Method for efficiently identifying Aspergillus oryzae CRISPR/Cas9 mutant
1. A method for efficiently identifying Aspergillus oryzae CRISPR/Cas9 mutant, comprising the following steps:
1) constructing an aspergillus oryzae gene editing system based on AMA1 autonomously replicating plasmids;
2) assessing the aspergillus oryzae gene editing system constructed in step 1) with an aspergillus oryzae kojic acid synthetic gene selected from the group consisting of kojA, kojR and kojT;
3) and (3) placing the sgRNA and PAM sequences of kojA behind the initiation codon of DsRed, and constructing non-functional DsRed containing the sgRNA and PAM sequences of kojA, so as to evaluate the non-functional DsRed as a reporter gene for screening the Aspergillus oryzae CRISPR/Cas9 mutant.
2. The method for efficiently identifying the Aspergillus oryzae CRISPR/Cas9 mutant according to claim 1, wherein the step 1) further comprises the following steps:
1-1) inserting an optimized Cas9 gene sequence between XhoI and BamHI recognition sites of a pEX1 vector to obtain a pEX1-Cas9 vector;
1-2) carrying out PCR amplification on a Cas9 expression cassette containing an Aspergillus nidulans gpdA promoter, Cas9 and a trpC terminator, and then inserting the obtained Cas9 expression cassette into a HindIII site of a pPTRII vector to generate a pPTRII-Cas9 recombinant vector;
1-3) the sgRNA sequence including the target protospacer sequence was fused with the U6 promoter and U6 terminator and then inserted into the pPTRII-Cas9 recombinant vector to generate the pPTRII-Cas 9-target gene vector.
3. The method for efficiently identifying the Aspergillus oryzae CRISPR/Cas9 mutant according to claim 2, wherein in the step 1-2), the primer sequences amplified by PCR are as follows:
pEX1-Cas9-F：TGATTACGCCAAGCTTTGTGACGAACTCGTGTGCTC；
pEX1-Cas9-R：GCAGGCATGCAAGCTTAAGAAGGATTACCTCTAAACAAGTGT。
4. the method for efficiently identifying the Aspergillus oryzae CRISPR/Cas9 mutant according to claim 2, wherein the step 2) further comprises the step of constructing a gene editing vector for knocking out the Aspergillus oryzae kojic acid synthetic gene:
2-1) amplifying the U6 promoter PU6 by using a forward primer PU6-F and a reverse primer PU6-kojA/kojR/kojT-R containing a kojA/kojR/kojT targeting sequence to obtain a PU6-kojA/kojR/kojT fragment;
2-2) connecting a kojA/kojR/kojT targeting sequence to the N end of the sgRNA-TU6 by PCR amplification by using sgRNA and a U6 terminator sequence sgRNA-TU6 as templates and TU6-R and TU6-kojA/kojR/kojT-F as primers to obtain a kojA/kojR/kojT-sgRNA-TU6 fragment;
2-3) carrying out overlapped PCR on the PU6-kojA/kojR/kojT fragment and the kojA/kojR/kojT-sgRNA-TU6 fragment to obtain a PU6-kojA/kojR/kojT-sgRNA-TU6 fragment;
2-4) recombining and connecting the PU6-kojA/kojR/kojT-sgRNA-TU6 fragment to a SmaI site of the pPTRII-Cas 9-target gene vector to obtain the pPTRII-Cas9-kojA/kojR/kojT vector.
5. The method for efficiently identifying the Aspergillus oryzae CRISPR/Cas9 mutant according to claim 4, wherein in the step 2-1), the genomic DNA of the Aspergillus oryzae RIB40 strain is used as a template.
6. The method for efficiently identifying the Aspergillus oryzae CRISPR/Cas9 mutant according to claim 4, wherein the sequences of the forward primer PU6-F and the reverse primer PU6-kojA/kojR/kojT-R in the step 2-1) are as follows:
PU6-F：CGACTCTAGAGGATCCCCGGGTAATGCCGGCTCATTCAAA；
PU6-kojA-R：TGGTCAAGTTCTGTGAGACGACTTGTTCTTCTTTACAATGATTTATTT；
PU6-kojR-R：TGAAGCATGGGGGCAGTTGGACTTGTTCTTCTTTACAATGATTTATTTA；
PU6-kojT-R：TCGGTATTGGCGGAAGGACTACTTGTTCTTCTTTACAATGATTTATTTA；
in step 2-2), the sequences of primers TU6-R and TU6-kojA/kojR/kojT-F were as follows:
TU6-R：AATTCGAGCTCGGTACCCGGGAGCAGCTCTATATCACGTGACG；
TU6-kojA-F：CGTCTCACAGAACTTGACCAGTTTTAGAGCTAGAAATAGCAAGTTAAA；
TU6-kojR-F：CCAACTGCCCCCATGCTTCAGTTTTAGAGCTAGAAATAGCAAGTTAAA；
TU6-kojT-F：AGTCCTTCCGCCAATACCGAGTTTTAGAGCTAGAAATAGCAAGTTAAA。
7. the method for efficiently identifying the Aspergillus oryzae CRISPR/Cas9 mutant according to claim 4 or 5, wherein the step 2) further comprises the following steps: PEG-mediated Aspergillus oryzae transformants were screened and confirmed for gene mutations by sequencing.
8. The method for efficiently identifying the Aspergillus oryzae CRISPR/Cas9 mutant according to claim 1, wherein the step 3) comprises the following steps:
and performing PCR amplification by using DsRed as a template and using a pEX2B-nDsRed-kojA-F forward primer and a reverse primer pEX2B-nDsRed-kojA-R, wherein a kojA targeting sequence and a PAM sequence of the kojA targeting sequence are added behind an initiation codon at the 5' end, wherein the amplified product is an nDsRed reporter gene nDsRed-kojA with the kojA targeting sequence and the PAM sequence inserted at the downstream of the initiation codon.
9. The method for efficiently identifying the Aspergillus oryzae CRISPR/Cas9 mutant according to claim 8, wherein the primer sequences of a forward primer pEX2B-nDsRed-kojA-F and a reverse primer pEX2B-nDsRed-kojA-R are as follows:
pEX2B-nDsRed-kojA-F：CGTGCCCGTGCTTAAGATGCGTCTCACAGAACTTGACCAAGGGCCTCCTCCGAGGACGT；
pEX2B-nDsRed-kojA-R：AACGTTAAGTGGATCCCTACAGGAACAGGTGGTGGC。
10. the method for efficiently identifying Aspergillus oryzae CRISPR/Cas9 mutant according to claim 8,
the step 3) comprises the following steps:
3-1) cloning the nDsRed-kojA fragment into a linearized vector pEX2B with an Aspergillus oryzae amyB promoter to obtain a plasmid pEX 2B-nDsRed-kojA;
3-2) co-transforming the recombinant plasmids pPTRII-Cas9-kojA and pEX2B-nDsRed-kojA into an Aspergillus oryzae 3.042 uridine/uracil auxotrophic mutant by using a PEG mediated protoplast method;
3-3) inoculating Aspergillus oryzae hyphae transferred with two vectors of pPTRII-Cas9-kojA and pEX2B-nDsRed-kojA, culturing, carrying out DsRed fluorescent primary screening on the transformant to obtain a candidate positive transformant, and then identifying the mutation of a kojA gene target site through sequencing.
Background
Aspergillus oryzae is widely used in food fermentation, and in the industrial production of enzymes and secondary metabolites. The development of the genetic engineering technology greatly improves the product quality and yield of the aspergillus oryzae, wherein the CRISPR/Cas9 system provides a powerful genetic engineering tool for the genetic modification of the aspergillus oryzae. The CRISPR/Cas9 system comprises two components: cas9 nuclease and one sgRNA. The sgRNA can direct Cas9 nuclease to recognize and cleave a target sequence located upstream of a protospacer motif (PAM). When Cas9 produces a DNA double-strand break (DSB) that is repaired by a non-homologous end joining (NHEJ) mechanism or a homologous-directed repair (HDR) mechanism, the target site produces random insertions or deletions of nucleotides (insertions or deletions). The CRISPR/Cas9 system has been widely used in Aspergillus oryzae, Aspergillus niger, Aspergillus aculeatus and other filamentous fungi. However, to meet the needs of industrial production and functional research, rapid screening of mutants produced by the CRISPR/Cas9 system is required.
The current methods for identifying mutants are mainly based on PCR, restriction enzymes and sequencing technologies. For example, PCR/restriction enzyme (PCR/RE) analysis requires amplification and digestion of the available restriction enzyme sites in the target site, which, once edited to destroy, results in the inability of the target site to cleave to identify mutants. Similarly, the T7EI assay method utilizes a bacteriophage lytic enzyme T7EI that has greater cleavage activity for mismatches at the target site introduced by CRISPR/Cas9 gene editing, thereby identifying mutants. Although these sequencing methods can accurately identify the mutation type of the mutant, the cost and difficulty of batch screening of the mutant are high. Direct observation of the fluorescence of the material is a good way to rapidly identify the mutant. Studies have reported that transformed material is obtained by fusing a Green Fluorescent Protein (GFP) reporter gene to a Cas 9-encoding gene, but fluorescence alone cannot distinguish transformed material from a large amount of untransformed material. Therefore, it is very necessary to establish an efficient method to identify CRISPR/Cas 9-produced mutants.
Disclosure of Invention
In order to solve the technical problems, the invention provides a method for efficiently identifying the Aspergillus oryzae CRISPR/Cas9 mutant.
In order to achieve the technical purpose, the invention adopts the following technical scheme:
a method for efficiently identifying Aspergillus oryzae CRISPR/Cas9 mutant, comprising the following steps:
1) constructing an aspergillus oryzae gene editing system based on AMA1 autonomously replicating plasmids;
2) assessing the aspergillus oryzae gene editing system constructed in step 1) with an aspergillus oryzae kojic acid synthetic gene selected from the group consisting of kojA, kojR and kojT;
3) and (3) placing the sgRNA and PAM sequences of kojA behind the initiation codon of DsRed, and constructing non-functional DsRed containing the sgRNA and PAM sequences of kojA, so as to evaluate the non-functional DsRed as a reporter gene for screening the Aspergillus oryzae CRISPR/Cas9 mutant.
Preferably, step 1) in turn comprises:
1-1) inserting an optimized Cas9 gene sequence between XhoI and BamHI recognition sites of a pEX1 vector to obtain a pEX1-Cas9 vector;
1-2) carrying out PCR amplification on a Cas9 expression cassette containing an Aspergillus nidulans gpdA promoter, Cas9 and a trpC terminator, and inserting the obtained Cas9 expression cassette into a HindIII site of a pPTRII vector to generate a pPTRII-Cas9 recombinant vector;
1-3) the sgRNA sequence including the target protospacer sequence was fused with the U6 promoter and U6 terminator and then inserted into the pPTRII-Cas9 recombinant vector to generate the pPTRII-Cas 9-target gene vector.
More preferably, in step 1-2), the sequences of the primers amplified by PCR are as follows:
pEX1-Cas9-F：5′-TGATTACGCCAAGCTTTGTGACGAACTCGTGTGCTC-3′；
pEX1-Cas9-R：5′-GCAGGCATGCAAGCTTAAGAAGGATTACCTCTAAACAAGTGT-3′。
preferably, step 2) further comprises constructing a gene editing vector for knocking out the aspergillus oryzae kojic acid synthesis gene:
2-1) amplifying the U6 promoter PU6 by using a forward primer PU6-F and a reverse primer PU6-kojA/kojR/kojT-R containing a kojA/kojR/kojT targeting sequence to obtain a PU6-kojA/kojR/kojT fragment;
2-2) connecting a kojA/kojR/kojT targeting sequence to the N end of the sgRNA-TU6 by PCR amplification by using sgRNA and a U6 terminator sequence sgRNA-TU6 as templates and TU6-R and TU6-kojA/kojR/kojT-F as primers to obtain a kojA/kojR/kojT-sgRNA-TU6 fragment;
2-3) carrying out overlapped PCR on the PU6-kojA/kojR/kojT fragment and the kojA/kojR/kojT-sgRNA-TU6 fragment to obtain a PU6-kojA/kojR/kojT-sgRNA-TU6 fragment;
2-4) recombining and connecting the PU6-kojA/kojR/kojT-sgRNA-TU6 fragment to a SmaI site of the pPTRII-Cas 9-target gene vector to obtain the pPTRII-Cas9-kojA/kojR/kojT vector.
More preferably, in step 2-1), the genomic DNA of the Aspergillus oryzae RIB40 strain is used as a template.
More preferably, in step 2-1), the sequences of the forward primer PU6-F and the reverse primer PU6-kojA/kojR/kojT-R are as follows:
PU6-F：CGACTCTAGAGGATCCCCGGGTAATGCCGGCTCATTCAAA；
PU6-kojA-R：TGGTCAAGTTCTGTGAGACGACTTGTTCTTCTTTACAATGATTTATTT；
PU6-kojR-R：TGAAGCATGGGGGCAGTTGGACTTGTTCTTCTTTACAATGATTTATTTA；
PU6-kojT-R：TCGGTATTGGCGGAAGGACTACTTGTTCTTCTTTACAATGATTTATTTA；
in step 2-2), the sequences of primers TU6-R and TU6-kojA/kojR/kojT-F were as follows:
TU6-R AATTCGAGCTCGGTACCCGGGAGCAGCTCTATATCACGTGACG；
TU6-kojA-F CGTCTCACAGAACTTGACCAGTTTTAGAGCTAGAAATAGCAAGTTAAA；
TU6-kojR-F CCAACTGCCCCCATGCTTCAGTTTTAGAGCTAGAAATAGCAAGTTAAA；
TU6-kojT-F AGTCCTTCCGCCAATACCGAGTTTTAGAGCTAGAAATAGCAAGTTAAA。
preferably, step 2) further comprises: PEG-mediated Aspergillus oryzae transformants were screened and confirmed for gene mutations by sequencing.
Preferably, step 3) comprises:
and performing PCR amplification by using DsRed as a template and using pEX2B-nDsRed-kojA-F forward primer and pEX2B-nDsRed-kojA-R with a kojA targeting sequence and PAM thereof added at the 5' end, wherein the amplified product is nDsRed-kojA reporter gene inserted with the kojA targeting sequence and the PAM sequence at the downstream of the initiation codon.
More preferably, the primer sequences of the forward primer pEX2B-nDsRed-kojA-F and the reverse primer pEX2B-nDsRed-kojA-R are:
pEX2B-nDsRed-kojA-F：CGTGCCCGTGCTTAAGATGCGTCTCACAGAACTTGACCAAGGGCCTCCTCCGAGGACGT；
pEX2B-nDsRed-kojA-R：AACGTTAAGTGGATCCCTACAGGAACAGGTGGTGGC。
preferably, step 3) comprises:
3-1) cloning the nDsRed-kojA fragment into a linearized vector pEX2B with an Aspergillus oryzae amyB promoter to obtain a plasmid pEX 2B-nDsRed-kojA;
3-2) co-transforming the recombinant plasmids pPTRII-Cas9-kojA and pEX2B-nDsRed-kojA into an Aspergillus oryzae 3.042 uridine/uracil auxotrophic mutant by using a PEG mediated protoplast method;
3-3) inoculating Aspergillus oryzae hyphae transferred with two vectors of pPTRII-Cas9-kojA and pEX2B-nDsRed-kojA, culturing, carrying out DsRed fluorescent primary screening on the transformant to obtain a candidate positive transformant, and then identifying the mutation of a kojA gene target site through sequencing.
The invention has the following beneficial effects:
according to the constructed Aspergillus oryzae gene editing system of the AMA1 autonomously replicating plasmid, the non-functional DsRed containing the target sequence of the target gene and the PAM thereof is used as a reporter gene, and whether the target gene is edited or not is rapidly identified through the red fluorescence recovery condition, so that the mutant is preliminarily screened in batches from the Aspergillus oryzae CRISPR/Cas9 mutant strain, the complexity of extracting DNA in large quantities is avoided, and the sequencing screening of the Aspergillus oryzae transformants in batches is not needed.
Drawings
Figure 1 shows the construction of Cas9 expression cassettes.
FIG. 2 shows the construction of an Aspergillus oryzae gene editing plasmid based on the AMA1 autonomously replicating plasmid.
FIG. 3 shows an Aspergillus oryzae gene editing system for evaluating an autonomously replicating plasmid of AMA1 using the Aspergillus oryzae kojic acid synthesis gene.
FIG. 4 shows a workflow for constructing Aspergillus oryzae CRISPR/Cas9 mutants using non-functional DsRed as a reporter.
FIG. 5 shows the feasibility of using non-functional DsRed as a reporter gene to screen Aspergillus oryzae CRISPR/Cas9 mutants, as exemplified by kojA.
FIG. 6 shows the fluorescent screening of Aspergillus oryzae CRISPR/Cas9 mutants using non-functional DsRed.
FIG. 7 shows sequencing validation of the fluorescent screening of Aspergillus oryzae CRISPR/Cas9 mutants with non-functional DsRed.
Detailed Description
In order to more clearly illustrate the present invention, the present invention will be described in further detail below with reference to examples and the accompanying drawings. It is to be understood by persons skilled in the art that the following detailed description is illustrative and not restrictive, and is not to be taken as limiting the scope of the invention.
The materials and methods described in the examples below can be implemented by conventional technical means, unless otherwise specified.
Examples
The relevant primers used below are shown in Table 1.
TABLE 1 primer information
The main steps of this example are as follows:
construction of Aspergillus oryzae gene editing system based on AMA1 autonomously replicating plasmid
Artificially synthesizing an optimized Cas9 gene, which takes Cas9 reported by Katayama et al (2016, Biotechnol Lett 38: 637-642) as a reference; the optimized Cas9 gene sequence (SEQ ID NO: 1) was inserted between the XhoI and BamHI recognition sites of pEX1 vector (Nguyen et al (2016) World J Microbiol Biotechnol, 32:204) to give pEX1-Cas9 vector containing the promoter of Aspergillus nidulans gpdA gene, Cas9 gene and trpC gene terminator (TtrpC) (FIG. 1); the Cas9 expression cassette containing the gpdA promoter, Cas9 and trpC terminator was then PCR amplified with primers pEX1-Cas9-F and pEX1-Cas 9-R.
TABLE 2 Cas9 expression cassette PCR amplification System (50. mu.l)
PCR amplification conditions: pre-denaturation at 95 ℃ for 30s, denaturation at 95 ℃ for 10s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 5min, 35 cycles, and complete extension at 72 ℃ for 5 min.
The obtained Cas9 expression cassette (PgpdA-Cas9-TtrPC) was inserted into the HindIII site of pPTRII vector (TaKaRa, Japan, Code No.3622, a shuttle vector based on AMA1 that can autonomously replicate in Aspergillus fungus) to produce pPTRII-Cas9 recombinant vector. Fusion of sgRNA sequence including the target gene protospacer sequence with the U6 promoter and the U6 terminator: mu.l of each PCR product of PU6 and TU6-sgRNA was added with 5 XBuffer 10. mu.l, dNTPs (10mM each) 1. mu.l, and enzyme 1. mu.l at an annealing temperature of 55 ℃ for 5 amplifications, and then 4. mu.l of primers (PU6-F and TU-R mixture (10. mu.M)) was added and amplification was continued for 30 cycles.
Then inserted into the pPTRII-Cas9 recombinant vector, resulting in the pPTRII-Cas 9-target gene vector (fig. 2).
Evaluation of Aspergillus oryzae Gene editing System based on AMA1 autonomously replicating plasmid
1. Gene editing vector construction for knocking out Aspergillus oryzae kojic acid synthetic gene (kojA, kojR, kojT)
For the CRISPR/Cas9 vector, the genomic DNA of Aspergillus oryzae RIB40 strain was used as a template, and the U6 promoter (PU6) was amplified with forward primer PU6-F and reverse primer PU6-kojA/kojR/kojT-R (reverse primer contains targeting sequence of kojA/kojR/kojT) to obtain PU6-kojA/kojR/kojT fragment.
TABLE 3 PU6-kojA/kojR/kojT fragment amplification System (50. mu.l)
Amplification conditions: pre-denaturation at 95 ℃ for 30s, denaturation at 95 ℃ for 10s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 5min, 35 cycles, and complete extension at 72 ℃ for 5 min.
Directly synthesizing sgRNA and U6 terminator sequences (sgRNA-TU6, see SEQ ID NO: 2) by using a gene synthesis method, taking the sgRNA as a template, taking TU6-kojA/kojR/kojT-F and TU6-R as primers, connecting a targeting sequence of kojA/kojR/kojT to the N end of the sgRNA-TU6 to obtain kojA/kojR/kojT-sgRNA-TU6 (taking the targeting sequence of a target gene as a primer joint, and then introducing the targeting sequence by PCR (without special conditions); the two fragments, PU6-kojA/kojR/kojT and kojA/kojR/kojT-sgRNA-TU6 (both fragments contain targeting sequences for kojA/kojR/kojT) were subjected to overlapping PCR: taking 2. mu.l of each PCR product of PU6-kojA/kojR/kojT and kojA/kojR/kojT-sgRNA-TU6, adding 5 Xbuffer 10. mu.l, 1. mu.l of dNTPs (10mM each), and 1. mu.l of enzyme, annealing at 55 ℃, amplifying for 5 times, adding 4. mu.l of primers (PU6-F and TU-R mixture (10. mu.M)) and continuing to amplify for 30 cycles; obtaining PU6-kojA/kojR/kojT-sgRNA-TU6 fragment. This fragment (incubated at 37 ℃ for 30min) was recombinantly ligated to the SmaI site of the above pPTRII-Cas9 vector to obtain pPTRII-Cas9-kojA/kojR/kojT vector, see FIGS. 3A-3C.
PEG-mediated transformation of Aspergillus oryzae and selection of transformants
Aspergillus oryzae 3.042 spores were inoculated into DPY liquid medium (2% glucose, 1% polypeptone, 0.5% yeast extract, 0.5% monopotassium phosphate, 0.05% magnesium sulfate heptahydrate, pH 5.5), cultured for 16-20h, and mycelia were collected with enzyme buffer (50mM maleic acid, 0.6M (NH)4)2SO4pH 5.5); protoplasts were isolated by treating the above mycelia with 1% Yatalase (TaKaRa) and 1.5% cell lysis enzyme (Sigma); washing with washing buffer (1.2M sorbitol, 50mM CaCl)2·2H2O, 35mM NaCl, 10mM Tris-HCl, pH 7.5) resuspending the protoplasts; the recombinant vector (10. mu.g) was mixed with protoplasts and incubated on ice for 30 min. PEG buffer (60% PEG 4000, 50mM CaCl) was then added2·2H2O, 10mM Tris-HCl, pH 7.5), left at room temperature for 10 to 20 minutes, the PEG-treated protoplasts were diluted with a washing buffer, collected by centrifugation (1,000rpm, 8min, 4 ℃) and incubated with M + Met medium (0.2% NH) containing 1.2M sorbitol and 0.5% agar4Cl，0.1％(NH4)2SO4，0.05％KCl，0.05％NaCl，0.1％KH2PO4，0.05％MgSO4·7H2O，0.002％FeSO4·7H2O, 2% glucose, 0.15% methionine, l.2M sorbitol, pH 5.5), plated on M + Met medium plate containing 1.2M sorbitol and 1.5% agar, and cultured at 30 ℃ for 3-5 days.
3. Screening of CRISPR/Cas9 knockout strain of Aspergillus oryzae kojic acid synthetic gene (kojA, kojR, kojT)
Mycelia grown from the MM medium were picked up and transferred to a CD medium containing 0.1. mu.g/ml of pyrithione, followed by secondary screening. After the second selection, the mixture was screened with a reagent containing 0.5mM FeCl3The transformant was cultured in the CD liquid medium of (1). Kojic acid and FeCl3The chelation reaction occurred to a red color indicating the production of kojic acid, which was observed in figure 3D. After 7 days of incubation, the supernatant was collected by centrifugation at 10,000rpm for 5 minutes, and the concentration of kojic acid was measured by colorimetry(Terabayashi et al, 2010), see FIG. 3E. The target genes were simultaneously amplified using the primers listed in table 1 and sequenced to confirm the mutation in each gene.
The results showed that 2 kojA, 3 kojR and 2 kojT knockout strains were successfully obtained using the constructed Aspergillus oryzae gene editing system of AMA1 autonomously replicating plasmid, see FIG. 3.
Thirdly, using non-functional DsRed to assist in selecting Aspergillus oryzae CRISPR/Cas 9-produced mutant
The workflow is shown in fig. 4. The method specifically comprises the following steps:
1. construction of nDsRed report vector
PCR amplification was performed using pEX2B-nDsRed-kojA-F forward primer and pEX2B-nDsRed-kojA-R with a kojA targeting sequence and its PAM added to the 5' end, using DsRed as a template.
TABLE 4 nDsRed-kojA fragment amplification System (50. mu.l)
Amplification conditions: pre-denaturation at 95 ℃ for 30s, denaturation at 95 ℃ for 10s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 5min, 35 cycles, and complete extension at 72 ℃ for 5 min.
The amplified product was the nDsRed reporter gene with the kojA targeting sequence and its PAM sequence (23 bp in total) inserted downstream of the start codon (DsRed shifted by 23bp, translation was terminated early, and non-functional nDsRed was produced, and this fragment was named nDsRed-kojA (SEQ ID NO: 3). The nDsRed-kojA fragment was cloned into the linearized vector pEX2B (Nguyen et al (2017) World J Microbiol Biotechnol, 33:107) with the promoter of Aspergillus oryzae amyB (PamyB) to obtain the plasmid pEX 2B-nDsRed-kojA.
2. Construction of Aspergillus oryzae CRISPR/Cas9 knockout strain containing nDsRed report vector
The recombinant plasmids pPTRII-Cas9-kojA and pEX2B-nDsRed-kojA were co-transformed into an Aspergillus oryzae 3.042 uridine/uracil auxotrophic mutant using the PEG-mediated protoplast method.
3. Aspergillus oryzae CRISPR/Cas9 knockout strain selected with aid of nDsRed
Transferring Aspergillus oryzae mycelium transferred with pPTRII-Cas9-kojA and pEX2B-nDsRed-kojA to CD culture medium containing 0.1 μ g/ml pyrithione, culturing for 3-5 days, collecting new mycelium, preparing into tablet, and directly preparing with ZOETMDetecting DsRed fluorescence (excitation at 556 +/-20 nm and emission at 615 +/-61 nm) of the transformant by a fluorescent cell imager (BIO-RAD), carrying out DsRed fluorescence primary screening on the transformant to obtain a candidate positive transformant, and then identifying the mutation of a kojA gene target site by using a primer kojA-F/R. The results of the fluorescent screen are shown in fig. 5, which shows the feasibility of using non-functional DsRed as a reporter gene to screen aspergillus oryzae CRISPR/Cas9 mutants.
In this example, 8 strains of nDsRed-kojA fluorescence-recovered transformants were obtained by fluorescence screening of 14 Aspergillus oryzae transformants (kojA-1 to koj-14), as shown in FIG. 6. The results of sequencing verification of the above 14 Aspergillus oryzae transformants (kojA-1 to koj-14) are shown in FIG. 7.
It should be understood that the above-mentioned embodiments of the present invention are only examples for clearly illustrating the present invention, and are not intended to limit the embodiments of the present invention, and it will be obvious to those skilled in the art that other variations or modifications may be made on the basis of the above description, and all the embodiments of the present invention are not exhaustive, and all the obvious variations or modifications which are introduced in the technical scheme of the present invention are within the scope of the present invention.
Sequence listing
<110> university of science and technology in Jiangxi
Institute of horticulture, Jiangxi Academy of Agricultural Sciences
<120> method for efficiently identifying Aspergillus oryzae CRISPR/Cas9 mutant
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 4218
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
atggattaca aggatgacga cgataagatc atggccccaa agaagaagcg gaaggtcggt 60
atccacggag tcccagcagc cgacaagaag tactccatcg gtctcgacat cggtaccaac 120
tccgtcggtt gggccgtcat caccgacgag tacaaggtcc cctccaagaa gttcaaggtc 180
ctcggtaaca ccgaccgtca ctccatcaag aagaacctca tcggtgccct cctcttcgac 240
tccggtgaga ccgccgaggc cacccgtctc aagcgtaccg cccgtcgtcg ttacacccgt 300
cgtaagaacc gtatctgcta cctccaggag atcttctcca acgagatggc taaggtcgat 360
gactccttct tccaccgtct cgaggagtcc ttcctcgtcg aggaggataa gaagcacgag 420
cgtcacccca tcttcggtaa catcgtcgac gaggtcgcct accacgagaa gtaccccacc 480
atctaccacc tccgtaagaa gcttgtcgac tctactgata aggctgacct tcgtctcatc 540
tacctcgccc tcgcccacat gatcaagttc cgtggtcact tcctcatcga gggtgacctc 600
aaccctgaca actccgatgt cgacaagctc ttcatccagc tcgttcagac ttacaaccag 660
ctcttcgaag agaaccccat caacgcttcc ggtgttgacg ccaaggccat cctctccgct 720
cgtctctcca agtcccgtcg tctcgagaac ctcatcgctc agctccctgg tgagaagaag 780
aacggtctct tcggtaacct tatcgccctc tctctcggtc tcacccccaa cttcaagtcc 840
aacttcgacc tcgccgagga tgccaagctt cagctctcca aggacaccta cgatgacgat 900
ctcgacaacc tcctcgccca gatcggtgac cagtacgctg acctcttcct tgccgctaag 960
aacctctccg acgccatcct cctctccgat atcctccgtg tcaacaccga gatcaccaag 1020
gctcccctct ccgcttctat gatcaagcgt tacgatgagc accaccagga cctcactctt 1080
ctcaaggccc ttgtccgtca gcagctccct gagaagtaca aggagatctt cttcgatcag 1140
tccaagaacg gttacgccgg ttacatcgac ggcggtgctt cccaggagga gttctacaag 1200
ttcatcaagc ccatcctcga gaagatggac ggtaccgagg agctcctcgt caagctcaac 1260
cgtgaggatc tcctccgtaa gcagcgtact ttcgacaacg gttccatccc ccaccagatc 1320
caccttggcg aactccacgc tatcctccgt cgtcaggagg acttctaccc cttcctcaag 1380
gacaaccgtg agaagatcga gaagatcctc accttccgta tcccctacta cgttggcccc 1440
ctcgcccgtg gtaactcccg tttcgcctgg atgactcgta agtccgaaga gaccatcact 1500
ccctggaact tcgaggaagt cgtcgataag ggtgcctctg cccagtcctt catcgagcgt 1560
atgactaact tcgacaagaa cctccctaac gagaaggtcc ttcctaagca ctctctcctt 1620
tacgagtact tcactgttta caacgagctc accaaggtca agtacgtcac cgaaggtatg 1680
cgtaagcccg ccttcctctc tggtgagcag aagaaggcta tcgtcgacct cctcttcaag 1740
accaaccgta aggttaccgt caagcagctc aaggaagact acttcaagaa gatcgagtgc 1800
ttcgactccg ttgagatctc cggtgtcgag gatcgtttca acgcttccct cggtacctac 1860
cacgatctcc tcaagatcat caaggacaag gacttcctcg acaacgagga gaacgaggac 1920
atccttgagg acatcgtcct cacccttacc ctcttcgagg atcgtgagat gatcgaagaa 1980
cgtctcaaga cttacgctca cctcttcgac gacaaggtca tgaagcagct caagcgtcgt 2040
cgttacactg gttggggccg tctctcccgt aagctgatca acggcatccg tgacaagcag 2100
tctggtaaga ctatcctcga cttccttaag tccgatggtt tcgccaaccg taacttcatg 2160
cagctcatcc acgacgactc tctcaccttc aaggaggaca tccagaaggc tcaggtttcc 2220
ggtcagggtg actcccttca cgagcacatc gctaacctcg ccggttcccc cgctatcaag 2280
aagggtatcc tccagaccgt taaggtcgtc gatgagctcg tcaaggttat gggtcgtcac 2340
aagcccgaga acatcgttat cgagatggcc cgtgagaacc agactaccca gaagggtcag 2400
aagaactctc gtgaacgtat gaagcgtatc gaggagggta tcaaggaact cggctcccag 2460
atccttaagg agcaccccgt cgagaacacc cagcttcaga acgagaagct ctacctctac 2520
tacctccaga acggccgtga catgtacgtt gatcaggagc tcgacatcaa ccgtctctcc 2580
gactacgacg tcgatcacat cgtcccccag tccttcctca aggatgactc tatcgacaac 2640
aaggtcctca cccgttccga taagaaccgt ggcaagtctg acaacgtccc ctccgaagag 2700
gttgtcaaga agatgaagaa ctactggcgt cagcttctca acgccaagct catcacccag 2760
cgtaagttcg ataacctcac taaggctgaa cgtggtggcc tctctgagct cgacaaggcc 2820
ggcttcatca agcgtcagct tgttgagact cgtcagatca ccaagcacgt cgcccagatt 2880
ctcgactctc gcatgaacac caagtacgat gagaacgaca agctcatccg tgaggtcaag 2940
gttatcactc tcaagtctaa gctcgtctcc gacttccgta aggacttcca gttctacaag 3000
gtccgtgaga tcaacaacta ccaccacgcc cacgatgcct acctcaacgc tgtcgttggc 3060
actgctctta tcaagaagta ccccaagctt gagtccgagt tcgtctacgg tgactacaag 3120
gtctacgatg ttcgtaagat gatcgctaag tccgagcagg agatcggtaa ggccaccgct 3180
aagtacttct tctactccaa catcatgaac ttcttcaaga ccgagatcac cctcgccaac 3240
ggtgagatcc gtaagcgtcc cctcatcgag accaacggtg agactggtga gatcgtctgg 3300
gacaagggtc gtgacttcgc cactgtccgt aaggtcctct ccatgcccca ggtcaacatc 3360
gtcaagaaga ccgaggtcca gaccggtggc ttctccaagg aatctatcct ccccaagcgt 3420
aactccgaca agctcatcgc tcgcaagaag gactgggacc ccaagaagta cggcggtttc 3480
gactctccca ctgtcgctta ctccgtcctc gttgtcgcca aggtcgagaa gggtaagtct 3540
aagaagctca agtccgtcaa ggagctcctc ggcatcacca tcatggagcg ttcctccttc 3600
gagaagaacc ccatcgactt cctcgaggcc aagggttaca aggaggtcaa gaaggacctc 3660
atcatcaagc ttcccaagta ctccctcttc gagcttgaga acggtcgtaa gcgtatgctc 3720
gcttccgccg gtgagctcca gaagggtaac gagctcgctc tcccctccaa gtacgtcaac 3780
ttcctctacc tcgcctccca ctacgagaag ctcaagggtt ctcccgaaga caacgagcag 3840
aagcagctct tcgtcgagca gcacaagcac taccttgatg agatcatcga gcagatctcc 3900
gagttctcca agcgtgtcat cctcgccgac gctaacctcg ataaggtcct ctccgcttac 3960
aacaagcacc gtgacaagcc catccgtgag caggctgaga acatcatcca cctcttcact 4020
ctcaccaacc ttggtgcccc tgctgccttc aagtacttcg acaccaccat cgaccgtaag 4080
cgttacacct ctaccaagga ggtcctcgac gccactctca tccaccagtc cattaccggt 4140
ctctacgaga ctcgtatcga cctctctcag ctcggtggtg actcccgtgc tgaccccaag 4200
aagaagcgta aggtctga 4218
<210> 2
<211> 214
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gttttagagc tagaaatagc aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt 60
ggcaccgagt cggtgctttt tttttgagca tttatcagct tgatatagag gtaggaatgt 120
atggaggtgc agaatggcta ttttgttatt ggagcgggtt cgaaacggag ggcaggagac 180
tttttctaaa tacgtcacgt gatatagagc tgct 214
<210> 3
<211> 701
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
atgcgtctca cagaacttga ccaagggcct cctccgagga cgtcatcaag gagttcatgc 60
gcttcaaggt gcgcatggag ggctccgtga acggccacga gttcgagatc gagggcgagg 120
gcgagggccg cccctacgag ggcacccaga ccgccaagct gaaggtgacc aagggcggcc 180
ccctgccctt cgcctgggac atcctgtccc cccagttcca gtacggctcc aaggtgtacg 240
tgaagcaccc cgccgacatc cccgactaca agaagctgtc cttccccgag ggcttcaagt 300
gggagcgcgt gatgaacttc gaggacggcg gcgtggtgac cgtgacccag gactcctccc 360
tgcaggacgg ctccttcatc tacaaggtga agttcatcgg cgtgaacttc ccctccgacg 420
gccccgtaat gcagaagaag actatgggct gggaggcctc caccgagcgc ctgtaccccc 480
gcgacggcgt gctgaagggc gagatccaca aggccctgaa gctgaaggac ggcggccact 540
acctggtgga gttcaagtcc atctacatgg ccaagaagcc cgtgcagctg cccggctact 600
actacgtgga ctccaagctg gacatcacct cccacaacga ggactacacc atcgtggagc 660
agtacgagcg cgccgagggc cgccaccacc tgttcctgta g 701
