Vibrio parahaemolyticus specific binding polypeptide V2 and application thereof
1. The nucleotide sequence of the polypeptide V2 specifically bound by the vibrio parahaemolyticus is shown as the sequence table SEQ ID NO. 2.
2. The use of the vibrio parahaemolyticus-specifically binding polypeptide V2 of claim 1 in the preparation of a reagent for detecting vibrio parahaemolyticus.
3. A kit for detecting Vibrio parahaemolyticus, comprising: a phage immunomagnetic complex; the phage immune magnetic complex is prepared by the following method:
1) washing streptavidin magnetic beads: shaking the resuspension magnetic beads, transferring 100 mu L of magnetic beads into a reaction tube by using a pipettor, carrying out magnetic separation, and sucking supernatant by using the pipettor; washing with 1m LPBST, shaking for resuspension, magnetically separating, removing supernatant, and washing repeatedly for three times;
2) the immune magnetic compound is synthesized by the following specific operations: taking 100 mu L/tube of washed magnetic beads, discarding the supernatant, adding 4 mu g of biotin modified by polypeptide V2, fixing the volume of the solution to 1mL by PBST, placing the solution on a vertical mixer, mixing the solution at room temperature for 60min in a rotating way, combining streptavidin modified on the magnetic beads and biotin modified on the polypeptide, coupling the polypeptide on the surfaces of the magnetic beads, and obtaining the supernatant by a magnetic separation method;
3) washing the immune magnetic complex: fully shaking and resuspending with 1ml of BST, magnetically separating, removing supernatant, then resuspending the immune magnetic complex with 1ml of BST, repeatedly washing for three times, and storing the obtained immune magnetic complex at 4 ℃ for later use;
the nucleotide sequence of the polypeptide V2 is shown in a sequence table SEQ ID NO. 2.
Technical Field
Vibrio parahaemolyticus is a Vibrio parahaemolyticus, exists in offshore sea water, submarine sediments, marine products such as fishes and shellfishes or salted products, is the most common food-borne pathogenic bacterium in coastal areas of China, and mainly causes acute gastroenteritis and even septicemia. According to the data of the food-borne disease monitoring network in China, the occurrence scale of food poisoning caused by vibrio parahaemolyticus and the exposure scale of people are in a trend of obviously increasing in the last decade, and the food-borne disease monitoring network exceeds salmonella and becomes the primary food-borne pathogenic bacteria in China. Therefore, the rapid and accurate detection of the vibrio parahaemolyticus in the food is strengthened, the food safety monitoring is implemented, and the detection method is necessary for preventing food safety events caused by the vibrio parahaemolyticus.
In recent years, the immunomagnetic bead separation technology is rapidly developed, and the principle is that magnetic beads coated by antibodies are used as carriers and are combined with specific antigens in a reaction medium to form an antigen-antibody complex, and the complex is directionally moved under the action of an external magnetic field, so that the antigens are specifically captured and separated. In the aspect of detection of food-borne pathogenic bacteria, the immunomagnetic bead separation technology effectively combines specificity of antigen-antibody reaction and magnetic field responsiveness of magnetic beads, can realize rapid separation and enrichment of target bacteria from a complex matrix, and can effectively eliminate matrix interference, thereby improving detection efficiency, being an effective sample pretreatment method and having better development and application prospects.
The phage display technology is to display polypeptides with various local three-dimensional space structures and composed of different arranged amino acids on the surface of a phage to form a molecular library, and perform biological elutriation by utilizing the characteristic of specific combination of pathogens and corresponding polypeptides on the phage to obtain the polypeptides capable of specifically identifying the pathogens. The phage specific polypeptide obtained by the method has the advantage of monoclonal antibody specificity, overcomes the defect of tedious preparation of the monoclonal antibody, is short in preparation time, can be prepared in a large amount, and greatly saves time and cost. Therefore, the polypeptide specifically bound by the vibrio parahaemolyticus is screened out and coupled with the magnetic beads to form an immunomagnetic compound, so that the vibrio parahaemolyticus in food can be rapidly enriched and separated, the detection time can be effectively shortened, and the detection accuracy is improved.
Disclosure of Invention
The invention aims to provide a polypeptide specifically bound by vibrio parahaemolyticus in order to quickly enrich and separate the vibrio parahaemolyticus in food, shorten the detection time and improve the detection accuracy.
The nucleotide sequence of the polypeptide specifically bound by the vibrio parahaemolyticus is shown in a sequence table SEQ ID NO.1, 2 or 3.
The application of the polypeptide specifically bound by the vibrio parahaemolyticus in preparing a reagent for detecting the vibrio parahaemolyticus.
A kit for detecting Vibrio parahaemolyticus, comprising: a phage immunomagnetic complex; the phage immune magnetic complex is prepared by the following method:
1. washing streptavidin magnetic beads: shaking the resuspension magnetic beads, transferring 100 mu L of magnetic beads into a reaction tube by using a pipettor, carrying out magnetic separation, and sucking supernatant by using the pipettor; washing with 1m LPBST, shaking for resuspension, magnetically separating, removing supernatant, and washing repeatedly for three times;
2. the immune magnetic compound is synthesized by the following specific operations: taking 100 mu L/tube of washed magnetic beads, removing the supernatant, adding 4 mu g of polypeptide modified biotin, fixing the volume of the solution to 1mL by PBST, placing the solution on a vertical mixer, rotating and mixing the solution at room temperature for 60min, combining the streptavidin modified on the magnetic beads and the biotin modified on the polypeptides, coupling the polypeptides on the surfaces of the magnetic beads, and obtaining the supernatant by a magnetic separation method;
3. washing the immune magnetic complex: fully shaking and resuspending with 1ml of BST, magnetically separating, removing supernatant, then resuspending the immune magnetic complex with 1ml of BST, repeatedly washing for three times, and storing the obtained immune magnetic complex at 4 ℃ for later use;
the nucleotide sequence of the polypeptide is shown in a sequence table SEQ ID NO.1, 2 or 3.
The invention provides a vibrio parahaemolyticus specific binding polypeptide V2 and application thereof, wherein the nucleotide sequence of the polypeptide is shown in a sequence table SEQ ID NO.1, 2 or 3; it has the advantages that: (1) the first report of the preparation of synthetic immunomagnetic compounds from polypeptides specifically bound to Vibrio parahaemolyticus screened by phage display technology at home and abroad; (2) the enrichment efficiency of the immunomagnetic compound provided by the invention is up to 93.52%; (3) the immunomagnetic compound provided by the invention can realize the separation and enrichment of the vibrio parahaemolyticus within 30min, and greatly saves time compared with the traditional culture and enrichment method.
Drawings
FIG. 1 shows the result of ELISA for identifying the affinity between the monoclonal phage corresponding to polypeptide V1-3 and Vibrio parahaemolyticus;
FIG. 2 is the results of the enrichment efficiency of immunomagnetic complexes with three different bacteriophage polypeptides;
FIG. 3 shows the results of the enrichment efficiency of immunomagnetic compound V1 in different amounts;
FIG. 4 shows the results of the enrichment efficiency of immunomagnetic complex V1 at different enrichment times.
Detailed Description
Example 1 main experimental materials:
random heptapeptide phage display library (ph.d.TMPhage Display Libraries) purchased from NEB corporation; streptavidin magnetic beads (BeaverBeads)TMStreptavidin) was purchased from beaver biomedical engineering limited.
Experimental reagent:
low-salt LB medium: 2 g of tryptone, 1 g of yeast extract, 1 g of NaCl and 200 mL of double distilled water, autoclaving and storing at 4 ℃; LB-Tet plates: 2 g of tryptone, 1 g of yeast extract, 1 g of NaCl, 3 g of agar powder and 200 mL of double distilled water, autoclaving, cooling to below 70 ℃, adding 1mL of tetracycline stock solution (10 mg/mL), mixing uniformly, pouring into a flat plate, and storing at 4 ℃ in a dark place; LB/IPTG/Xgal plates: 2 g of tryptone, 1 g of yeast extract, 1 g of NaCl, 3 g of agar powder and 200 mL of double distilled water, autoclaving, cooling to a temperature lower than 70 ℃, adding 1mL of IPTG/Xgal, uniformly mixing, pouring into a flat plate, and storing at 4 ℃ in a dark place; top agar layer: 2 g tryptone, 1 g yeast extract, 1 g NaCl, 0.2 g MgCl2·6H2O, 1.4 g of agar powder and 200 mL of double distilled water, and carrying out autoclaving and storage at 4 ℃; coating liquid: 0.1M NaHCO3(pH 8.6), filtered, sterilized and stored at room temperature; sealing liquid: 0.1M NaHCO3(pH 8.6), 5 mg/ml BSA, filter sterilized,stored at 4 ℃. TBS: 50 mM Tris-HCl (pH 7.5), 150 mM NaCl, autoclaved, and stored at room temperature. TBST: first round of preparation 0.1% [ v/v ]]Tween-20, the second three rounds of preparation of 0.5% (v/v) Tween-20; eluent: 0.2M Gly-HCl (pH 2.2), 0.1% BSA; neutralization buffer: 1M Tris-HCl (pH 9.1); PEG/NaCl; 20% (w/v) PEG-8000, 2.5M NaCl, autoclaving, storing at room temperature; NaI buffer solution: 10 mM Tris-HCl (pH 8.0), 0.1 mM EDTA, 4M NaI.
Example 2 screening and preparation of Vibrio parahaemolyticus-specific binding Polypeptides
Screening of Vibrio parahaemolyticus-specifically binding polypeptide
The method is carried out according to the cycle of adsorption-washing-elution-amplification, and the specific operation is as follows after 3 rounds of screening:
1. get 100 mu L/hole 2X 107 Adding CFU/mL vibrio parahaemolyticus into an enzyme label plate, and coating overnight at 4 ℃;
2. washing the plate for three times by TBST, and taking a 300 mu L/hole closed liquid chamber to be statically placed and closed for 90 min;
3. TBST washing plate six times, diluting phage peptide library to 2X 1010Adding 100 muL/hole into an enzyme label plate, and slightly shaking and combining for 45min at room temperature;
4. washing the plate for ten times by TBST, completely absorbing residual liquid, adding eluent of 100 muL/hole, carrying out light shock elution for 8min at room temperature, immediately transferring the eluent to a centrifuge tube preset with 15 muL of neutralization buffer solution by a liquid transfer device, and uniformly mixing;
5. and (3) determining the titer of the phage: preparing an LB/IPTG/Xgal flat plate for pre-warming at 37 ℃, pre-warming top-layer agar at 3 mL/tube at 49 ℃, diluting the eluted phage by 10 times with LB, subpackaging ER2738 in the middle logarithmic growth period into 200 muL/tube, adding 10 muL phage into each tube, quickly shaking, uniformly mixing, incubating at room temperature for 5min, adding the phage into the top-layer agar, quickly and uniformly mixing, immediately pouring the mixture into the LB/IPTG/Xgal flat plate pre-warmed at 37 ℃, properly inclining the flat plate to uniformly spread the upper-layer agar, after the flat plate is cooled for 5min, inversely placing the flat plate at 37 ℃ for culturing overnight, and counting 10-102Number of spots on the plate of individual plaques. Multiplying the number by a dilution factor to obtain a plaque forming unit (pfu) titer of each 10 mul of phage;
6. phage amplification: adding 80 mu L of the eluted phage into 20 mL ER2738 in the early logarithmic growth stage, performing shake culture at 37 ℃ for 4.5 hours, transferring the culture into a centrifuge tube, centrifuging at 4 ℃ and 10000 rpm for 10min, and transferring the supernatant into a new tube for re-centrifugation. Transferring 80% of the supernatant into a fresh centrifuge tube by using a pipette, adding 1/6 volumes of PEG/NaCl, and precipitating overnight;
7. performing titer determination on the amplified phage so as to facilitate the basis of phage library dilution in the next round of panning process;
steps 1 to 7 were the first round of panning and amplification, the second and third rounds of panning and amplification steps were as above, and the stringency of panning was increased by decreasing the concentration of the target molecule, so that the coating concentration of the second round of Vibrio parahaemolyticus was 1.5X 107 CFU/mL, coating concentration of the third round of Vibrio parahaemolyticus was 1X 107 CFU/mL。
The number of eluted phage and amplified phage in the whole panning process is shown in table 1, and the recovery rate is gradually increased, which indicates that the affinity screening effect is better.
TABLE 1 panning of Vibrio parahaemolyticus-binding phage display polypeptides
Number of wheels
Input quantity (pfu)
Output (pfu)
Recovery rate
1
2ⅹ1010
3.12×104
1.56×10-6
2
2ⅹ1010
2.57×105
1.29×10-5
3
2ⅹ1010
3.70×106
1.85×10-4
EXAMPLE 3 screening of phage clones and determination of polypeptide sequences
Screening of phage clones and determination of displayed polypeptide sequences thereof
After the final panning was completed, the eluates were titered, LB/IPTG/Xgal plates with less than 100 blue plaques were selected, and 10 clones were randomly picked for amplification and identification. The operation process is as follows: performing plaque amplification according to the method, after the first step of centrifugation, transferring 500 mul of phage-containing supernatant into a fresh centrifuge tube, adding 200 mul of PEG/NaCl, reversing and uniformly mixing, and standing at room temperature for 10 min; centrifuging at 4 ℃ and 10000 rpm for 10min, discarding the supernatant, centrifuging for a short time, carefully removing the residual supernatant, thoroughly resuspending the precipitate in 100 mul of iodide buffer solution, and adding 250 mul of ethanol; incubating at room temperature for 10 min; centrifuging at 4 deg.C and 10000 rpm for 10min, and removing supernatant; washing the precipitate with 70% ethanol, and vacuum drying for a short time; the precipitate was resuspended in 30. mu.l of TE buffer and sent to Shanghai Biotech Co., Ltd for sequencing with-96 primers.
TABLE 2 nucleotide and amino acid sequences of phage display polypeptides
SEQ ID NO
Nucleotide sequence
Amino acid sequence
Frequency of appearance (%)
V1
CCAGCAGGCGGAAGCCGCGGCAT
MPRLPPA
44.45
V2
CCCGAAACAACAGTATTCCAATG
HWNTVVS
33.34
V3
CCCGAAGAAACCACCGTCTCCAG
LETVVSS
22.22
Detecting the combination of phage clone to vibrio parahaemolyticus by enzyme-linked immunoassay, which comprises the following steps:
(1) coating: diluting 100 mul/hole of vibrio parahaemolyticus with sterile NaHCO3, and incubating and coating overnight at 4 ℃;
(2) and (3) sealing: washing the plate 6 times with a washing solution TBST (0.05% Tween 20), patting the plate dry with absorbent paper, adding 300 muL/hole of 1% BSA blocking solution, and blocking for 2 hours at 4 ℃;
(3) washing the plate with TBST for 6 times, drying with absorbent paper, and diluting the amplified phage stock solution to 1010 pfu of 100 muL/well, slightly shaking for 1 hour at room temperature, and setting a negative control;
(4) washing the plate 6 times with a washing solution TBST, drying with absorbent paper, adding a horseradish peroxidase-labeled anti-M13 monoclonal antibody diluted at a ratio of 1:1000, and slightly shaking for 1 hour at room temperature;
(5) color development: adding 100 muL/hole of color development liquid, and developing in a dark place at room temperature for 15 min;
(6) and (4) terminating: adding 50 muL/hole of stop solution;
(7) and (3) measuring absorbance: the absorbance of each well at a wavelength of 450nm was measured using a microplate reader.
The result takes P/N > 2.1 as a judgment standard, phage clones corresponding to the three polypeptides are all positive, so the amino acid sequence is sent to Shanghai bioengineering limited company to synthesize the polypeptide with the purity of 95 percent, and biotin is modified.
Example 4 preparation of phage immunomagnetic complexes
1. Washing streptavidin magnetic beads: shaking the resuspension magnetic beads, transferring 100 mu L of magnetic beads into a reaction tube by using a pipettor, carrying out magnetic separation, and sucking supernatant by using the pipettor; washing with 1m LPBST (0.05% Tween20, pH 7.4), shaking thoroughly, resuspending, magnetically separating, removing supernatant, and repeating the washing three times;
2. the immune magnetic compound is synthesized by the following specific operations: taking 100 mu L/tube of washed magnetic beads, removing supernatant, adding 4 mu g of displayed polypeptide, fixing the volume of the solution to 1mL by PBST, placing the solution on a vertical mixer, rotating and mixing the solution at room temperature for 60min, combining streptavidin modified on the magnetic beads and biotin modified on the polypeptide, coupling the polypeptide on the surfaces of the magnetic beads, and obtaining the supernatant by a magnetic separation method;
3. washing the immune magnetic complex: and (3) fully shaking and resuspending the mixture by using 1ml of BST, carrying out magnetic separation, removing supernatant, then resuspending the immune magnetic complex by using 1ml of BST, repeatedly washing the immune magnetic complex for three times, and storing the obtained immune magnetic complex for later use at 4 ℃.
Example 5
The enrichment efficiency of the phage immunomagnetic compound on the vibrio parahaemolyticus is determined by the following specific operations:
(1) determination of the enrichment efficiency of three immunomagnetic complexes: adding bacteria of a vibrio parahaemolyticus monoclonal colony in a high-salt LB culture solution for 2 hours to a logarithmic growth phase, taking 1mL of bacteria solution for 1000-time dilution, adding 100 mul of diluted bacteria solution into a 1.5mL reaction tube, adding 200 mul of prepared immune magnetic compound, respectively adding 700 mul of PBST, and setting a positive control as a simple bacteria solution; placing the reaction tube on a rotary suspension instrument, rotating and mixing for 60min at room temperature, and enriching vibrio parahaemolyticus in the bacterial liquid; after the reaction, the supernatant obtained by magnetic separation was counted on a plate.
The enrichment efficiency of the immunomagnetic compound coupled by the three polypeptides VI, V2 and V3 and the magnetic bead is 93.03 percent, 83.97 percent and 79.79 percent respectively, the enrichment efficiency of the immunomagnetic compound of the polypeptide V1 is the highest, and the condition of enriching the vibrio parahaemolyticus is optimized:
(1) optimizing the dosage of the immune magnetic compound V1: adding bacteria to a vibrio parahaemolyticus monoclonal colony in a high-salt LB culture solution for 2 hours to a logarithmic growth phase, taking 1mL of bacteria solution, diluting by 1000 times, adding 100 mul of the diluted bacteria solution into a 1.5mL reaction tube, respectively adding 100 mul, 200 mul, 300 mul, 400 mul, 500 mul and 600 mul of immune magnetic complex V1, and respectively adding 800 mul, 700 mul, 600 mul, 500 mul, 400 mul and 300 mul PBST to make the system be 1mL, and setting a positive control as the pure bacteria solution; placing the reaction tube on a rotary suspension instrument, rotating and mixing for 60min at room temperature, and enriching vibrio parahaemolyticus in the bacterial liquid; after the reaction, the supernatant obtained by magnetic separation was counted on a plate.
The optimal dosage of the immune complex is 300 mul, namely 300 mug of magnetic beads and 12 mug of polypeptide used in a 1ml reaction system.
(2) Optimization of the enrichment time of immunomagnetic complex V1: adding bacteria to a vibrio parahaemolyticus monoclonal colony in a high-salt LB culture solution for 2 hours to a logarithmic growth phase, taking 1mL of bacteria solution for 1000-time dilution, adding 100 mul of diluted bacteria solution to a 1.5mL reaction tube, adding 300 mul of the prepared immune magnetic compound, and then respectively adding 600 mul of PBST to make a reaction system be 1mL, and setting a blank control; placing the reaction tube on a rotary suspension instrument, respectively rotating and mixing at room temperature for 15min, 30min, 45min, 60min, 90min and 120min, and enriching vibrio parahaemolyticus in the bacterial liquid; after the reaction, the supernatant obtained by magnetic separation was counted on a plate.
The optimal enrichment time is 30 min.
The phage polypeptide immunomagnetic compound prepared by the invention has high enrichment efficiency on vibrio parahaemolyticus and short enrichment time, can realize rapid enrichment and separation of vibrio parahaemolyticus, is a good sample pretreatment method, and lays a foundation for establishing a high-efficiency and simple detection system.
Sequence listing
<110> Jilin university
<120> Vibrio parahaemolyticus-specific binding polypeptide V2 and application thereof
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA
<213> Artificial Synthesis ()
<400> 1
ccagcaggcg gaagccgcgg cat 23
<210> 2
<211> 23
<212> DNA
<213> Artificial Synthesis ()
<400> 2
cccgaaacaa cagtattcca atg 23
<210> 3
<211> 23
<212> DNA
<213> Artificial Synthesis ()
<400> 3
cccgaagaaa ccaccgtctc cag 23
