1. The preparation method of the H3N2 and H9N2 subtype avian influenza bivalent chimeric virus-like particle is characterized in that: the method comprises the following steps:

the method comprises the following steps: the protein particle with a hollow structure is formed by self-assembly of Mouse Leukemia Virus (MLV) Gag protein, HA protein of H3N2 subtype avian influenza virus and HA and NA protein of H9N2 subtype avian influenza virus;

step two: nucleotide encoding HA protein of H3N2 subtype avian influenza virus; nucleotide encoding HA protein of H9N2 subtype avian influenza virus; nucleotides encoding Mouse Leukemia Virus (MLV) Gag protein and NA protein of H9N2 subtype avian influenza virus;

step three: the gene of Mouse Leukemia Virus (MLV) Gag protein is connected with NA gene of H9N2 subtype avian influenza virus in series by using ribosome internal entry site for gene synthesis, and the serial gene is named as MgagN 2;

step four: constructing a recombinant baculovirus expressing structural proteins of the avian influenza virus, which specifically comprises the following steps:

designing a primer according to an HA gene of the H3N2 subtype avian influenza virus; designing primers of an HA gene of H9N2 subtype avian influenza virus by the same method, carrying out RT-PCR amplification by utilizing upstream and downstream primer sequences of the HA gene, carrying out enzyme digestion, connection and transformation on the amplified HA gene and a baculovirus vector to obtain an HA gene recombinant baculovirus shuttle plasmid; similarly, the artificially synthesized MgagN2 gene and the baculovirus vector are subjected to enzyme digestion, connection and transformation to obtain a MgagN2 gene recombinant baculovirus shuttle plasmid; respectively transforming the shuttle plasmids into escherichia coli DH10Bac competent cells, and screening to obtain recombinant bacmid; the recombinant bacmid is transfected into Sf9 insect cell by means of liposome mediated transfection to obtain three kinds of recombinant baculovirus, named as: rBV-H3, rBV-H9 and rBV-Mgagn 2;

step five: the preparation and purification of avian influenza VLPs specifically comprise the following steps:

three recombinant baculovirus rBV-H3, rBV-H9 and rBV-MgAGN2 are inoculated to infect Sf9 insect cells, after four structural proteins are expressed and assembled by self, the formed VLPs are secreted into cell culture supernatant, after cell fragments are removed by low-speed centrifugation, purified VLPs are obtained by adopting a discontinuous 40-60% sucrose density gradient centrifugation method.

2. The preparation of the bivalent chimeric virus-like particle of H3N2 and H9N2 subtype avian influenza according to claim 1, wherein: in the fifth step, when three recombinant baculoviruses are inoculated to infect Sf9 insect cells, the volume ratio of the solution containing the recombinant baculoviruses is as follows: rBV-H3 rBV-H9 rBV-MgAGN2 is 1:1: 3.

3. The preparation of the bivalent chimeric virus-like particle of H3N2 and H9N2 subtype avian influenza according to claim 1, wherein: the HA protein is respectively from H3N2 and H9N2 subtype avian influenza virus; the matrix protein is Mouse Leukemia Virus (MLV) Gag protein.

4. The preparation of the bivalent chimeric virus-like particle of H3N2 and H9N2 subtype avian influenza according to claim 1, wherein: the nucleotide sequence of the H3N2 subtype avian influenza virus HA protein is SEQ ID NO. 1:

>SEQIDNO.1

atgaggaccgttattgcattgagctacattctctgcttggcttttggacagaaccttccagggaatgacaacagtacagcaacactatgcctgggacatcatgcagtgccgaatggaacaatagtgaaaacaatcaccgacgatcagattgaggtgaccaatgctactgagctggtccaaagttcctcaacagggaaaatatgcaacaatccccacaagatccttgatggaagagattgcacattaatagatgccatgcttggagatcctcattgtgatgtttttcaagatgagacatgggatctcttcgttgagcgaagcaatgctttcagcaattgttatccttatgatgtaccggattatgcctcccttcgatccttagttgcttcatcaggcacactagaattcattactgaaggtttcacctggacaggagtgagccagaatggaggaagcggtgcctgcaaaaggggacctgccaacggtttcttcggtagattgaactggttgactaagtcagggaactcatacccactgttaaacgtgactatgccaaacaatgataattttgacaagctatacatctggggtgttcaccacccgagtacaaaccaagaacagactaacctgtatgttcaggcctcaggaagagtcacagtctctaccaggagaagtcaacagaccatagtcccgaacattggatctagaccttgggtaaggggtcaatctggaagaataagcatctactggacaatagtcaaacctggagatgtaccggtaatcaatagtaacggaaacctgattgcgcctcggggatacttcaagatccgaactgggaaaagctcaataatgagatcagatgcacctatagagacttgcatctcagaatgcatcactccaaatggaagcatccctaatgacaagccttttcaaaatgtaaacaaaatcacatacggggcatgtcccaaatatgtaaagcaaaataccctaaaattggctacaggaatgaggaatgtgcctgagaagcaaaccagaggtctattcggtgcaatagcagggttcatagagaatggatgggaaggaatgatagatggctggtatggcttcagacaccaaaattctgaaggcacaggacaagcagcagatcttaaaagcacccaagcggccattgaccaaatcaatgggaaattgaacagagtgattgaaaagacgaatgaaaaattccatcagatcgaaaaagaattctccgaggttgaaggaaggattcaagatcttgagaaatatgtcgaagacacaaaggtggacctctggtcttataatgcagagcttcttgttgctctagagaatcagcatacaattgatttgaccgattctgagatgaacaagttatttgaaaaaaccagaaggcaactgagagagaatgctgaagacatgggcaatggttgcttcaaaatatatcacaaatgtgacaatgcctgcatagaatcaattaggaatggaacttatgaccatgacatatatcgagatgaggcactgaacaatcggttccagatcagaggtgtagaactaaaatctggatacaaagactggatcctgtggatttcctttgccatatcatgctttttgctttgtgttgtgttgttggggttcattatgtgggcttgccagcgaggcaacattaggtgcaacatttgcatttga；

the nucleotide sequence of the H9N2 subtype avian influenza virus HA protein is SEQ ID NO. 2:

>SEQIDNO.2

atgggagccgtatcattgataactatgctactagtagcaacagtaagcaatgcagacaaaatctgcatcggataccaatcaacaaactccacagaaactgtagacacactaacagaaaacaatgtccctgtgacacatgccaaagaattgctccacacagagcacaatgggatgctatgtgcaacaaacttgggacatcctcttattctagacacctgtaccattgcaggactaatctatggcaatccttcttgtgatctattgctgggaggaagagaatggtcttacatcgtcgagagaccatcggctgtcaatggattgtgctaccccgggaatgtagaaaatctagaagaactaaggtcacttttcagttctgctagttcttatcaaagaatccagatttttccggacacaatatggaatgtgtcttacagtggaacaagcaaagcatgttcagattcattctacagaagcatgagatggttgacccaaaagaacaacgcttaccctattcaagacgcccaatacacaaataatcgagaaaagaacattcttttcatgtggggtataaatcacccacccaccgagactacacagacagatctgtacacaagaaccgacacaacaacaagtgtggcaacagaagaaataaataggaccttcaaaccattgataggaccaaggcctcttgtcaatggtttgcagggaagaattgattattattggtcggtattgaaaccaggtcaaacactgcgagtaagatccaatgggaatctaatagctccatggtatggacacattctttcaggagagagccacggaagaatcctgaagactgatttgaaaaggggtagctgtacagtgcaatgtcagacagaaaaaggtggcttaaacacaacattgccattccaaaatgtaagtaagtatgcatttggaaactgctcgaaatatgttggagtaaagagtctcaaacttgcagttggtctgaggaatgtgccttctaaatctagtagaggactatttggggccatagctggattcatagagggaggttggtcaggactagttgctggttggtatggattccagcattcaaatgaccaaggggttggtatggcagcagatagagactcaacccaaaaggcaattgataaaataacatccaaagtgaataacatagtcgataaaatgaacaaacagtatgaaattattgatcatgaattcagcgaggttgaaaatagacttaacatgatcaataataagattgatgatcaaattcaagacatatgggcatataacgcagaactgctagtgctacttgaaaaccagaaaacactcgatgagcatgatgcaaatgtaaataatctatataataaagtgaagagggcattgggttccaatgcagtggaagatgggaaaggatgtttcgagctatatcacagatgtgattaccagtgcatggagacaattcggaacgggacctacaacaggaggaaatatcaagaggaatcaaaattagaaaggcagagaatagagggggtcaagctggagtctgaaggaacttacaaaattctcaccatttattcgactgtcgcctcatctcttgtgattgcaatggggtttgctgccttcttgttctgggccatgtccaatgggtcttgcagatgcaacatttgtatataa；

the nucleotide sequences of Mouse Leukemia Virus (MLV) Gag protein and NA protein of H9N2 subtype avian influenza virus are SEQ ID NO. 3:

>SEQIDNO.3

atgggccagactgttaccactcccttaagtttgaccttaggtcactggaaagatgtcgagcggatcgctcacaaccagtcggtagatgtcaagaagagacgttgggttaccttctgctctgcagaatggccaacctttaacgtcggatggccgcgagacggcacctttaaccgagacctcatcacccaggttaagatcaaggtcttttcacctggcccgcatggacacccagaccaggtcccctacatcgtgacctgggaagccttggcttttgacccccctccctgggtcaagccctttgtacaccctaagcctccgcctcctcttcctccatccgccccgtctctcccccttgaacctcctcgttcgaccccgcctcgatcctccctttatccagccctcactccttctctaggcgccaaacctaaacctcaagttctttctgacagtggggggccgctcatcgacctacttacagaagaccccccgccttatagggacccaagaccacccccttccgacagggacggaaatggtggagaagcgacccctgcgggagaggcaccggacccctccccaatggcatctcgcctacgtgggagacgggagccccctgtggccgactccactacctcgcaggcattccccctccgcgcaggaggaaacggacagcttcaatactggccgttctcctcttctgacctttacaactggaaaaataataacccttctttttctgaagatccaggtaaactgacagctctgatcgagtctgttctcatcacccatcagcccacctgggacgactgtcagcagctgttggggactctgctgaccggagaagaaaaacaacgggtgctcttagaggctagaaaggcggtgcggggcgatgatgggcgccccactcaactgcccaatgaagtcgatgccgcttttcccctcgagcgcccagactgggattacaccacccaggcaggtaggaaccacctagtccactatcgccagttgctcctagcgggtctccaaaacgcgggcagaagccccaccaatttggccaaggtaaaaggaataacacaagggcccaatgagtctccctcggccttcctagagagacttaaggaagcctatcgcaggtacactccttatgaccctgaggacccagggcaagaaactaatgtgtctatgtctttcatttggcagtctgccccagacattgggagaaagttagagaggttagaagatttaaaaaacaagacgcttggagatttggttagagaggcagaaaagatctttaataaacgagaaaccccggaagaaagagaggaacgtatcaggagagaaacagaggaaaaagaagaacgccgtaggacagaggatgagcagaaagagaaagaaagagatcgtaggagacatagagagatgagcaagctattggccactgtcgttagtggacagaaacaggatagacagggaggagaacgaaggaggtcccaactcgatcgcgaccagtgtgcctactgcaaagaaaaggggcactgggctaaagattgtcccaagaaaccacgaggacctcggggaccaagaccccagacctccctcctgaccctagatgactag；

the sequences of the upstream primer and the downstream primer of the HA gene of the H3N2 subtype avian influenza virus are SEQ ID NO.4 and SEQ ID NO. 5:

>SEQIDNO.4

cggatccatgagtcttctgacc；

>SEQIDNO.5

gctctagatcacttgaaccgctg；

the sequences of the upstream primer and the downstream primer of the HA gene of the H9N2 subtype avian influenza virus are SEQ ID NO.6 and SEQ ID NO.7 respectively:

>SEQIDNO.6

cggatccatgaagacaaccatt；

>SEQIDNO.7

ccaagcttctatcagtttactcaaatg。

Background

Avian influenza is an acute infectious disease of avian caused by influenza virus type a of the family orthomyxoviridae, and the main host of the pathogenic avian influenza virus is poultry, and can also infect mammals and humans. The disease is widely spread all over the world since the first outbreak in italy in 1878, and brings great harm to the breeding industry. Vaccination is the most effective means of preventing influenza virus infection. At present, commercial avian influenza vaccines are all inactivated vaccines or virus vector vaccines, and play a good role in preventing and controlling avian influenza. However, these vaccines rely on chick embryos for production, and have disadvantages such as insufficient supply of chick embryos during outbreaks of epidemic diseases, generation of large amounts of waste products causing environmental pollution, contamination with endogenous viruses, and the like. In addition, inactivated vaccines can induce only humoral immunity, but not cellular immunity. Therefore, a safe and efficient avian influenza vaccine needs to be developed by using a new technology so as to meet the requirements of disease prevention and control in the modern poultry breeding industry.

Virus-like particles (VLPs) are highly structured hollow protein particles formed by self-assembly of one or more structural proteins of a certain virus, do not contain viral nucleic acid, cannot replicate autonomously, do not have the possibility of gene recombination or reassortment and virulence recovery, have high safety, are similar to natural virus particles in morphology, can be presented to immune cells in a form close to a real conformation through the same way as virus infection, and are more easily recognized by the immune system of the body, thereby effectively inducing the body to generate immune protective response.

VLP technology is a promising approach to construct novel vaccines, diagnostic tools and gene therapy vectors. Analysis of the data published by zetins (2013) shows that there are currently at least 110 VLPs constructed from 35 different families of viruses. The VLP can be prepared based on five expression systems such as escherichia coli, yeast, mammalian cells, plant cells and insect baculovirus, wherein the insect baculovirus expression system is widely applied to the production of VLP of various viruses due to the advantages of high expression level, eukaryotic processing property, suitability for large-scale production and the like, and the types of VLP prepared by the insect baculovirus expression system account for more than 30 percent. As a promising vaccine candidate, influenza VLPs have been shown to be able to induce both cellular and humoral immunity, as well as to activate innate immunity.

Disclosure of Invention

This section is for the purpose of summarizing some aspects of embodiments of the invention and to briefly introduce some preferred embodiments. In this section, as well as in the abstract and the title of the invention of this application, simplifications or omissions may be made to avoid obscuring the purpose of the section, the abstract and the title, and such simplifications or omissions are not intended to limit the scope of the invention.

The invention aims to provide preparation of H3N2 and H9N2 subtype avian influenza bivalent chimeric virus-like particles, and HA protein of H3N2 subtype avian influenza virus and HA and NA protein of H9N2 subtype avian influenza virus are simultaneously displayed on the surfaces of VLPs prepared by the method, so that the prepared avian influenza VLPs can prevent H3N2 subtype avian influenza and H9N2 subtype avian influenza, and technical guarantee is provided for the prevention and control requirements of H3N2 and H9N2 subtype avian influenza. In addition, the chimeric avian influenza VLPs can lay a good foundation for the development of related novel avian influenza vaccines.

To solve the above technical problem, according to an aspect of the present invention, the present invention provides the following technical solutions:

the preparation of bivalent chimeric virus-like particles of H3N2 and H9N2 subtype avian influenza comprises the following steps:

the method comprises the following steps: the protein particle with a hollow structure is formed by self-assembly of Mouse Leukemia Virus (MLV) Gag protein, HA protein of H3N2 subtype avian influenza virus and HA and NA protein of H9N2 subtype avian influenza virus;

step two: nucleotide encoding HA protein of H3N2 subtype avian influenza virus; nucleotide encoding HA protein of H9N2 subtype avian influenza virus; nucleotides encoding Mouse Leukemia Virus (MLV) Gag protein and NA protein of H9N2 subtype avian influenza virus;

step three: the gene of Mouse Leukemia Virus (MLV) Gag protein is connected with NA gene of H9N2 subtype avian influenza virus in series by using ribosome internal entry site for gene synthesis, and the serial gene is named as MgagN 2;

step four: constructing a recombinant baculovirus expressing structural proteins of the avian influenza virus, which specifically comprises the following steps:

designing a primer according to an HA gene of the H3N2 subtype avian influenza virus; designing primers of an HA gene of H9N2 subtype avian influenza virus by the same method, carrying out RT-PCR amplification by utilizing upstream and downstream primer sequences of the HA gene, carrying out enzyme digestion, connection and transformation on the amplified HA gene and a baculovirus vector to obtain an HA gene recombinant baculovirus shuttle plasmid; similarly, the artificially synthesized MgagN2 gene and the baculovirus vector are subjected to enzyme digestion, connection and transformation to obtain a MgagN2 gene recombinant baculovirus shuttle plasmid; respectively transforming the shuttle plasmids into escherichia coli DH10Bac competent cells, and screening to obtain recombinant bacmid; the recombinant bacmid is transfected into Sf9 insect cell by means of liposome mediated transfection to obtain three kinds of recombinant baculovirus, named as: rBV-H3, rBV-H9 and rBV-Mgagn 2;

step five: the preparation and purification of avian influenza VLPs specifically comprise the following steps:

three recombinant baculovirus rBV-H3, rBV-H9 and rBV-MgAGN2 are inoculated to infect Sf9 insect cells, after four structural proteins are expressed and assembled by self, the formed VLPs are secreted into cell culture supernatant, after cell fragments are removed by low-speed centrifugation, purified VLPs are obtained by adopting a discontinuous 40-60% sucrose density gradient centrifugation method.

As a preferred embodiment of the preparation of the bivalent chimeric virus-like particle of H3N2 and H9N2 subtype avian influenza, the invention provides: in the fifth step, when three recombinant baculoviruses are inoculated to infect Sf9 insect cells, the volume ratio of the solution containing the recombinant baculoviruses is as follows: rBV-H3 rBV-H9 rBV-MgAGN2 is 1:1: 3.

As a preferred embodiment of the preparation of the bivalent chimeric virus-like particle of H3N2 and H9N2 subtype avian influenza, the invention provides: the HA protein is respectively from H3N2 and H9N2 subtype avian influenza virus; the matrix protein is Mouse Leukemia Virus (MLV) Gag protein.

As a preferred embodiment of the preparation of the bivalent chimeric virus-like particle of H3N2 and H9N2 subtype avian influenza, the invention provides: the nucleotide sequence of the H3N2 subtype avian influenza virus HA protein is SEQ ID NO. 1:

>SEQIDNO.1

atgaggaccgttattgcattgagctacattctctgcttggcttttggacagaaccttccagggaatgacaacagtacagcaacactatgcctgggacatcatgcagtgccgaatggaacaatagtgaaaacaatcaccgacgatcagattgaggtgaccaatgctactgagctggtccaaagttcctcaacagggaaaatatgcaacaatccccacaagatccttgatggaagagattgcacattaatagatgccatgcttggagatcctcattgtgatgtttttcaagatgagacatgggatctcttcgttgagcgaagcaatgctttcagcaattgttatccttatgatgtaccggattatgcctcccttcgatccttagttgcttcatcaggcacactagaattcattactgaaggtttcacctggacaggagtgagccagaatggaggaagcggtgcctgcaaaaggggacctgccaacggtttcttcggtagattgaactggttgactaagtcagggaactcatacccactgttaaacgtgactatgccaaacaatgataattttgacaagctatacatctggggtgttcaccacccgagtacaaaccaagaacagactaacctgtatgttcaggcctcaggaagagtcacagtctctaccaggagaagtcaacagaccatagtcccgaacattggatctagaccttgggtaaggggtcaatctggaagaataagcatctactggacaatagtcaaacctggagatgtaccggtaatcaatagtaacggaaacctgattgcgcctcggggatacttcaagatccgaactgggaaaagctcaataatgagatcagatgcacctatagagacttgcatctcagaatgcatcactccaaatggaagcatccctaatgacaagccttttcaaaatgtaaacaaaatcacatacggggcatgtcccaaatatgtaaagcaaaataccctaaaattggctacaggaatgaggaatgtgcctgagaagcaaaccagaggtctattcggtgcaatagcagggttcatagagaatggatgggaaggaatgatagatggctggtatggcttcagacaccaaaattctgaaggcacaggacaagcagcagatcttaaaagcacccaagcggccattgaccaaatcaatgggaaattgaacagagtgattgaaaagacgaatgaaaaattccatcagatcgaaaaagaattctccgaggttgaaggaaggattcaagatcttgagaaatatgtcgaagacacaaaggtggacctctggtcttataatgcagagcttcttgttgctctagagaatcagcatacaattgatttgaccgattctgagatgaacaagttatttgaaaaaaccagaaggcaactgagagagaatgctgaagacatgggcaatggttgcttcaaaatatatcacaaatgtgacaatgcctgcatagaatcaattaggaatggaacttatgaccatgacatatatcgagatgaggcactgaacaatcggttccagatcagaggtgtagaactaaaatctggatacaaagactggatcctgtggatttcctttgccatatcatgctttttgctttgtgttgtgttgttggggttcattatgtgggcttgccagcgaggcaacattaggtgcaacatttgcatttga；

the nucleotide sequence of the H9N2 subtype avian influenza virus HA protein is SEQ ID NO. 2:

>SEQIDNO.2

atgggagccgtatcattgataactatgctactagtagcaacagtaagcaatgcagacaaaatctgcatcggataccaatcaacaaactccacagaaactgtagacacactaacagaaaacaatgtccctgtgacacatgccaaagaattgctccacacagagcacaatgggatgctatgtgcaacaaacttgggacatcctcttattctagacacctgtaccattgcaggactaatctatggcaatccttcttgtgatctattgctgggaggaagagaatggtcttacatcgtcgagagaccatcggctgtcaatggattgtgctaccccgggaatgtagaaaatctagaagaactaaggtcacttttcagttctgctagttcttatcaaagaatccagatttttccggacacaatatggaatgtgtcttacagtggaacaagcaaagcatgttcagattcattctacagaagcatgagatggttgacccaaaagaacaacgcttaccctattcaagacgcccaatacacaaataatcgagaaaagaacattcttttcatgtggggtataaatcacccacccaccgagactacacagacagatctgtacacaagaaccgacacaacaacaagtgtggcaacagaagaaataaataggaccttcaaaccattgataggaccaaggcctcttgtcaatggtttgcagggaagaattgattattattggtcggtattgaaaccaggtcaaacactgcgagtaagatccaatgggaatctaatagctccatggtatggacacattctttcaggagagagccacggaagaatcctgaagactgatttgaaaaggggtagctgtacagtgcaatgtcagacagaaaaaggtggcttaaacacaacattgccattccaaaatgtaagtaagtatgcatttggaaactgctcgaaatatgttggagtaaagagtctcaaacttgcagttggtctgaggaatgtgccttctaaatctagtagaggactatttggggccatagctggattcatagagggaggttggtcaggactagttgctggttggtatggattccagcattcaaatgaccaaggggttggtatggcagcagatagagactcaacccaaaaggcaattgataaaataacatccaaagtgaataacatagtcgataaaatgaacaaacagtatgaaattattgatcatgaattcagcgaggttgaaaatagacttaacatgatcaataataagattgatgatcaaattcaagacatatgggcatataacgcagaactgctagtgctacttgaaaaccagaaaacactcgatgagcatgatgcaaatgtaaataatctatataataaagtgaagagggcattgggttccaatgcagtggaagatgggaaaggatgtttcgagctatatcacagatgtgattaccagtgcatggagacaattcggaacgggacctacaacaggaggaaatatcaagaggaatcaaaattagaaaggcagagaatagagggggtcaagctggagtctgaaggaacttacaaaattctcaccatttattcgactgtcgcctcatctcttgtgattgcaatggggtttgctgccttcttgttctgggccatgtccaatgggtcttgcagatgcaacatttgtatataa；

the nucleotide sequences of Mouse Leukemia Virus (MLV) Gag protein and NA protein of H9N2 subtype avian influenza virus are SEQ ID NO. 3:

>SEQIDNO.3

atgggccagactgttaccactcccttaagtttgaccttaggtcactggaaagatgtcgagcggatcgctcacaaccagtcggtagatgtcaagaagagacgttgggttaccttctgctctgcagaatggccaacctttaacgtcggatggccgcgagacggcacctttaaccgagacctcatcacccaggttaagatcaaggtcttttcacctggcccgcatggacacccagaccaggtcccctacatcgtgacctgggaagccttggcttttgacccccctccctgggtcaagccctttgtacaccctaagcctccgcctcctcttcctccatccgccccgtctctcccccttgaacctcctcgttcgaccccgcctcgatcctccctttatccagccctcactccttctctaggcgccaaacctaaacctcaagttctttctgacagtggggggccgctcatcgacctacttacagaagaccccccgccttatagggacccaagaccacccccttccgacagggacggaaatggtggagaagcgacccctgcgggagaggcaccggacccctccccaatggcatctcgcctacgtgggagacgggagccccctgtggccgactccactacctcgcaggcattccccctccgcgcaggaggaaacggacagcttcaatactggccgttctcctcttctgacctttacaactggaaaaataataacccttctttttctgaagatccaggtaaactgacagctctgatcgagtctgttctcatcacccatcagcccacctgggacgactgtcagcagctgttggggactctgctgaccggagaagaaaaacaacgggtgctcttagaggctagaaaggcggtgcggggcgatgatgggcgccccactcaactgcccaatgaagtcgatgccgcttttcccctcgagcgcccagactgggattacaccacccaggcaggtaggaaccacctagtccactatcgccagttgctcctagcgggtctccaaaacgcgggcagaagccccaccaatttggccaaggtaaaaggaataacacaagggcccaatgagtctccctcggccttcctagagagacttaaggaagcctatcgcaggtacactccttatgaccctgaggacccagggcaagaaactaatgtgtctatgtctttcatttggcagtctgccccagacattgggagaaagttagagaggttagaagatttaaaaaacaagacgcttggagatttggttagagaggcagaaaagatctttaataaacgagaaaccccggaagaaagagaggaacgtatcaggagagaaacagaggaaaaagaagaacgccgtaggacagaggatgagcagaaagagaaagaaagagatcgtaggagacatagagagatgagcaagctattggccactgtcgttagtggacagaaacaggatagacagggaggagaacgaaggaggtcccaactcgatcgcgaccagtgtgcctactgcaaagaaaaggggcactgggctaaagattgtcccaagaaaccacgaggacctcggggaccaagaccccagacctccctcctgaccctagatgactag；

the sequences of the upstream primer and the downstream primer of the HA gene of the H3N2 subtype avian influenza virus are SEQ ID NO.4 and SEQ ID NO. 5:

>SEQIDNO.4

cggatccatgagtcttctgacc；

>SEQIDNO.5

gctctagatcacttgaaccgctg；

the sequences of the upstream primer and the downstream primer of the HA gene of the H9N2 subtype avian influenza virus are SEQ ID NO.6 and SEQ ID NO.7 respectively:

>SEQIDNO.6

cggatccatgaagacaaccatt；

>SEQIDNO.7

ccaagcttctatcagtttactcaaatg。

compared with the prior art, the invention has the beneficial effects that: the baculovirus is used as an expression vector, the Sf9 cell is used as a bioreactor, the prepared avian influenza VLPs have the advantages of high yield, good immunogenicity, convenience for large-scale production and the like, animal experiments prove that the vaccine has good immune protection effect on H3N2 subtype avian influenza and H9N2 subtype avian influenza, and a foundation is laid for the development of novel H3N2 and H9N2 subtype avian influenza vaccines.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the present invention will be described in detail with reference to the accompanying drawings and detailed embodiments, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings without inventive exercise. Wherein:

FIG. 1 is a schematic diagram showing the gene tandem connection of MgagN2, i.e., the tandem connection of the Mouse Leukemia Virus (MLV) Gag protein gene with the NA gene of H9N2 subtype avian influenza virus by using the Internal Ribosome Entry Site (IRES);

FIG. 2 is the RT-PCR amplification electrophoresis diagram of avian influenza virus HA gene. Lane 1 is the Trans2K DNA molecular weight standard; lane 2 is the PCR result (1683bp) of the HA gene of H9N2 subtype avian influenza virus; lane 3 is the PCR result (1701bp) of the HA gene of H3N2 subtype avian influenza virus;

FIG. 3 is an electrophoresis chart of the restriction enzyme identification of the shuttle plasmid. Lane 1 is the Trans2K plus DNA molecular weight standard; lane 2 shows the cleavage result (3500bp) of the shuttle plasmid pFastBac1-MgagN 2; lane 3 shows the cleavage result (1683bp) of the shuttle plasmid pFastBac 1-H9; lane 4 shows the cleavage result (1701bp) of the shuttle plasmid pFastBac 1-H3;

FIG. 4 shows the result of PCR identification of recombinant bacmids. Lane 1 is the Trans2K plus DNA molecular weight standard; lane 2 is the PCR identification of rBacmid-MgagN 2; lane 3 is the PCR identification of rBacmid-H9; lane 4 is the PCR identification of rBacmid-H3;

FIG. 5 is a schematic representation of normal Sf9 cells transfected with recombinant bacmid to produce diseased Sf9 cells. (A) Normal Sf9 cells; (B) the recombinant bacmid-Mgagn2 bacmid transfected Sf9 cells with lesions; (C) sf9 cells with lesions after rBacmid-H9 recombinant bacmid-transfection; (D) sf9 cells with lesions after rBacmid-H3 recombinant bacmid-transfection;

FIG. 6 shows PCR identification of baculovirus genomes. Lane 1 is the Trans2K plus DNA molecular weight standard; lane 2 is the PCR identification of rBV-MgagN 2; lane 3 is the PCR identification of rBV-H9; lane 4 is the PCR identification of rBV-H3;

FIG. 7 shows the Western blot identification results of recombinant baculovirus protein expression. Lane M is protein standard molecular mass; lane 1 shows Gag protein identification; lane 2 is the result of identifying HA protein of H9N2 subtype avian influenza virus; lane 3 is the NA protein identification result of H9N2 subtype avian influenza virus; lane 4 is the result of identifying HA protein of H3N2 subtype avian influenza virus;

FIG. 8 is a graph of hemagglutination results for bivalent chimeric avian influenza VLPs;

FIG. 9 shows the Western blot identification of bivalent chimeric avian influenza VLPs. Lane 1 is protein standard molecular mass; lane 2 is the identification results of HA protein (63.4kDa) of H9N2 subtype avian influenza virus, HA protein (63kDa) of H3N2 subtype avian influenza virus and Gag and NA tandem expression protein (54 kDa);

FIG. 10 is a transmission electron micrograph of bivalent chimeric avian influenza VLPs;

FIG. 11 shows the results of the depletion rule of the antibody titer of serum HI from immunized chickens with bivalent chimeric avian influenza VLPs; (A) is a H9N2 subtype avian influenza HI result after immunization; (B) is a H3N2 subtype avian influenza HI result after immunization;

FIG. 12 shows the results of lymphocyte proliferation. (A) The result is that the H9N2 subtype avian influenza virus stimulates the lymphocyte proliferation after immunization; (B) the result is that the H3N2 subtype avian influenza virus stimulates the lymphocyte proliferation after immunization;

FIG. 13 shows the chicken weight gain after immune challenge with bivalent chimeric avian influenza VLPs. (A) The growth rate of the weight of the chicken after the H9N2 subtype avian influenza virus is attacked; (B) the growth rate of the weight of the chicken after the H3N2 subtype avian influenza virus is attacked;

FIG. 14 is a group of experimental animals;

FIG. 15 is the in vitro detoxification test of H9N2 subtype avian influenza virus after immune challenge with bivalent chimeric avian influenza VLPs;

FIG. 16 is the in vitro detoxification test of H3N2 subtype avian influenza virus after immune challenge with bivalent chimeric avian influenza VLPs;

FIG. 17 is the distribution of H9N2 subtype avian influenza virus in vivo following immune challenge with bivalent chimeric avian influenza VLPs;

FIG. 18 shows the distribution of H3N2 subtype avian influenza virus in vivo after immune challenge with bivalent chimeric avian influenza VLPs.

Detailed Description

In order to make the aforementioned objects, features and advantages of the present invention comprehensible, embodiments accompanied with figures are described in detail below.

In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention, but the present invention may be practiced in other ways than those specifically described herein, and it will be apparent to those of ordinary skill in the art that the present invention may be practiced without departing from the spirit and scope of the present invention, and therefore the present invention is not limited to the specific embodiments disclosed below.

In order to make the objects, technical solutions and advantages of the present invention more apparent, embodiments of the present invention will be described in detail with reference to the accompanying drawings.

Example 1

(1) Construction of shuttle plasmid

Firstly, extracting genome RNA of the avian influenza virus, and performing reverse transcription to obtain cDNA;

secondly, designing a primer, and performing PCR amplification by taking the cDNA prepared in the first step as a template to obtain the HA gene of the H3N2 subtype avian influenza virus and the HA gene of the H9N2 subtype avian influenza virus, wherein the PCR amplification result is shown in figure 2, wherein the primer sequence specifically comprises:

H3F(SEQIDNO.4)：5’-cggatccatgaggaccgttattgcattgagc-3’

H3R(SEQIDNO.5)：5’-aaagctttcaaatgcaaatgttgcacct-3’

H9F(SEQIDNO.6)：5’-cggatcccatgggagccgtatcattgataac-3’

H9R(SEQIDNO.7)：5’-cctctagattatatacaaatgttgcatctgc-3’

wherein: the underlined sections are the cleavage sites. Wherein GGATCC is BamH I site, TCTAGA is Xba I site, and AAGCTT is Hind III site.

Thirdly, the target gene is cut, connected and transformed

And recovering the HA gene of the target fragment H3N2 subtype avian influenza virus and the HA gene of the H9N2 subtype avian influenza virus by using the glue, wherein enzyme cutting sites at two ends of the HA gene of the H3N2 subtype avian influenza virus are BamH I and Xba I, and enzyme cutting sites at two ends of the HA gene of the H9N2 subtype avian influenza virus are BamH I and Hind III. Cloning the plasmid into a baculovirus shuttle plasmid pFastBac1 after enzyme digestion, transforming competent Escherichia coli DH5 alpha, picking a single colony to shake bacteria overnight, extracting the plasmid and carrying out double enzyme digestion identification on the plasmid, wherein the double enzyme digestion identification result is shown in figure 3, and the correctly identified plasmids are named as pFastBac1-H3 and pFastBac 1-H9.

Fourthly, after the artificially synthesized MgagN2 sequence is cut by Sal I and Hind III enzyme, the artificially synthesized MgagN2 sequence is cloned into a baculovirus shuttle plasmid pFastBac1 cut by the same enzyme, the baculovirus shuttle plasmid pFastBac1 is transformed into escherichia coli DH5 alpha competence, a positive clone is selected, and the correctly identified plasmid is named as pFastBac1-MgagN2 through PCR and enzyme digestion identification.

(2) Construction of recombinant bacmids

Transforming the shuttle plasmids pFastBac1-H3, pFastBac1-H9 and pFastBac1-MgagN2 constructed in the step (1) into escherichia coli DH10Bac competent cells, carrying out resistance screening, and finally constructing to obtain recombinant bacmid-H3, rBacmid-H9 and rBacmid-MgagN2, wherein the specific process is as follows:

transforming the shuttle plasmids pFastBac1-H3, pFastBac1-H9 and pFastBac1-Mgag N2 constructed in the step (1) into escherichia coli DH10Bac competent cells, and gently mixing the cells; placed on ice for 30 minutes, followed by a 42 ℃ heat bath for 90 seconds, and then the non-resistant medium is added immediately; shaking culture in 30 deg.C incubator for 3h, spreading 100 μ L of transformation solution on solid culture medium containing kanamycin (100 μ g/mL), gentamicin (50 μ g/mL), tetracycline (70 μ g/mL), IPTG (24mg/mL) and X-gal solution (20mg/mL), culturing at 37 deg.C for 48h, picking white single colony, culturing overnight, extracting bacmid and performing PCR identification, the result of PCR identification is shown in FIG. 4. The PCR identification was carried out to obtain recombinant bacmid-H3, rBacmid-H9 and rBacmid-MgAGN2, which were correctly recombined.

(3) Preparation of recombinant baculovirus

Transfecting the recombinant bacmid-H3, rBacmid-H9 and rBacmid-MgAGN2 obtained in the step (2) by adopting a liposome-mediated transfection method, wherein the specific process is as follows:

the transfection reagent was returned to room temperature, and 4. mu.L of the transfection reagent was pipetted and gently mixed with 2. mu.L of recombinant bacmids (diluted to 2. mu.g/100. mu.L with serum-free Sf9 cell culture medium) and incubated for 30 minutes at room temperature;

adding the mixture to a prepared six-well plate of insect Sf9 cells;

after incubation at 28 ℃ for 96h, the results of Sf9 lesion are shown in FIG. 5. After the cells are diseased, collecting cell supernatant, namely first generation recombinant baculovirus rBV-H3, rBV-H9 and rBV-Mgagn 2;

inoculating insect Sf9 cells with the first generation of recombinant baculovirus, and collecting second generation of recombinant baculovirus under the same condition; by analogy, collecting the fourth generation recombinant baculovirus;

for ease of detection and analysis, each generation of recombinant baculovirus may be stored at-80 ℃ for use.

And extracting virus genome DNA from the collected supernatant containing the fourth generation recombinant baculovirus, and simultaneously performing PCR detection verification to ensure that the recombinant baculovirus is constructed correctly. When PCR detection and identification are carried out, a pair of universal primer sequences is designed as follows:

m13 upstream primer: 5'-gttttcccagtcacgac-3' the flow of the air in the air conditioner,

m13 downstream primer: 5'-caggaaacagctatgac-3' are provided.

The PCR validation results are shown in FIG. 6. As can be seen from the analysis of FIG. 6, the molecular weight results of PCR verification of each recombinant baculovirus coincided with the theoretical value, wherein lane 2 is the PCR identification result of MgagN2 gene, which is about 4000 bp; lane 3 is the PCR identification result of HA gene of H9N2 subtype avian influenza virus, about 3983 bp; lane 4 shows the result of PCR identification of HA gene of H3N2 subtype avian influenza virus, which is approximately 4001 bp. Meanwhile, Western blot identification is carried out on the foreign protein expressed by the fourth generation baculovirus, and the identification result is shown in FIG. 7.

(4) Preparing and purifying to obtain avian influenza VLPs

Simultaneously infecting the fourth generation of recombinant baculovirus rBV-H3, rBV-H9 and rBV-MgagnN 2 collected in the step (3) with suspension cultured insect Sf9 cells, carrying out shake culture at 28 ℃ and 120rpm, wherein the infection number is 5, and the infection time is 96 hours;

in the culture process, the virus structural protein can be assembled by self after expression, and finally the formed VLPs can be secreted into the cell culture supernatant;

after the culture is finished, taking culture supernatant, centrifuging at 8,000rpm for 30 minutes, and primarily removing large cell debris;

then, a discontinuous 40% -60% sucrose density gradient centrifugation is adopted, a white band is formed in the middle of 40% and 60% sucrose layers of the concentrated sample, baculovirus is precipitated at the bottom, other small foreign proteins are settled at the top layer, and the white band layer is collected to be VLPs.

The hemagglutination titer of the prepared avian influenza VLPs was tested, as shown in fig. 8, the hemagglutination titer of unpurified avian influenza VLPs was 5log2, and the hemagglutination titer of purified avian influenza VLPs was 8log2, indicating that the purification step can significantly improve the sample purity and hemagglutination titer. The prepared avian influenza VLPs were subjected to Western blot analysis using PBS solution containing the chicken H9N2 subtype avian influenza-resistant positive serum, the chicken H3N2 subtype avian influenza-resistant positive serum and the mouse Mgag protein-resistant positive serum at the same time, and the analysis results are shown in FIG. 9. The results of transmission electron microscope observation of the prepared avian influenza VLPs are shown in fig. 10, it can be seen that the virions have an intact structure, a significant capsular sac protrusion is present on the surface, and the diameter is about 180 nm.

Example 2

In this example, the immunopotentiation of VLPs prepared in example 1 was evaluated when used as vaccines.

(1) Preparation of immunogens

Preparation of VLPs vaccine: the purified VLPs were adjusted to contain 15. mu.g, 30. mu.g, and 40. mu.g of protein per 150. mu.L of PBS solution, slowly dropped into ImjectTM alum adjuvant at a ratio of 1:1, emulsified, stirred in a magnetic stirrer at a constant speed for about 30 minutes, and stored at 4 ℃ for further use.

Preparation of H3N2 home-made inactivated vaccine: adding 4% paraformaldehyde solution with final concentration of 1 ‰ according to virus liquid volume, mixing, and standing at 4 deg.C for 48 hr. Then slowly dropping the mixture into Imject according to the proportion of 1:1^TMEmulsifying in alum adjuvant, and storing at 4 deg.C.

(2) Animal immunization and challenge regimen

320 white feather broilers are purchased in a chicken farm in the local Changchun province and are divided into four groups, namely a blank control group, an immune non-offensive group, an immune offensive group and an offensive control group. Wherein the blank control group is continuously divided into 2 groups, the immune non-attacking group is continuously divided into 5 groups, the immune attacking group is continuously divided into 8 groups, and the attacking control group is continuously divided into 2 groups. The specific grouping is shown in table 1.

The immunization mode comprises the following steps: 300 μ l of each of the avian influenza VLPs vaccine, the commercial inactivated vaccine H9N2, and the home-made inactivated vaccine H3N2 was administered intramuscularly.

Immunization procedure: immunization was performed at 10 days of age.

Toxic attack mode and time: three weeks after immunization 10⁶EID₅₀The H9N2 subtype and the H3N2 subtype avian influenza viruses are subjected to nose-drop virus attack.

(3) HI antibody titer assay

The immunized chickens were subjected to venous blood collection on days 7, 14, 21, 28, and 35 after immunization, and the serum was separated by standing at room temperature for 3-6h, and the HI antibody titer in the serum of the immunized chickens was measured by hemagglutination inhibition assay, and the measurement results are shown in FIG. 11. The HI antibody titer determination results show that the HI antibody titers of the avian influenza VLPs immunization group and the vaccine immunization group at each dose are in an ascending trend within three weeks after immunization, even at day 35 after immunization, the HI antibody titers of the avian influenza VLPs immunization group and the vaccine immunization group at each dose are still higher than 2log2, and the comparison of the avian influenza VLPs immunization group and the vaccine immunization group at each dose shows that the HI and the vaccine immunization group at each time point of the avian influenza VLPs immunization group at high dose (40 μ g/300 μ L) have no significant difference (p > 0.05). Therefore, the avian influenza VLPs have stronger immunogenicity, and can induce organisms to generate specific antibodies with the same level as that of inactivated vaccines after immunization.

(4) Lymphocyte proliferation assay

Spleens of chickens were aseptically harvested at 7, 14, 21, and 28 days after immunization and subjected to lymphocyte proliferation assay. Firstly, separating chicken spleen lymphocytes, which comprises the following specific steps:

1) taking spleens of three chickens in each group of the immune non-challenge group in a sterile way and grinding;

2) sieving with 200 mesh sieve, re-suspending with lymphocyte separation liquid, and centrifuging at 1,000g for 10 min;

3) taking a lymphocyte layer, adding erythrocyte lysate into the lymphocyte layer for acting for 2 minutes, centrifuging the lymphocyte layer for 10 minutes at 1,000g, and removing supernatant;

4) PBS was washed twice.

After obtaining splenic lymphocytes of the chicken, carrying out lymphocyte proliferation test, comprising the following steps:

1) adjusting the cell concentration to 1X 10⁶Per mL;

2) 100 μ L of lymphocytesAdding the suspension into a 96-well cell culture plate, and adding 5% CO at 37 DEG C₂Culturing for 2h in a cell culture box;

3) respectively adding inactivated H9N2 subtype avian influenza virus, H3N2 subtype avian influenza virus and PBS as stimulators; two additional controls were set, one with 1640 medium and one with lymphocyte suspension. Each group is provided with three multiple holes;

4) put in 5% CO at 37 DEG C₂Incubating in a cell incubator;

5) after 24 hours, adding 10 mu L of CCK-8 solution into each hole;

6) put in 5% CO at 37 DEG C₂Incubating for 2h in a cell incubator;

7) the OD at 490nm was measured with a microplate reader.

And (4) judging a result: SI ═ (sample OD value-blank OD value)/(negative OD value-blank OD value). The SI results are shown in fig. 12. The lymphocyte proliferation capability detection result shows that the SI of each dose of avian influenza VLPs immune group and vaccine immune group increases along with the time extension and reaches the peak at 3 weeks after immunization, and the comparison of the high dose avian influenza VLPs immune group and the vaccine immune group shows that the SI of each time point of the high dose (40 mug/300 muL) avian influenza VLPs immune group has no significant difference (p is more than 0.05) with the vaccine immune group. Thus, avian influenza VLPs can induce the body to produce cellular immunity at a level comparable to that of inactivated vaccines.

(5) Weight gain rate monitoring

The weight of the chickens was weighed 3, 5, 7, 10, 14 days after challenge before feeding. The rate of change of body weight gain is shown in figure 13. As a result, the different doses of VLPs immune virus challenge group, the PBS virus challenge control group and the commodity or home-made vaccine virus challenge group are compared, and the different doses of VLPs immune virus challenge group and the commodity or home-made vaccine virus challenge group show a weight increase trend under the attack of two avian influenza viruses, and the increase rate of the high dose VLPs immune virus challenge group has no significant difference (p >0.05)

(6) In vitro detoxification time detection

From day 3 after challenge, oropharynx and cloaca were sampled with cotton swabs every other day. The collected samples were sterilized overnight in PBS containing 1% diabesin (penicillin and streptomycin), centrifuged at 2,000g for 10 minutes, 200. mu.L of the sample solution was aspirated to inoculate 9-day-old SPF chick embryos, and dead chick embryos within 24 hours were discarded. Hemagglutination test was performed on allantoic fluid of chick embryos collected after 72h, and the detoxification of the challenged chickens was examined, and the results are shown in tables 2 and 3. After the high-dose and medium-dose avian influenza VLPs immunization group is attacked, the in vitro toxin expelling time of the virus is shorter than that of the vaccine immunization group, and the in vitro toxin expelling time after the low-dose avian influenza VLPs is shorter than that of the vaccine immunization group or is equivalent to that of the vaccine immunization group. Therefore, compared with commercial or self-made inactivated vaccines, the avian influenza VLPs vaccine prepared by the research can effectively shorten the detoxification time of the oral pharynx and cloaca of the chicken.

(7) In vivo virus distribution detection

From day 1 after challenge, the experimental chickens were sacrificed every other day, and then the brain, trachea, lung, intestine, pancreas, spleen, kidney, muscle and other organs were collected. An equal weight of tissue was placed in a PBS solution containing 1% diabase (penicillin and streptomycin), the sample was ground using a grinder and centrifuged at 2,000g for 10 minutes. Extracting virus RNA from the grinding fluid and carrying out reverse transcription to obtain virus cDNA. And (3) carrying out qPCR detection by utilizing Hofmann primers of the M segment of the avian influenza virus. The results of in vivo virus distribution detection after H9N2 subtype avian influenza virus challenge are shown in Table 4. The detection result shows that after the high-dose and medium-dose avian influenza VLPs immunization group is attacked, the in vivo virus-carrying time is shorter than that of the vaccine immunization group, and the in vivo virus-carrying time after the low-dose avian influenza VLPs is immunized and attacked is shorter than that of the vaccine immunization group or is equivalent to that of the vaccine immunization group. Thus, the avian influenza VLPs vaccine prepared by the present study can reduce the viral load in animals compared to commercial or home-made inactivated vaccines.

In a word, the bivalent chimeric avian influenza VLPs H3N2 and H9N2 prepared by the research can induce the chicken to generate humoral immunity and cellular immunity response equivalent to the vaccine group level, can effectively protect the chicken from the attack of homologous viruses, and provides a new vaccine preparation strategy for the development of novel bivalent avian influenza vaccines.

While the invention has been described above with reference to an embodiment, various modifications may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention. In particular, the various features of the disclosed embodiments of the invention may be used in any combination, provided that no structural conflict exists, and the combinations are not exhaustively described in this specification merely for the sake of brevity and resource conservation. Therefore, it is intended that the invention not be limited to the particular embodiments disclosed, but that the invention will include all embodiments falling within the scope of the appended claims.

Sequence listing

<110> Jilin university

<120> preparation of H3N2 and H9N2 subtype avian influenza bivalent chimeric virus-like particle

<140> 2021104830730

<141> 2021-04-30

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1701

<212> DNA/RNA

<213> nucleotides (Influenza A virus)

<400> 1

atgaggaccg ttattgcatt gagctacatt ctctgcttgg cttttggaca gaaccttcca 60

gggaatgaca acagtacagc aacactatgc ctgggacatc atgcagtgcc gaatggaaca 120

atagtgaaaa caatcaccga cgatcagatt gaggtgacca atgctactga gctggtccaa 180

agttcctcaa cagggaaaat atgcaacaat ccccacaaga tccttgatgg aagagattgc 240

acattaatag atgccatgct tggagatcct cattgtgatg tttttcaaga tgagacatgg 300

gatctcttcg ttgagcgaag caatgctttc agcaattgtt atccttatga tgtaccggat 360

tatgcctccc ttcgatcctt agttgcttca tcaggcacac tagaattcat tactgaaggt 420

ttcacctgga caggagtgag ccagaatgga ggaagcggtg cctgcaaaag gggacctgcc 480

aacggtttct tcggtagatt gaactggttg actaagtcag ggaactcata cccactgtta 540

aacgtgacta tgccaaacaa tgataatttt gacaagctat acatctgggg tgttcaccac 600

ccgagtacaa accaagaaca gactaacctg tatgttcagg cctcaggaag agtcacagtc 660

tctaccagga gaagtcaaca gaccatagtc ccgaacattg gatctagacc ttgggtaagg 720

ggtcaatctg gaagaataag catctactgg acaatagtca aacctggaga tgtaccggta 780

atcaatagta acggaaacct gattgcgcct cggggatact tcaagatccg aactgggaaa 840

agctcaataa tgagatcaga tgcacctata gagacttgca tctcagaatg catcactcca 900

aatggaagca tccctaatga caagcctttt caaaatgtaa acaaaatcac atacggggca 960

tgtcccaaat atgtaaagca aaatacccta aaattggcta caggaatgag gaatgtgcct 1020

gagaagcaaa ccagaggtct attcggtgca atagcagggt tcatagagaa tggatgggaa 1080

ggaatgatag atggctggta tggcttcaga caccaaaatt ctgaaggcac aggacaagca 1140

gcagatctta aaagcaccca agcggccatt gaccaaatca atgggaaatt gaacagagtg 1200

attgaaaaga cgaatgaaaa attccatcag atcgaaaaag aattctccga ggttgaagga 1260

aggattcaag atcttgagaa atatgtcgaa gacacaaagg tggacctctg gtcttataat 1320

gcagagcttc ttgttgctct agagaatcag catacaattg atttgaccga ttctgagatg 1380

aacaagttat ttgaaaaaac cagaaggcaa ctgagagaga atgctgaaga catgggcaat 1440

ggttgcttca aaatatatca caaatgtgac aatgcctgca tagaatcaat taggaatgga 1500

acttatgacc atgacatata tcgagatgag gcactgaaca atcggttcca gatcagaggt 1560

gtagaactaa aatctggata caaagactgg atcctgtgga tttcctttgc catatcatgc 1620

tttttgcttt gtgttgtgtt gttggggttc attatgtggg cttgccagcg aggcaacatt 1680

aggtgcaaca tttgcatttg a 1701

<210> 2

<211> 1683

<212> DNA/RNA

<213> nucleotides (Influenza A virus)

<400> 2

atgggagccg tatcattgat aactatgcta ctagtagcaa cagtaagcaa tgcagacaaa 60

atctgcatcg gataccaatc aacaaactcc acagaaactg tagacacact aacagaaaac 120

aatgtccctg tgacacatgc caaagaattg ctccacacag agcacaatgg gatgctatgt 180

gcaacaaact tgggacatcc tcttattcta gacacctgta ccattgcagg actaatctat 240

ggcaatcctt cttgtgatct attgctggga ggaagagaat ggtcttacat cgtcgagaga 300

ccatcggctg tcaatggatt gtgctacccc gggaatgtag aaaatctaga agaactaagg 360

tcacttttca gttctgctag ttcttatcaa agaatccaga tttttccgga cacaatatgg 420

aatgtgtctt acagtggaac aagcaaagca tgttcagatt cattctacag aagcatgaga 480

tggttgaccc aaaagaacaa cgcttaccct attcaagacg cccaatacac aaataatcga 540

gaaaagaaca ttcttttcat gtggggtata aatcacccac ccaccgagac tacacagaca 600

gatctgtaca caagaaccga cacaacaaca agtgtggcaa cagaagaaat aaataggacc 660

ttcaaaccat tgataggacc aaggcctctt gtcaatggtt tgcagggaag aattgattat 720

tattggtcgg tattgaaacc aggtcaaaca ctgcgagtaa gatccaatgg gaatctaata 780

gctccatggt atggacacat tctttcagga gagagccacg gaagaatcct gaagactgat 840

ttgaaaaggg gtagctgtac agtgcaatgt cagacagaaa aaggtggctt aaacacaaca 900

ttgccattcc aaaatgtaag taagtatgca tttggaaact gctcgaaata tgttggagta 960

aagagtctca aacttgcagt tggtctgagg aatgtgcctt ctaaatctag tagaggacta 1020

tttggggcca tagctggatt catagaggga ggttggtcag gactagttgc tggttggtat 1080

ggattccagc attcaaatga ccaaggggtt ggtatggcag cagatagaga ctcaacccaa 1140

aaggcaattg ataaaataac atccaaagtg aataacatag tcgataaaat gaacaaacag 1200

tatgaaatta ttgatcatga attcagcgag gttgaaaata gacttaacat gatcaataat 1260

aagattgatg atcaaattca agacatatgg gcatataacg cagaactgct agtgctactt 1320

gaaaaccaga aaacactcga tgagcatgat gcaaatgtaa ataatctata taataaagtg 1380

aagagggcat tgggttccaa tgcagtggaa gatgggaaag gatgtttcga gctatatcac 1440

agatgtgatt accagtgcat ggagacaatt cggaacggga cctacaacag gaggaaatat 1500

caagaggaat caaaattaga aaggcagaga atagaggggg tcaagctgga gtctgaagga 1560

acttacaaaa ttctcaccat ttattcgact gtcgcctcat ctcttgtgat tgcaatgggg 1620

tttgctgcct tcttgttctg ggccatgtcc aatgggtctt gcagatgcaa catttgtata 1680

taa 1683

<210> 3

<211> 1617

<212> DNA/RNA

<213> nucleotides (Influenza A virus)

<400> 3

atgggccaga ctgttaccac tcccttaagt ttgaccttag gtcactggaa agatgtcgag 60

cggatcgctc acaaccagtc ggtagatgtc aagaagagac gttgggttac cttctgctct 120

gcagaatggc caacctttaa cgtcggatgg ccgcgagacg gcacctttaa ccgagacctc 180

atcacccagg ttaagatcaa ggtcttttca cctggcccgc atggacaccc agaccaggtc 240

ccctacatcg tgacctggga agccttggct tttgaccccc ctccctgggt caagcccttt 300

gtacacccta agcctccgcc tcctcttcct ccatccgccc cgtctctccc ccttgaacct 360

cctcgttcga ccccgcctcg atcctccctt tatccagccc tcactccttc tctaggcgcc 420

aaacctaaac ctcaagttct ttctgacagt ggggggccgc tcatcgacct acttacagaa 480

gaccccccgc cttataggga cccaagacca cccccttccg acagggacgg aaatggtgga 540

gaagcgaccc ctgcgggaga ggcaccggac ccctccccaa tggcatctcg cctacgtggg 600

agacgggagc cccctgtggc cgactccact acctcgcagg cattccccct ccgcgcagga 660

ggaaacggac agcttcaata ctggccgttc tcctcttctg acctttacaa ctggaaaaat 720

aataaccctt ctttttctga agatccaggt aaactgacag ctctgatcga gtctgttctc 780

atcacccatc agcccacctg ggacgactgt cagcagctgt tggggactct gctgaccgga 840

gaagaaaaac aacgggtgct cttagaggct agaaaggcgg tgcggggcga tgatgggcgc 900

cccactcaac tgcccaatga agtcgatgcc gcttttcccc tcgagcgccc agactgggat 960

tacaccaccc aggcaggtag gaaccaccta gtccactatc gccagttgct cctagcgggt 1020

ctccaaaacg cgggcagaag ccccaccaat ttggccaagg taaaaggaat aacacaaggg 1080

cccaatgagt ctccctcggc cttcctagag agacttaagg aagcctatcg caggtacact 1140

ccttatgacc ctgaggaccc agggcaagaa actaatgtgt ctatgtcttt catttggcag 1200

tctgccccag acattgggag aaagttagag aggttagaag atttaaaaaa caagacgctt 1260

ggagatttgg ttagagaggc agaaaagatc tttaataaac gagaaacccc ggaagaaaga 1320

gaggaacgta tcaggagaga aacagaggaa aaagaagaac gccgtaggac agaggatgag 1380

cagaaagaga aagaaagaga tcgtaggaga catagagaga tgagcaagct attggccact 1440

gtcgttagtg gacagaaaca ggatagacag ggaggagaac gaaggaggtc ccaactcgat 1500

cgcgaccagt gtgcctactg caaagaaaag gggcactggg ctaaagattg tcccaagaaa 1560

ccacgaggac ctcggggacc aagaccccag acctccctcc tgaccctaga tgactag 1617

<210> 4

<211> 22

<212> DNA/RNA

<213> nucleotides (Influenza A virus)

<400> 4

cggatccatg agtcttctga cc 22

<210> 5

<211> 23

<212> DNA/RNA

<213> nucleotides (Influenza A virus)

<400> 5

gctctagatc acttgaaccg ctg 23

<210> 6

<211> 22

<212> DNA/RNA

<213> nucleotides (Influenza A virus)

<400> 6

cggatccatg aagacaacca tt 22

<210> 7

<211> 27

<212> DNA/RNA

<213> nucleotides (Influenza A virus)

<400> 7

ccaagcttct atcagtttac tcaaatg 27