1. An intestinal fungus Candida metapsilosis M2006B, wherein the strain deposit number of the human intestinal fungus Candida metapsilosis M2006B is GDMCC 61628.

2. Use of the fungus Candida metapsilosis M2006B according to claim 1 for the preparation of a product for the prevention and/or treatment of inflammatory bowel disease.

3. The use according to claim 2, wherein the inflammatory bowel disease is ulcerative colitis or Crohn's disease.

4. Use according to claim 2, wherein the product is a medicament, a functional food or an additive.

5. The use of claim 2, wherein the product further comprises a pharmaceutically acceptable carrier.

6. The use according to any one of claims 2 to 5, wherein the effective amount of the fungus Candida metapsilosis M2006B is 5 x 10⁹CFU/Kg。

Background

Inflammatory Bowel Disease (IBD) is a group of diseases characterized by inflammation of the ileum, rectum, and colon, mainly including Ulcerative Colitis (UC) and Crohn's Disease subtype (CD). The clinical manifestations mainly include persistent diarrhea, abdominal pain, rectal bleeding/hematochezia, weight loss, etc., which seriously affect the quality of life of patients and are easy to recur, and are considered as a lifelong disease. At present, IBD has become a global disease, and particularly, the incidence rate of IBD in developed countries is significantly higher than that in developing countries, and no obvious improvement trend exists. With the obvious changes of people's dietary structure, life style and living environment, the incidence of IBD (1.8/10 ten thousand people) in China is in a continuously and rapidly increasing trend, and has become a common disease of the digestive system. The patients affected by inflammatory bowel disease can timely and reasonably use the medicines such as mesalazine, prednisolone, infliximab and the like to treat the diseases. For refractory inflammatory bowel disease, fecal bacteria transplantation is a leading and effective treatment in cases where drug therapy is ineffective. In recent years, biological treatment protocols based on probiotics have been gaining increasing attention. The probiotic is separated and identified from the human intestinal tract, and is an effective way for preventing and treating inflammatory bowel diseases.

A large number of microorganisms, including bacteria, fungi and the like, are parasitic in the intestinal tract and are closely related to the physiological and pathological processes of the organism. Candida methidosis M2006B, a fungus isolated and identified from human feces, has biological functions, particularly effects on inflammatory bowel disease, not been clearly reported. Therefore, the invention finds the probiotic resources which can be used for preventing and treating the inflammatory bowel disease from the human intestinal fungi by comprehensively using microbiological and pharmacological experimental techniques.

Disclosure of Invention

The invention aims to provide an intestinal fungus Candida metapsilosis M2006B and application thereof, so as to solve the problems in the prior art.

In order to achieve the purpose, the invention provides an intestinal fungus Candida metapsilosis M2006B, wherein the strain deposit number of the fungus Candida metapsilosis M2006B is GDMCC 61628.

The invention also provides application of the fungus Candida metapsilosis M2006B in preparation of a product for preventing and/or treating inflammatory bowel diseases.

Further, the inflammatory bowel disease is ulcerative colitis or crohn's disease.

Further, the product is a medicament, a functional food or an additive.

Further, the product also comprises a pharmaceutically acceptable carrier.

Further, the pharmaceutically acceptable carrier is milk powder, lactose, cyclodextrin, maltose, glucose, glycerol, sodium glutamate, vitamin C, mannose, galactose, mannitol or methyl cellulose.

Further, the effective dose of the enteric fungus Candida metapsilosis M2006B is 5 × 10⁹CFU/Kg。

The invention discloses the following technical effects: the invention separates and identifies an intestinal fungus from a human fecal sample, which is identified as Candida metapsilosis M2006B. According to the invention, the biological activity of the Candida metaplasis M2006B is further evaluated by combining with an animal model of inflammatory bowel disease, so that the Candida metaplasis M2006B can prevent or treat the inflammatory bowel disease by inhibiting colon lesion, inhibiting colon shortening and reducing the expression of inflammatory factors such as IL-1 beta, IL-6, TNF-alpha, INF-gamma and the like; the invention not only defines the important role of Candida metaplasis M2006B in inflammatory bowel disease, but also discloses the wide application prospect of the strain in the prevention and treatment of inflammatory bowel disease.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings needed to be used in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings without inventive exercise.

FIG. 1 is a scanning electron micrograph of Candida metaphysis M2006B;

FIG. 2 is a graph showing the results of a remission treatment of the inflammatory bowel disease phenotype in wild type mice in example 2 with Candida metaplasia M2006B, where A is the change in body weight of the mice, compared to a control group; b is the diarrhea score of the mice; c is rectal bleeding or bloody stool of the mouse;

FIG. 3 shows the effect of Candida metaphysis M2006B on colon lesions in mice with wild-type inflammatory bowel disease in example 2; wherein, A is enteroscope picture, B is colon tissue HE staining section picture;

FIG. 4 is a graph showing the effect of Candida metaphysis M2006B on colon tissue length in mice with wild-type inflammatory bowel disease in example 2;

FIG. 5 shows the expression of IL-1. beta. inflammatory factors, IL-6, TNF-. alpha., INF-. gamma.in colon tissues of mice after colonization by Candida methidosis M2006B in example 2;

FIG. 6 is the body weight, activity index, diarrhea score and rectal bleeding or bloody stool status of mice after colonization with Candida metaplasis M2006B in example 3, wherein A is the change in body weight of the mice; b is the diarrhea score of the mice; c is rectal bleeding or bloody stool of the mouse;

FIG. 7 shows the results of colon length of mice colonized with Candida metaplasis M2006B in example 3, wherein A is a colon photograph and B is data statistics;

FIG. 8 is a photograph of a colon tissue HE stained section of mice after colonization with Candida metaplasis M2006B in example 3;

FIG. 9 shows mRNA expression levels of inflammatory factors IL-1. beta., IL-6, TNF-. alpha., and INF-. gamma.in colon tissue of mice after colonization with Candida metaplasis M2006B in example 3.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

In order to make the aforementioned objects, features and advantages of the present invention comprehensible, embodiments accompanied with figures are described in further detail below.

Example 1 Strain isolation and characterization

Fresh human feces samples were taken, diluted with sterile water in a clean environment, spread on modified Martin agar medium (MTB containing penicillin 100U/mL, streptomycin 100. mu.g/mL), and incubated at a constant temperature of 32 ℃ for 5-10 days. When remarkable fungus colonies are observed, selecting morphologically different colonies, inoculating the colonies on a newly prepared MTB culture medium, continuously culturing for 3 days at the constant temperature of 32 ℃, when monoclonal colonies are observed, selecting monoclonal colonies, further inoculating the monoclonal colonies on the newly prepared MTB culture medium, culturing for 3 days at the constant temperature of 32 ℃ to obtain purified intestinal fungi, wherein the intestinal fungi are white circular colonies and have smooth and flat surfaces (the number is M2006B), selecting bacteria, placing the bacteria in a 25% glycerol aqueous solution, and preserving the strains at the temperature of-80 ℃. Meanwhile, nucleic acid of the isolated strain is extracted through a DNA extraction kit, 18S rRNA gene sequencing analysis is carried out on the isolated strain through RT-PCR by 18S rDNA primers in combination with a sequencing technology, and the species Candida metaphysics (homology 99.4%) is determined by combination with the BLAST comparison of an NCBI nucleic acid database, and FIG. 1 is a scanning electron microscope image of the Candida metaphysics M2006B. The strain of Candida mycoderma M2006B was deposited at 26.4.2021 at Guangdong province of microbial cultures Collection center (accession number: GDMCC NO: 61628, accession number: Zuixianzhizhou 100, Guangzhou, Guangdong province).

Nucleotide sequence of 18S rRNA (SEQ ID NO: 1):

GAAGGGCGCTTACTGCGACCCTTTTCTTTCTACACATGTGTTTTTCTTTTTTTTG AAAACTTTGCTTTGGTGGGCCCACGGCCTGCCAGAGATTAAACTCAACCAAATTTTTTA TTAATTGTCAACTTGATTAACTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCT CGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATATTCGTGA ATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTT GAGCGTCATTTCTCCCTCAAACCTTCGGGTTTGGTGTTGAGCGATACGCTGGGTTTGCT TGAAAGAAAGGCGGAGTATAAACTAATGGATAGGTTTTTTTCTTCCACTCATTGGTACA AACTCCAAACATTCTTCCAAATTCGACCTCAAATCAGGTAGGACTACCCGCTGAACTTA AGCATATCAAAAGGGCGGAGGAA。

example 2 relieving Effect of Candida metaphysis M2006B on inflammatory bowel disease in wild-type mice

Male C57BL/6J mice at 6-8 weeks were acclimatized for 1 week and randomized into four groups (control group, control group + Candida metaphysis M2006B colonization, inflammatory bowel disease modeling group, modeling group + Candida metaphysis M2006B colonization), each group consisting of 6 mice.

On days 1-14, Candida metapsilosis M2006B bacterial suspension (5X 10)⁹CFU/Kg) was administered to mice by gavage (control group + M2006B, mock + M2006B); the control group and the inflammatory bowel disease molding group were each administered with the same volume of sterile physiological saline by intragastric administration.

On days 15-23, four groups of mice were given drinking water containing 2.5% dextran sodium sulfate, resulting in an inflammatory bowel disease model. In the experimental process, the body weight, activity index, diarrhea, hematochezia and rectal bleeding of the mice are recorded, and the result is shown in fig. 2, wherein A is the body weight change of the mice; b is the diarrhea score of the mice; c is the rectal bleeding or bloody stool of the mice. As can be seen from fig. 2, the M2006B colonized mice exhibited a weaker inflammatory bowel disease state compared to the inflammatory bowel disease-causing mice.

On day 23, each group of mice was taken for colonoscopy, and the results are shown in fig. 3A, in comparison with the mice model for inflammatory bowel disease, the mice transplanted with M2006B had smooth colon inner wall, reduced ulcer focus and improved bleeding symptoms. The intestinal tissue is taken for HE staining, and the result is shown in figure 3B, compared with the inflammatory bowel model-building mice, the pathological damage of the colon tissue of the mice planted with M2006B is obviously reduced, the intestinal villus structure is recovered, and the inflammatory cell infiltration is reduced. After 4 groups of mice are sacrificed, colons are cut out and placed on coordinate paper for photographing, and the length of the colons is counted, as shown in fig. 4A and 4B, the colons of the mice planted with M2006B are normal and are obviously longer than that of the mice of the inflammatory bowel disease model group. Taking fresh colon tissues, extracting intestinal tissue proteins, and detecting the expression of the tight junction proteins Occludin and Claudin-2 by a western blot method, wherein the result is shown in figure 4C, the M2006B permanent planting improves the reduction of the expression of the tight junction proteins induced by DSS modeling, which indicates that the colon tissue integrity of mice of M2006B permanent planting groups is better. Fresh colon tissues are taken and stored at the temperature of minus 80 ℃, RNA is extracted by a tissue grinder, and after reverse transcription, the expression conditions of inflammatory factors such as IL-1 beta (figure 5A), IL-6 (figure 5B), TNF-alpha (figure 5C), INF-gamma (figure 5D) and the like are measured by using an RT-PCR technology so as to evaluate the inflammatory reaction conditions of the intestinal tracts of mice. As can be seen from fig. 5, the results show that after M2006B colonizes, the level of inflammation in colon tissue of mice is significantly reduced, and Candida metaphysis M2006B has an improvement effect on the colon inflammatory response of wild-type inflammatory bowel disease mice.

Example 3 relieving Effect of Candida metaphysis M2006B on inflammatory bowel disease in germfree mice

6-8 weeks sterile male C57BL/6J mice were produced by Setarian Biotechnology Ltd, and after 1 week of acclimatization, were randomly divided into two groups (inflammatory bowel disease model building group, model building group + Candida metapsisis M2006B permanent planting), each of which had 6 mice.

On days 1-14, Candida metapsilosis M2006B bacterial suspension (5X 10)⁹CFU/Kg) was administered to mice by gavage (molding + M2006B group); the inflammatory bowel disease molding group was gavaged with the same volume of sterile saline.

On days 15-23, both groups of mice were given drinking water containing 2.5% dextran sodium sulfate, resulting in an inflammatory bowel disease model. During the experiment, mouse body weight, activity index, diarrhea score, hematochezia, and rectal bleeding or bloody stool were recorded. The results are shown in fig. 6, where a is the change in body weight of the mice; b is the diarrhea score of the mice; c is the rectal bleeding or bloody stool of the mice. As can be seen from fig. 6, the M2006B colonized mice exhibited a weaker inflammatory bowel disease state compared to the inflammatory bowel disease-causing mice.

On day 23, after two groups of mice are sacrificed, colons are cut out and placed on a piece of coordinate paper for photographing, and the length of the colons is counted, so that the result shows that the colons of the mice fixedly planted with M2006B are normal and are obviously longer than that of the mice model built with the inflammatory bowel disease (fig. 7, A is a photograph and B is data statistics), and the improving effect of Candida metaphisis M2006B on the length of the colons of the mice with the aseptic inflammatory bowel disease is achieved. Fresh colon tissue is taken and placed in paraformaldehyde fixing solution, paraffin sections are made, and the inflammation condition of the colon tissue is observed under a microscope through HE staining. HE stained sections as shown in fig. 8, compared with the building block (fig. 8A), the colon tissue integrity of the mice of M2006B colonization group (fig. 8B) was better, and no obvious inflammatory infiltration was observed, and the remission effect of Candida metaphysis M2006B on colon lesions of the mice with sterile inflammatory bowel disease was observed. Fresh colon tissues are taken and stored at the temperature of minus 80 ℃, RNA is extracted from partial tissues by a tissue grinder, after reverse transcription, mRNA expression conditions of inflammatory factors such as IL-1 beta (figure 9A), IL-6 (figure 9B), TNF-alpha (figure 9C), INF-gamma (figure 9D) and the like are measured by using an RT-PCR technology, so as to evaluate the inflammatory reaction conditions of the intestinal tracts of mice. The results show that after M2006B colonizes, the level of inflammation of colon tissues of mice is remarkably reduced (figure 9), and Candida metapsilosis M2006B has an improvement effect on colon inflammatory response of sterile inflammatory bowel diseases mice.

Example 4 evaluation of safety of Candida metaphysis M2006B

Male C57BL/6J mice at 6-8 weeks were acclimatized for 1 week and randomized into four groups (control, Candida metaphysisis M2006B permanent planting) of 6 mice each.

Mice of Candida metaplasia M2006B permanent planting group were gavaged with gastric juice every day (5X 10)⁹CFU/Kg); control mice were gazed with the same volume of sterile saline. Body weight, mental status and fecal status were monitored daily, and after 60 days, mice were sacrificed and whole blood was taken for blood testing. The results show that there was no significant difference in body weight, mental status and fecal status between the two groups of mice during the period of bacterial colonization. After 60 days of colonization, there was no significant difference in the blood routine indices of the two groups of mice, including red blood cell, white blood cell, platelet, hemoglobin counts, etc. (table 1). Indicating that Candida metapsilosis M2006B has no toxicity for long-term colonization.

TABLE 1 Effect of Candida metaphysis M2006B on mouse blood conventions

The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.

Sequence listing

<110> university of Dalian medical science

<120> intestinal fungus Candida metapsilosis M2006B and application thereof

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 491

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gaagggcgct tactgcgacc cttttctttc tacacatgtg tttttctttt ttttgaaaac 60

tttgctttgg tgggcccacg gcctgccaga gattaaactc aaccaaattt tttattaatt 120

gtcaacttga ttaactaata gtcaaaactt tcaacaacgg atctcttggt tctcgcatcg 180

atgaagaacg cagcgaaatg cgataagtaa tatgaattgc agatattcgt gaatcatcga 240

atctttgaac gcacattgcg ccctttggta ttccaaaggg catgcctgtt tgagcgtcat 300

ttctccctca aaccttcggg tttggtgttg agcgatacgc tgggtttgct tgaaagaaag 360

gcggagtata aactaatgga taggtttttt tcttccactc attggtacaa actccaaaca 420

ttcttccaaa ttcgacctca aatcaggtag gactacccgc tgaacttaag catatcaaaa 480

gggcggagga a 491