgaa ccatggttta 1800

agtgtacttg ccatccgtac aacccaatcc atgtcttcat taactaatac aatacaagga 1860

attccgccac taatacgaaa atccttcata tacttgccct taagaataat atctttttga 1920

gcacctaata atgatttaaa ccaagaagta ctaatcttct cgtattcaat atcatctatt 1980

acattatata acgcaaaatc atcataatct aaaaaactta aactaccggt aaaataattg 2040

tgtctcccta aagatctggc ccattgcgtc ttgccggatc tggttggtcc acagatgtag 2100

aggctgatgg gcctgtctgg cttggactcg ggctcctgtt gcacatatat tgttgtggaa 2160

cagttaggcc cacttcccac caaaaatcat catgacatct ataacataaa acagaatcgg 2220

cccattgacg acttacgaat agaatattgt ccttggccca ttgctgaata ggttcaggta 2280

ggcccgggaa gtcagtccac cggggaacgt aaggaatact tcttcggcgg taatggtctc 2340

gagcgaaacc ggtaatcgac ggccatctga gaacgtagtc ctgtggtctt cgttctcgga 2400

caagggcgag gaaggactcc tcgtctgttg ccaaggtaag gatctctcca aagatcttct 2460

cagcgcttgc aacaggactt cgtcctcgtg tattaaattc tccgtgttca atgaagtgac 2520

cctccttctg gatatatttc ctgacggccg ctggtgagga gcacttctgg acattcggat 2580

ggtaggtgcc cgaggagtgt tcctgcggca aatcaaagaa attaggattt cttgtttcta 2640

gttttttgtc caattggaca atagcatgaa aatgactgtt gtcatcttta tgtttttctt 2700

cagcgacaca ggcatacttg actgtgtatg aattaagaat ttggagtaaa tgggacatga 2760

cccaagtaat agattcggga cattgaggga atgtaaggaa aacattctta gcagccaacc 2820

tgaagttaga acttgaagcc atttatagaa gggaaggagt tgaagccgta cgaagaaggg 2880

agagtaaggt tctataggta aggagggagt ggtggcagcg gcaaatgaag cgagggggcc 2940

ttatataata tt 2952