Use of the ETV4 gene in reprogramming hypertrophic scar fibroblasts.

2. The use according to claim 1, wherein the method of reprogramming hypertrophic scar fibroblasts is:

step 1: taking a fresh human hypertrophic scar specimen, carrying out tissue digestion, and separating to obtain hypertrophic scar fibroblasts;

step 2: connecting a CDS region coding sequence of a human ETV4 gene shown as SEQ ID No.1 to a pCDH plasmid vector to obtain a pCDH-ETV4 overexpression plasmid and amplifying;

and step 3: co-transfecting HEK 293T cells with a target gene ETV4 plasmid, a packaging plasmid psPAX2 and an envelope plasmid pMD2.G, collecting virus supernatant, and concentrating to obtain a lentivirus suspension;

and 4, step 4: and (3) taking the hypertrophic scar fibroblasts obtained in the step (1), culturing to reach the 3 rd generation to obtain P3 generation hypertrophic scar fibroblasts, infecting the cells by using the lentiviral suspension obtained in the step (3) when the cells are fused to 70-80%, and obtaining the hypertrophic scar fibroblasts which are reprogrammed by the ETV4 gene after 72 hours.

3. The use according to claim 2, wherein in step 1, the specific method of tissue digestion is: taking a fresh human hypertrophic scar specimen, cleaning the specimen by using sterile PBS, cutting the specimen into thin strips, putting the thin strips into a neutral protease solution with the mass percent of 0.25%, incubating the sample at 37 ℃ for 2 hours, and separating epidermis from dermis; cutting dermal tissue into paste, adding into 10 times volume of 0.2% type I collagenase solution, placing in a shaker at 37 deg.C, and incubating for 2 hr at a rotation speed of 80-100 rpm.

4. The use of claim 2, wherein in step 1, the separation is performed by filtering with a 70 μm filter, centrifuging for 5min at 300g, adding 5mL of DMEM low-sugar medium containing 10% fetal calf serum for resuspension, inoculating into a cell culture dish, and culturing at 37 deg.C and 5% CO₂Culturing in an incubator.

Background

Hypertrophic scar fibroblasts (HSF for short) are over-activated in the process of wound healing, generate a large amount of extracellular matrix, and excessively deposit the extracellular matrix, which is an important reason for Hypertrophic scar formation. In the scar in the hyperplastic stage, the capability of fibroblast for synthesizing and secreting collagen is enhanced, and especially the content of type I and type III collagen is far higher than that of normal skin. The application of cell biology technology can reverse scar muscle fibroblast to fibroblast or other cells, reduce the generation of I and III collagen, and reshape extracellular matrix, thus opening up a new direction for the treatment of scar. How to regulate the phenotype change of the scar fibroblast is a research hotspot of the current scar treatment.

The ETV4 (collectively called ETS translocation variant 4 in English) gene belongs to the ETS (E26 translocation-specific) transcription factor family, which is also called PEA3 or E1 AF. Currently, ETV4 gene-related studies are mainly focused on their relationship with local invasion and distant metastasis of tumors, such as: over-expression of ETV4 in a less metastatic breast cancer cell, MCF7, resulted in increased invasiveness; knocking down the expression of ETV4 in tumor cells leads to the reduction of tumor invasiveness. However, the correlation between the ETV4 gene and hypertrophic scar fibroblasts is not reported at present.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides application of an ETV4 gene in reprogramming hypertrophic scar fibroblasts.

The technical scheme for solving the technical problems is as follows: application of ETV4 gene in reprogramming hypertrophic scar fibroblast.

The principle of the invention is as follows:

the invention respectively detects the mRNA expression levels in the hypertrophic scar fibroblasts and the normal dermal fibroblasts, and finds that the ETV4 expression in the hypertrophic scar fibroblasts is obviously lower than that of the normal dermal fibroblasts. By constructing ETV4 overexpression lentiviral vector and transfecting human hypertrophic scar fibroblast, the collagen I and III expression of the human hypertrophic scar fibroblast is obviously reduced, and the effect of improving the scar is realized in vitro. Therefore, the ETV4 gene can be used for reprogramming hypertrophic scar fibroblasts, which not only exploits a new application field of the ETV4 gene, but also exploits a new gene for reprogramming hypertrophic scar fibroblasts, and has positive pharmaceutical value and wide social significance.

The invention has the beneficial effects that:

the research shows that the ETV4 gene can be used for reprogramming hypertrophic scar fibroblasts, which not only exploits the new application field of the ETV4 gene, but also exploits the new gene for reprogramming hypertrophic scar fibroblasts, and has positive pharmaceutical value and wide social significance.

On the basis of the technical scheme, the invention can be further improved as follows.

Further, the method of reprogramming hypertrophic scar fibroblasts is:

step 1: taking a fresh human hypertrophic scar specimen, carrying out tissue digestion, and separating to obtain hypertrophic scar fibroblasts;

step 2: connecting a CDS region coding sequence of a human ETV4 gene shown as SEQ ID No.1 to a pCDH plasmid vector to obtain a pCDH-ETV4 overexpression plasmid and amplifying;

and step 3: co-transfecting HEK 293T cells with a target gene ETV4 plasmid, a packaging plasmid psPAX2 and an envelope plasmid pMD2.G, collecting virus supernatant, and concentrating to obtain a lentivirus suspension;

and 4, step 4: and (3) taking the hypertrophic scar fibroblasts obtained in the step (1), culturing to reach the 3 rd generation to obtain P3 generation hypertrophic scar fibroblasts, infecting the cells by using the lentiviral suspension obtained in the step (3) when the cells are fused to 70-80%, and obtaining the hypertrophic scar fibroblasts which are reprogrammed by the ETV4 gene after 72 hours.

The adoption of the further beneficial effects is as follows: by the operation, hypertrophic scar fibroblast with over-expression of ETV4 gene can be obtained.

Furthermore, in step 1, the specific method for tissue digestion is as follows: taking a fresh human hypertrophic scar specimen, cleaning the specimen by using sterile PBS, cutting the specimen into thin strips, putting the thin strips into a neutral protease solution with the mass percent of 0.25%, incubating the sample at 37 ℃ for 2 hours, and separating epidermis from dermis; cutting dermal tissue into paste, adding into 10 times volume of 0.2% type I collagenase solution, placing in a shaker at 37 deg.C, and incubating for 2 hr at a rotation speed of 80-100 rpm.

The adoption of the further beneficial effects is as follows: through the steps, the hypertrophic scar tissue can be digested, so that the scar fibroblast cells in the hypertrophic scar tissue can be further separated.

Further, in step 1, the separation is performed by filtering through a 70 μm filter, centrifuging for 5min at 300g, adding 5mL of DMEM low-sugar medium containing 10% fetal calf serum for resuspension, inoculating into a cell culture dish, and culturing at 37 ℃ with 5% CO₂Culturing in an incubator.

The adoption of the further beneficial effects is as follows: by the method, the primary hypertrophic scar fibroblast with good activity can be obtained, and further experiments can be carried out more easily.

Drawings

FIG. 1 shows the morphology of hypertrophic scar fibroblast cells cultured in primary HSF under an inverted microscope for 48 h.

FIG. 2 shows the morphology of hypertrophic scar fibroblast cells cultured in HSF for 3 generations under an inverted microscope for 48 h.

FIG. 3 shows the position of the ETV4 insertion into the plasmid vector pCDH-CMV-MCS-EF 1-Puro;

FIG. 4 shows agarose electrophoresis patterns of the over-expression plasmid ETV4-PCDH, XbaI and NheI cleavage patterns; wherein, the channel 1 is plasmid DNA; the channel 2 is cut by NdeI/NheI enzyme; channel M is a DNA marker;

FIG. 5 is a photograph of HEK 293T cells transfected by PCDH-ETV4 vector under an inverted fluorescence microscope;

FIG. 6 is a photograph of HSF cells infected with PCDH-ETV4 virus under an inverted fluorescence microscope;

FIG. 7 is a photograph of PCDH virus infected HSF cells under an inverted microscope;

FIG. 8 is a photograph of an inverted microscope showing PCDH-ETV4 virus-infected HSF cells;

FIG. 9 shows the ETV4 gene expression levels of HSF after lentivirus infection

FIG. 10 is the HSF fibrosis associated gene mRNA expression level overexpressing ETV 4;

fig. 11 is the protein expression level of HSF fibrosis-associated gene overexpressing ETV 4.

Detailed Description

The principles and features of this invention are described below in conjunction with the following detailed drawings, which are given by way of illustration only and are not intended to limit the scope of the invention.

Example 1: plasmid construction and cell culture

1.1 isolation and culture of hypertrophic scar fibroblasts

Fresh human hypertrophic scar specimens were collected, and all hypertrophic scars were obtained with approval from the ethical committee of the plastic surgery hospital and informed consent of the patients and the family members was obtained. Cleaning with sterile PBS for 2 times, cutting into strips, adding into 0.25% neutral protease solution, incubating at 37 deg.C for 2 hr, separating epidermis and dermis, and cutting dermis tissue into paste. Adding the cut dermal tissue into 10 times volume of type I collagenase solution with the mass percent of 0.2%, and placing the mixture in a shaker at 37 ℃ for incubation for 2h, wherein the rotating speed is 80rpm-100 rpm. After scar tissue is completely digested (no block tissue is observed), filtering with 70 μm filter screen, centrifuging for 5min at 300g, adding 5mL DMEM low sugar medium containing 10% fetal calf serum for resuspension, inoculating into cell culture dish, and culturing at 37 deg.C with 5% CO₂Culturing in an incubator. The observation under an inverted microscope shows that: after the hypertrophic scar fibroblasts are digested by an enzymolysis method, the cells after primary culture for 48 hours have relatively small shapes, and most of the cells are in a short spindle shape (see figure 1). The average passage time of the cells is about 2-3 days, the cells are cultured until the 3 rd generation cells are relatively large in volume and inconsistent in shape, and part of the cells are irregular triangles or polygons (see figure 2).

1.2 construction of ETV4 overexpression plasmid

The NCBI database was searched to obtain the CDS (coding sequence) region coding sequence of human ETV4 gene, as shown in SEQ ID No. 1.

atggagcggaggatgaaagccggatacttggaccagcaagtgccctacaccttcagcagcaaatcgcccggaaatgggagcttgcgcgaagcgctgatcggcccgctggggaagctcatggacccgggctccctgccgcccctcgactctgaagatctcttccaggatctaagtcacttccaggagacgtggctcgctgaagctcaggtaccagacagtgatgagcagtttgttcctgatttccattcagaaaacctagctttccacagccccaccaccaggatcaagaaggagccccagagtccccgcacagacccggccctgtcctgcagcaggaagccgccactcccctaccaccatggcgagcagtgcctttactccagtgcctatgacccccccagacaaatcgccatcaagtcccctgcccctggtgcccttggacagtcgcccctacagccctttccccgggcagagcaacggaatttcctgagatcctctggcacctcccagccccaccctggccatgggtacctcggggaacatagctccgtcttccagcagcccctggacatttgccactccttcacatctcagggagggggccgggaacccctcccagccccctaccaacaccagctgtcggagccctgcccaccctatccccagcagagctttaagcaagaataccatgatcccctgtatgaacaggcgggccagccagccgtggaccagggtggggtcaatgggcacaggtacccaggggcgggggtggtgatcaaacaggaacagacggacttcgcctacgactcagatgtcaccgggtgcgcatcaatgtacctccacacagagggcttctctgggccctctccaggtgacggggccatgggctatggctatgagaaacctctgcgaccattcccagatgatgtctgcgttgtccctgagaaatttgaaggagacatcaagcaggaaggggtcggtgcatttcgagaggggccgccctaccagcgccggggtgccctgcagctgtggcaatttctggtggccttgctggatgacccaacaaatgcccatttcattgcctggacgggccggggaatggagttcaagctcattgagcctgaggaggtcgccaggctctggggcatccagaagaaccggccagccatgaattacgacaagctgagccgctcgctccgatactattatgagaaaggcatcatgcagaaggtggctggtgagcgttacgtgtacaagtttgtgtgtgagcccgaggccctcttctctttggccttcccggacaatcagcgtccagctctcaaggctgagtttgaccggcctgtcagtgaggaggacacagtccctttgtcccacttggatgagagccccgcctacctcccagagctggctggccccgcccagccatttggccccaagggtggctactcttactag(SEQ ID No.1)。

This sequence was ligated into a pCDH plasmid vector: the vector pCDH-CMV-MCS-EF1-Puro is cut off by using restriction enzymes XbaI and NheI, and then an ETV4 protein coding sequence with XbaI and NheI restriction enzyme sequences synthesized by Protechinaceae is reconnected with the pCDH-CMV-MCS-EF1-Puro vector under the action of DNA ligase (see figure 3), and the constructed plasmid is transformed by the Protechinaceae to provide a cultured PCDH-ETV4 strain.

And (3) plasmid inspection: the constructed plasmid was transformed to obtain a cultured pCDH-ETV4 strain, a small amount of plasmid was obtained by plasmid extraction, digested with restriction enzymes XbaI and NheI, and examined by agarose gel electrophoresis (see FIG. 4).

Example 2: virus-infected cells

2.1 Lentiviral packaging

The target gene ETV4 plasmid, the packaging plasmid psPAX2 and the envelope plasmid pMD2.G were co-transfected into HEK 293T cells by jetPRIME transfection reagent buffer (see figure 5), and high-titer viruses were obtained.

2.2 Lentiviral infection

The mixture is subjected to a reaction with pCDH-ETV4Plasmid-expressing virus and pCDH empty vector plasmid virus infected scar fibroblasts respectively: taking P3 generation cells of hypertrophic scar fibroblast, making into single cell suspension, adjusting density to 1 × 10⁵Perml was plated on 6-well plates. When the cells grow to 70-80%, the multiplicity of infection (MOI) value is taken as 350. Addition of recombinant Lentiviral vectors (1.26X 10) to cells¹⁰pfu/mL). The calculation mode of the added virus volume is as follows: MOI-virus volume (mL) × virus titer (pfu/mL) ÷ cell number(s). Gently shaking the 6-well plate to make the virus liquid fully contact with the cells, and replacing fresh culture medium for 24h to continue culturing. The cells were observed for fluorescent expression under an inverted fluorescence microscope 24h, 48h and 72h after virus infection (see FIG. 6).

Example 3: hyperplastic scar fibroblast fibrosis related gene expression

The control group was HSF infected with the PCDH empty vector plasmid (see FIG. 7), and the experimental group was HSF infected with the PCDH-ETV4 overexpression plasmid (see FIG. 8). The gene expression level of ETV4 in the overexpression group is remarkably increased (see figure 9); after the ETV4 is over-expressed, the mRNA and protein level expression of fibrosis related genes COL1a1, COL3a1 and ACTA2 is significantly down-regulated, and the expression of MMP1 is significantly up-regulated (see fig. 10 and 11).

The specific implementation process is as follows:

3.1 RT-PCR detection of Gene expression of ETV4 in cells after infection with lentivirus

(1) And respectively adding PBS solution into the hyperplastic HSF of the experimental group and the hyperplastic HSF of the control group for washing for 2-3 times, adding 1mL of Trizol after liquid is completely absorbed, standing for 5min at room temperature until the cells are fully cracked, and then blowing the cells by using a pipette gun to make the cells fall off.

(2) Transferring the cell lysate to a 1.5mL centrifuge tube, adding 0.2mL chloroform, tightly covering the EP tube, shaking by turning upside down with hands (without vortex and violent shaking) and mixing for 15s to obtain pink turbid liquid without layering, and standing at room temperature for 15 min.

(3)12000g, 4 ℃, centrifuging for 15min, and then separating the liquid into three layers, wherein the upper layer is a colorless water phase and mainly comprises cellular RNA.

(4) The upper colorless aqueous phase was carefully pipetted and transferred to a new rnase-free Ep tube to avoid the middle white layer and the lower pink organic phase.

(5) To the colorless solution obtained above was added isopropanol of equal volume, mixed by gentle inversion, and allowed to stand at room temperature for 10 min.

(6) After centrifugation at 12000g for 10min at 4 ℃ the supernatant was discarded and 1mL of 75% ethanol was slowly added along the wall of the Ep tube and gently mixed.

(7)12000g, 4 ℃, 5min centrifugation, carefully aspirated supernatant, without touching the bottom white precipitate of EP tube, drying at room temperature, adding 30L-50L RNase Free water to dissolve RNA.

(8) Determination of RNA concentration, OD Using NanoDrop MicroSpectrophotometer_260nmAnd OD_280nmValue of (1) in OD_260nm/OD_280nmAnd when the total RNA reaches the standard at 1.8-2.0, detecting the total RNA concentration of the cells on a computer. After determination of the RNA concentration, the RNA is reverse transcribed into cDNA. GAPDH was used as an internal reference, and a pair of specific primers (Table 1) were designed, and the synthesis of the primers was completed by Shanghai Progestis bioengineering Co.

TABLE 1 genes and primer sequences

The specific sequence PCR amplification operation is as follows:

(1) primer dilution: centrifuging the EP tube containing the upstream and downstream primers at 4000rpm for 4-5min, slowly opening the tube cover, adding DEPC water to dilute to 10 μ M, covering the tube cover, and fully shaking and mixing uniformly for later use.

(2) PCR was performed using cDNA as a template, and 3 replicate wells were used for each group to construct a 20. mu.L total reaction system.

(3)20 μ L reaction: cDNA 1. mu.g, Forward Primer 0.6. mu.L, Reverse Primer 0.6. mu.L, 2 XSSYBER Green Master Mix 10. mu.L, ddH₂And O is supplemented to 20 mu L.

(4) Reaction conditions are as follows: at 95 ℃ for 10 min; 94 ℃, 15s, 60 ℃, 30s, 72 ℃, 45s, 40 cycles.

3.2 RT-PCR detection of the differences in expression of fibrosis-associated genes, such as COL1A1, COL3A1 and ACTA2, in two groups of cells. The specific experimental procedure was the same as in 3.1 above.

3.3 Western blot to detect the expression difference of fibrosis related genes such as COL1A1, COL3A1 and ACTA2 in two groups of cells

(1) Protein extraction

Firstly, the hypertrophic scar fibroblast cells cultured in a 6-well plate are discarded from the culture medium and washed 2 times with precooled PBS.

② after pouring out PBS, adding 100 μ L RIPA lysate (containing 1mM PMSF and protease inhibitor, prepared at present).

And thirdly, gently blowing and beating the cells to ensure that the lysate and the cells are fully contacted for 3-5min, then completely transferring the lysate and the cells into a 1.5mL centrifuge tube, carrying out ice bath for 30min, and gently shaking once every 5 min.

Fourthly, centrifuging for 10min at 4 ℃ and 12000rpm after the ice bath is finished, and collecting the supernatant.

(2) BCA protein quantification

The Biyunnan protein stock solution with the concentration of 25mg/mL is diluted to a protein standard substance with the concentration of 0.5mg/mL by PBS.

Secondly, adding 1 volume of BCA reagent B into 50 volumes of BCA reagent A according to the number of samples, preparing a proper amount of BCA working solution, and fully and uniformly mixing.

③ 0. mu.L, 1. mu.L, 2. mu.L, 4. mu.L, 8. mu.L, 12. mu.L, 16. mu.L and 20. mu.L of the standard substance are added into the standard substance wells of the 96-well plate in sequence, each well is supplemented with PBS to 20. mu.L, which is equivalent to the concentration of the mixed solution in the 96-well plate to be 0mg/mL, 0.025mg/mL, 0.05mg/mL, 0.1mg/mL, 0.2mg/mL, 0.3mg/mL, 0.4mg/mL and 0.5mg/mL respectively.

And fourthly, taking another 4 mu L of the protein supernatant to a 96-well plate, and supplementing the protein supernatant to 20 mu L by PBS.

And fifthly, adding 200 mu L of BCA working solution into each sample protein and standard protein hole, and incubating for 20min at 37 ℃.

Sixthly, measuring absorbance at 562 nm.

And seventhly, drawing a standard curve according to the absorbance of the standard product, and calculating the concentration of the supernatant of the protein of the sample according to a standard curve formula and the used sample volume.

(3) Preparing SDS-PAGE polyacrylamide protein electrophoresis gel:

firstly, selecting a glass rubber plate with the thickness of 1.5mm and a 10-tooth comb as a rubber making model.

② preparing 10 percent separation gel, immediately mixing the gel uniformly, pouring 7.5mL into a fixed gel plate, slightly adding 3mL deionized water above the separation gel, and flattening the surface of the separation gel.

Standing at room temperature for 30min, pouring off deionized water after the separation gel is solidified, and sucking out residual water by using filter paper.

Fourthly, preparing concentrated glue, mixing the concentrated glue evenly, pouring the mixed glue into an upper glue layer of the separation glue, and inserting a 10-tooth electrophoresis comb.

Standing at room temperature for 20min, and removing the electrophoresis comb after the concentrated gel is solidified.

(4) Protein electrophoresis:

taking the same amount (20-40 mu g) of extracted protein, and adjusting the total volume to be consistent by deionized water.

② adding 5xSDS loading buffer, boiling for 5min at 100 ℃, and cooling at room temperature.

And thirdly, pouring the electrophoresis liquid into the protein electrophoresis tank to submerge the rubber plate.

And fourthly, protein loading.

After the sample loading is finished, switching on the power supply, firstly using 80V constant voltage until the sample enters the separation gel, then increasing the voltage to 120V, leading the front-end indicator to completely enter the electrophoresis buffer solution, switching off the power supply, and finishing the electrophoresis.

(5) Rotary film

After electrophoresis, the gel is taken out, put into a cold membrane transferring liquid, soaked for 5min, and simultaneously a PVDF membrane with a proper size is cut according to the size of the gel.

② after activating the PVDF membrane in methanol for 30s, putting the PVDF membrane in a membrane transferring buffer solution.

Thirdly, sequentially laying a spongy cushion, protein glue, a PVDF film and a spongy cushion in the film transferring groove from top to bottom, and then transferring the protein on the glue to the PVDF film by adopting a semi-dry transferring method.

(6) Antibody incubation

Firstly, after the membrane transfer is finished, the membrane is dyed with ponceau red dye solution for 2min, and then the dye solution on the gel is washed away by water.

And secondly, rinsing the PVDF membrane once by using TBST, and then putting the PVDF membrane into 5% skimmed milk powder sealing liquid for sealing for 2 hours at room temperature.

Preparing primary antibody solution according to proper concentration, putting the PVDF membrane into the primary antibody solution, and incubating overnight at 4 ℃.

Fourthly, primary antibody is discarded, and the mixture is washed for 3 times with TBST, 10min each time.

Fifthly, preparing a secondary antibody solution according to a proper concentration, putting the PVDF membrane into the secondary antibody solution, incubating for 2 hours at room temperature, and washing for 10min for 3 times by TBST.

(7) Color development

Firstly, mixing a proper amount of ECL developing solution A and B according to the volume of 1: 1.

And secondly, uniformly dripping the uniformly mixed color development liquid on the surface of the PVDF membrane.

Thirdly, developing in a darkroom, and adjusting the exposure time according to the luminous intensity.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.

Sequence listing

<110> orthopedic hospital of Chinese academy of medical sciences

Application of <120> ETV4 gene in reprogramming hypertrophic scar fibroblast

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1455

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atggagcgga ggatgaaagc cggatacttg gaccagcaag tgccctacac cttcagcagc 60

aaatcgcccg gaaatgggag cttgcgcgaa gcgctgatcg gcccgctggg gaagctcatg 120

gacccgggct ccctgccgcc cctcgactct gaagatctct tccaggatct aagtcacttc 180

caggagacgt ggctcgctga agctcaggta ccagacagtg atgagcagtt tgttcctgat 240

ttccattcag aaaacctagc tttccacagc cccaccacca ggatcaagaa ggagccccag 300

agtccccgca cagacccggc cctgtcctgc agcaggaagc cgccactccc ctaccaccat 360

ggcgagcagt gcctttactc cagtgcctat gaccccccca gacaaatcgc catcaagtcc 420

cctgcccctg gtgcccttgg acagtcgccc ctacagccct ttccccgggc agagcaacgg 480

aatttcctga gatcctctgg cacctcccag ccccaccctg gccatgggta cctcggggaa 540

catagctccg tcttccagca gcccctggac atttgccact ccttcacatc tcagggaggg 600

ggccgggaac ccctcccagc cccctaccaa caccagctgt cggagccctg cccaccctat 660

ccccagcaga gctttaagca agaataccat gatcccctgt atgaacaggc gggccagcca 720

gccgtggacc agggtggggt caatgggcac aggtacccag gggcgggggt ggtgatcaaa 780

caggaacaga cggacttcgc ctacgactca gatgtcaccg ggtgcgcatc aatgtacctc 840

cacacagagg gcttctctgg gccctctcca ggtgacgggg ccatgggcta tggctatgag 900

aaacctctgc gaccattccc agatgatgtc tgcgttgtcc ctgagaaatt tgaaggagac 960

atcaagcagg aaggggtcgg tgcatttcga gaggggccgc cctaccagcg ccggggtgcc 1020

ctgcagctgt ggcaatttct ggtggccttg ctggatgacc caacaaatgc ccatttcatt 1080

gcctggacgg gccggggaat ggagttcaag ctcattgagc ctgaggaggt cgccaggctc 1140

tggggcatcc agaagaaccg gccagccatg aattacgaca agctgagccg ctcgctccga 1200

tactattatg agaaaggcat catgcagaag gtggctggtg agcgttacgt gtacaagttt 1260

gtgtgtgagc ccgaggccct cttctctttg gccttcccgg acaatcagcg tccagctctc 1320

aaggctgagt ttgaccggcc tgtcagtgag gaggacacag tccctttgtc ccacttggat 1380

gagagccccg cctacctccc agagctggct ggccccgccc agccatttgg ccccaagggt 1440

ggctactctt actag 1455

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gggattccct ggacctaaag 20

<210> 3

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ggaacacctc gctctcca 18

<210> 4

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ctggacccca gggtcttc 18

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

catctgatcc agggtttcca 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

aaagcaagtc ctccagcgtt 20

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gcccttccac aatgccaaag 20

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ctgaaagtga ctgggaaacc 20

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gacaaactga gccacatcag 20

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gtctgcgttg tccctgagaa 20

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

agcttgaact ccattccccg 20

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ttgccctcaa cgaccacttt 20

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

tggtccaggg gtcttactcc 20