1. A chimeric antigen receptor comprising, in order, an extracellular antigen-binding domain, a transmembrane domain, and an intracellular activation domain;

the extracellular antigen-binding domain comprises a signal peptide and/or an scFv targeting EGFRvIII;

transmembrane domains include CD8 α;

the intracellular activation domain comprises at least one of TIR, CD3ZETA or GM-CSFR α/β.

2. The chimeric antigen receptor according to claim 1, wherein the signal peptide is expressed by the nucleotide sequence shown in SEQ ID No. 1;

the scFv is expressed by a nucleotide sequence shown in SEQ ID NO. 2;

preferably, the CD8 alpha is expressed by the nucleotide sequence shown in SEQ ID NO. 3.

3. The chimeric antigen receptor according to claim 1, wherein the TIR comprises an intracellular signaling domain derived from TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, TLR13, or TLR 19;

the intracellular signal transduction domain of the TLR4 is expressed by a nucleotide sequence shown in SEQ ID NO. 4;

the CD3ZETA is expressed by a nucleotide sequence shown in SEQ ID NO. 5;

the GM-CSF alpha/beta is expressed by the nucleotide sequence shown in SEQ ID NO. 6.

4. A method for macrophage polarization, wherein the chimeric antigen receptor of any one of claims 1-3 is expressed in macrophages.

5. A macrophage cell comprising the chimeric antigen receptor of any one of claims 1-3.

6. The method of producing macrophages according to claim 5, comprising the steps of: constructing a lentivirus expression system containing the gene expression sequence of the chimeric antigen receptor, integrating the gene expression sequence of the chimeric antigen receptor into the pluripotent stem cells by using the lentivirus expression system, and preparing macrophages after induced differentiation;

preferably, the pluripotent stem cells are induced to differentiate into monocytes and then into macrophages.

7. A pluripotent stem cell capable of differentiating to give a macrophage according to claim 5, wherein the pluripotent stem cell comprises a gene encoding the chimeric antigen receptor.

8. A monocyte capable of differentiating to give the macrophage of claim 5, wherein said monocyte comprises a gene encoding said chimeric antigen receptor;

the mononuclear cells are differentiated from pluripotent stem cells.

9. Use of the macrophage of claim 5, the pluripotent stem cell of claim 7 or the monocyte of claim 8 in the manufacture of a product for treating glioma.

10. A product for use in the treatment of glioma, wherein said product comprises the macrophage of claim 5.

Background

Glioblastoma (GBM), which is believed to originate from glial progenitor cells, is the most common and most aggressive primary brain tumor that has been found to date. The incidence rate of the tumor is 12 to 15 percent of that of intracranial tumors and 50 to 60 percent of that of astrocytic tumors. The median survival of patients with this tumor was about 15 months with a 5-year survival rate of less than 10%. Therefore, the tumor constitutes a great threat to human life health. Although the existing treatment method aiming at GBM has the means of surgery, radiotherapy, chemotherapy and the like, the tumor infiltrates and grows to the deep part of the brain lobe and has the characteristics of rapid growth, easy relapse and the like, so the effect is very little, and the secondary injury which is difficult to recover is easily caused to the brain of a patient.

Recently emerging tumor immune cell therapies represented by chimeric antigen receptor T cells (CAR-T) have gradually played an increasingly important role in clinical treatment of tumors, and particularly, exhibited better therapeutic effects in the treatment of hematological cancers. Meanwhile, studies have attempted to extend the survival of GBM-bearing mice by developing CAR-ts that target the GBM-specific antigen EGFRvIII. However, despite the current considerable search for CAR-T therapy in the treatment of a number of solid tumors including GBM, its efficacy is not ideal. The main reasons for this are: 1. off-target effects that may occur in the treatment of adoptively transplanted CAR-T cells; t cells have poor infiltration on solid tumors; t cells have difficulty penetrating the blood brain barrier; 4. factors such as the high complexity of solid tumors and the anaerobic microenvironment lead to the appearance of a difficult to recover depletion of cytotoxic T cells. Therefore, there is an urgent need to find new alternatives for immune cell therapy.

Macrophages, which are nonspecific immune cells with the same tumor cell killing ability, are becoming a new choice for immune cell engineering modification due to their core role in the interaction between the adoptive immune system and the innate immune system, strong plasticity, easy breakthrough of the blood brain barrier, and more effective infiltration to tumor tissue sites and long-term persistence. However, the following problems exist in adoptive transplantation with macrophages: 1. m1 type macrophages with cellular immune function are easy to polarize to M2 state under the influence of the tumor microenvironment, so that the immune function is lost, and the occurrence and development of tumors are promoted; 2. the traditional method for the patient autoimmune cell reinfusion treatment has the problems of few cell sources, low separation efficiency, great modification difficulty, time and labor consumption and the like, and primary macrophages are difficult to be genetically engineered through a lentivirus infection way.

In view of the above, the present invention is particularly proposed.

Disclosure of Invention

The first purpose of the invention is to provide a chimeric antigen receptor, which can endow macrophages with the property of targeting GBM, reduce off-target effect, promote and maintain the M1 polarization state of the macrophages in a tumor microenvironment, and improve killing efficiency of the macrophages.

The second purpose of the invention is to provide a macrophage polarization method, which is simple and can realize M1 polarization of macrophages.

A third object of the present invention is to provide a macrophage cell to solve at least one of the above problems.

The fourth purpose of the invention is to provide a preparation method of macrophage.

The fifth object of the present invention is to provide a pluripotent stem cell.

The sixth object of the present invention is to provide a monocyte.

The seventh purpose of the invention is to provide the application of the macrophage or the pluripotent stem cell in preparing products for treating glioma.

An eighth object of the present invention is to provide a product for the treatment of glioma.

In a first aspect, the present invention provides a chimeric antigen receptor comprising an extracellular antigen-binding domain, a transmembrane domain and an intracellular activation domain connected in sequence;

the extracellular antigen-binding domain comprises a signal peptide and/or an scFv targeting EGFRvIII;

transmembrane domains include CD8 α;

the intracellular activation domain comprises at least one of TIR, CD3ZETA or GM-CSFR α/β.

As a further technical scheme, the signal peptide is expressed by a nucleotide sequence shown in SEQ ID NO. 1;

the scFv is expressed by a nucleotide sequence shown in SEQ ID NO. 2.

As a further technical scheme, the CD8 alpha is expressed by a nucleotide sequence shown in SEQ ID NO. 3.

As a further embodiment, the TIR comprises an intracellular signaling domain derived from TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, TLR13, or TLR 19;

the intracellular signal transduction domain of the TLR4 is expressed by a nucleotide sequence shown in SEQ ID NO. 4;

the CD3ZETA is expressed by a nucleotide sequence shown in SEQ ID NO. 5;

the GM-CSFR alpha/beta is expressed by the nucleotide sequence shown in SEQ ID NO. 6.

In a second aspect, the invention provides a method for the polarization of macrophages by expressing chimeric antigen receptors in the macrophages.

In a third aspect, the invention provides a macrophage including a chimeric antigen receptor.

In a fourth aspect, the present invention provides a method for preparing macrophages, comprising the steps of: constructing a lentivirus expression system containing the gene expression sequence of the chimeric antigen receptor, integrating the gene expression sequence of the chimeric antigen receptor into the pluripotent stem cells by using the lentivirus expression system, and preparing macrophages after induced differentiation;

preferably, the pluripotent stem cells are induced to differentiate into monocytes and then into macrophages.

In a fifth aspect, the present invention provides a pluripotent stem cell capable of differentiating into the above-mentioned macrophage, the pluripotent stem cell comprising a gene encoding the chimeric antigen receptor.

In a sixth aspect, the present invention provides a monocyte capable of differentiating to obtain the above-mentioned macrophage, said monocyte comprising a gene encoding said chimeric antigen receptor;

the mononuclear cells are differentiated from pluripotent stem cells.

In a seventh aspect, the invention provides the use of a macrophage, pluripotent stem cell or monocyte in the manufacture of a product for the treatment of glioma.

In an eighth aspect, the invention provides a product for use in the treatment of glioma, said product comprising the above-mentioned macrophage.

Compared with the prior art, the invention has the following beneficial effects:

the invention provides a chimeric antigen receptor which is special for macrophages and comprises an extracellular antigen binding domain, a transmembrane domain and an intracellular activation domain which are connected in sequence. Wherein the extracellular antigen-binding domain comprises a signal peptide which can help the CAR protein sequence to be positioned on the surface of a cell membrane and/or a scFv which can specifically recognize a cell membrane surface protein EGFRvIII specifically expressed by GBM; the transmembrane domain comprises CD8 α, linking the extracellular antigen-binding domain and the intracellular activation domain; the intracellular activation domain comprises at least one of TIR, CD3ZETA or GM-CSFR alpha/beta, the macrophage is promoted to be polarized to M1 type, the chimeric antigen receptor provided by the invention is introduced into the macrophage, the immunosuppressive effect of the immune cell on the tumor microenvironment is enhanced while the targeted killing effect of the macrophage on the GBM is given, and the M1 polarization state is effectively promoted and maintained.

The invention provides a macrophage polarization method, which is simple and effective by expressing the chimeric antigen receptor in the macrophage to realize M1 polarization of the macrophage.

The invention provides a macrophage, which can express the chimeric antigen receptor provided by the invention, can maintain the polarization state of M1, and has strong targeted killing property on GBM.

The inventor researches and discovers that primary macrophages are difficult to be infected by lentiviruses and difficult to be edited and engineered, and based on the facts, the invention provides a preparation method of the macrophages.

The invention provides a pluripotent stem cell, which contains a gene for coding the chimeric antigen receptor, has a state more inclined to a proinflammatory tumor inhibiting M1 state, can be further differentiated to obtain macrophages, and is more favorable for inhibiting tumors.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 shows construction U87MG^EGFRvIIIA cell line; a: constructing an EGFRvIII lentivirus expression system; b: western Blotting to detect the expression level of total EGFR in U87MG cells after lentivirus infection; c: western Blotting to detect the expression level of total EGFRvIII in U87MG cells after lentivirus infection; d: immunofluorescence detection experiments show that EGFRvIII is positioned on the surface of a cell membrane after being over-expressed in U87MG cells;

FIG. 2 is the construction of CAR-iMAC and examination of its non-specific basal phagocytic function; a: 3, constructing a CAR with different intracellular activation signal transduction domains and capable of targeting a GBM specific membrane protein EGFRvIII; b: the ipscs stably overexpressing CAR induced differentiation into CAR-iMAC; c: CAR-imac (egfp) phagocytosis of U87MG (tdTomato) cells in vitro;

FIG. 3 is CAR-iMAC in vitro targeted killing U87MG^EGFRvIIIA cell line; a: results after 12 hours of in vitro co-culture; b: confocal scanning results;

FIG. 4 is CAR-iMAC in vitro targeted killing U87MG^EGFRvIIIFlow analysis and ELISA experimental results of cell lines; a: counting the survival number of the tumor cells after 24 hours of co-culture by using a flow analysis technology; b: performing data statistical analysis on the proportion of the residual tumor cells in the A; c: survival of tumor cells; d: detecting the release condition of the immune activating factor by an ELISA experiment;

FIG. 5 is a test of iMAC from iPSC in vivo survival time and solid tumor tissue infiltration; a: live imaging detection of survival signals and time of imacs; b: counting survival curves of iMAC in A by data; c: an experimental flow chart; d: infiltration of iMAC in tumor tissue; e: detecting the infiltration condition of iMAC in the tumor tissue by an immunohistochemical experiment;

FIG. 6 demonstrates the tumor killing effect of CAR-iMAC in GBM mouse tumor model; a: the killing effect of the three CAR-iMAC on GBM (Luciferin Biotin luminescence) respectively; b: changes in tumor signal; c: time to survival of GBM mice following different CAR-iMAC treatments;

FIG. 7 is a block diagram of CD8-GM-CSFR α/β -CAR and its activation schematic;

FIG. 8 is a graph demonstrating the effects of CD8-GM-CSFR α/β -CAR-iMAC targeted killing and CAR-dependent immune activation in vitro;

figure 9 is a structural schematic of a three-generation CAR designed in the present invention, and a comparative schematic of different CAR-iMAC dependent immune activation on CARs.

Detailed Description

Embodiments of the present invention will be described in detail below with reference to embodiments and examples, but those skilled in the art will understand that the following embodiments and examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention. Those who do not specify the conditions are performed according to the conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

In the present application, the term "Macrophage (Macrophage)" generally refers to a myeloid immune cell that develops after a Monocyte (Monocyte) exits a blood vessel and is widely distributed in various organs of body tissues. Its main physiological roles in normal tissues are: mediating specific immune responses by means of processing and presenting antigens; phagocytosis and degradation of necrotic cells, debris and foreign bodies in the form of fixed cells or free cells, which then participate in non-specific reactions in the body; the process of inflammation is coordinated by the secretion of inflammatory factors that activate lymphocytes or other immune cells.

In the present application, the term "Chimeric Antigen Receptor (CAR)" generally means that it is composed mainly of three parts, an extracellular membrane-binding region, a transmembrane region and an intracellular signaling region. The extracellular domain is a single chain variable domain (scFv) with the function of targeting and binding to the TAA of tumor specific antigen. The transmembrane region is typically composed of the immunoglobulin superfamily, such as CD8 or CD 28. The intracellular signaling region is mainly composed of an intracellular signaling domain of an activation receptor which can activate immune cells, such as a costimulatory factor (4-1BB or CD28) specific to T cells and a signaling activation region CD3 zeta. After the immune cells loaded with the chimeric antigen receptor are specifically combined with the surface antigen of the tumor cells, the extramembranous antigen binding region transmits signals to the intracellular signal activation region, and then the immune cell activation reaction is started.

In the present application, the term "polarization of macrophages" generally refers to the conversion of macrophages to different functional phenotypes in response to various environmental factors (e.g., microbial products, damaged cells, activated lymphocytes) or under different pathophysiological conditions, namely classical activated macrophages (M1) and selective activated macrophages (M2). Mature macrophages exhibit phenotypic and morphological differentiation, i.e., macrophage polarization, under various factors. Macrophages are predominantly activated to both the M1 and M2 phenotypes in response to environmental stimuli. Under the long-term tumor microenvironment, the M1 type is obtained through the activation of IFN-gamma, LPS and other signals, mainly has the functions of resisting tumor and enhancing immunity, and can secrete inflammatory factors, chemokines, effector molecules, TNF-alpha and the like, wherein the membrane molecules CD80, surface markers CD64 and the like are taken as representatives. The M2 type is obtained by the activation of factors such as IL-4 and IL-13, mainly has the potential of inhibiting immune response, promoting angiogenesis, tissue repair and promoting tumor growth, more factors such as IL-10, TGF-beta, VEGF and the like are secreted, and the factors are relatively highly expressed as CD163 and CD 206.

In the present application, the term "Induced Pluripotent Stem Cell (iPSC)" generally refers to a pluripotent stem cell having the potential to differentiate into various cells, which is obtained by transferring a pluripotency factor in an adult cell and then reprogramming an initial genome expression profile.

In the present application, the term "iMAC" generally refers to Macrophage derived from iPSC-induced differentiation.

In the present application, the term "monocyte" refers to a cell differentiated from hematopoietic stem cells in bone marrow and developed in bone marrow. Can be further differentiated into mature macrophages and dendritic cells. Monocytes have the characteristic of marked anamorphic movement and have the ability to phagocytose and remove injured, senescent cells and their debris. In addition, monocytes also participate in immune responses, which transfer antigenic determinants carried by phagocytosed antigens to lymphocytes, which in turn induce specific immune responses of the lymphocytes. Monocytes also have the ability to recognize and kill tumor cells.

In a first aspect, the present invention provides a chimeric antigen receptor comprising an extracellular antigen-binding domain, a transmembrane domain and an intracellular activation domain connected in sequence;

the extracellular antigen-binding domain comprises a signal peptide and/or an scFv targeting EGFRvIII;

transmembrane domains include CD8 α;

the intracellular activation domain comprises at least one of TIR, CD3ZETA or GM-CSFR α/β.

The invention provides a chimeric antigen receptor, wherein an extracellular antigen binding domain comprises a signal peptide and/or scFv, the signal peptide can help a CAR protein sequence to be positioned on the surface of a cell membrane, and the scFv can specifically recognize a cell membrane surface protein EGFRvIII specifically expressed by GBM; the transmembrane domain comprises CD8 α, linking the extracellular antigen-binding domain and the intracellular activation domain; the intracellular activation domain comprises TIR, CD3ZETA or GM-CSFR alpha/beta, promotes the polarization of macrophages to M1 type, introduces the chimeric antigen receptor provided by the invention into the macrophages, and enhances the immunosuppressive effect of immune cells against tumor microenvironment while endowing the macrophages with the targeted killing effect on GBM, thereby effectively promoting and maintaining the M1 polarization state of the immune cells.

As a further technical scheme, the signal peptide is expressed by a nucleotide sequence shown in SEQ ID NO. 1;

the scFv is expressed by a nucleotide sequence shown in SEQ ID NO. 2.

As a further technical scheme, the CD8 alpha is expressed by a nucleotide sequence shown in SEQ ID NO. 3.

As a further embodiment, the TIR includes, but is not limited to, an intracellular signaling domain derived from TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, TLR13, or TLR 19;

the intracellular signal transduction domain of the TLR4 is expressed by a nucleotide sequence shown in SEQ ID NO. 4;

the CD3ZETA is expressed by a nucleotide sequence shown in SEQ ID NO. 5;

the GM-CSFR alpha/beta is expressed by the nucleotide sequence shown in SEQ ID NO. 6.

In a second aspect, the invention provides a method for the polarization of macrophages by expressing chimeric antigen receptors in the macrophages.

In the present invention, the method is simple and effective by expressing the above chimeric antigen receptor in macrophages to achieve M1 polarization of macrophages.

In a third aspect, the invention provides a macrophage including a chimeric antigen receptor.

The macrophage can express the chimeric antigen receptor provided by the invention, can maintain the polarization state of M1, and has strong targeted killing performance on GBM.

A schematic of the structure of a three-generation CAR designed in this invention, and a comparative schematic of different CAR-iMAC dependent immune activation on CARs is shown in figure 9.

The a display trunecate CAR in fig. 9 consists mainly of scFv domain that specifically recognizes EGFRvIII protein extracellularly and CD 8a transmembrane domain. Lacking an intracellular signaling domain. The first generation CARs consisted primarily of an scFv domain that specifically recognized the EGFRvIII protein extracellularly, a CD 8a transmembrane domain, and an intracellular CD3ZETA signaling domain. The second generation CARs consist primarily of an scFv domain that specifically recognizes the EGFRvIII protein extracellularly, a CD 8a transmembrane domain, and an intracellular signaling domain specific to macrophages. The intracellular signaling domain is a single TIR or GM-CSFR α/β activation domain, respectively. Third generation CARs are upgraded on top of second generation CARs. The difference is that the intracellular signal transduction structural domain of the third generation CAR is formed by connecting and combining CD3ZETA, TIR and GM-CSFR alpha/beta in pairs through a Linker, so as to achieve stronger and more durable immune activation effect.

B-E in fig. 9 shows a schematic of different CAR-iMAC dependent immune activation of CARs. Due to the lack of intracellular signaling domains, Truncate CAR-iMAC does not have CAR-dependent immune activation functions. After extracellular scFv targeted recognition of EGFRvIII by the first generation CAR, its intracellular CD3ZETA signaling domain is activated, which in turn initiates immune activation and small release of inflammatory factors of the first generation CAR-iMAC. Activation of TIR stimulates macrophage immune activation, releasing inflammatory factors such as IL1, IL6, TNF α, and the like, and is polarized to M1 type. Activation of GM-CSFR alpha/beta promotes the massive expansion of macrophages, immune activation, release of inflammatory factors such as IL12, IL23, TNF alpha and the like, and polarization to M1 type. Therefore, compared with the first generation CAR-iMAC, the second generation CAR-iMAC has the advantages that after EGFRvIII is targeted, the survival amplification, M1 polarization, immune activation and other anti-tumor capabilities are remarkably improved in a tumor microenvironment. When the extracellular scFv of the third-generation CAR recognizes EGFRvIII in a targeted manner, 2 signal transduction domains in TIR, CD3ZETA and GM-CSFR alpha/beta in the cell synergistically play a role in immune activation, and the advantages of different immune activation signal paths can be utilized to further play a stronger and more durable immune activation effect.

In a fourth aspect, the present invention provides a method for preparing macrophages, comprising the steps of: constructing a lentivirus expression system containing the gene expression sequence of the chimeric antigen receptor, integrating the gene expression sequence of the chimeric antigen receptor into the pluripotent stem cells by using the lentivirus expression system, and preparing macrophages after induced differentiation;

preferably, the pluripotent stem cells are induced to differentiate into monocytes and then into macrophages.

The inventor researches and discovers that primary macrophages are difficult to infect by lentiviruses and difficult to edit and engineer, and based on the facts, the invention provides the preparation method of the macrophages.

In a fifth aspect, the present invention provides a pluripotent stem cell capable of differentiating into the above-mentioned macrophage, the pluripotent stem cell comprising a gene encoding the chimeric antigen receptor.

Because the pluripotent stem cell contains the gene for coding the chimeric antigen receptor, the state of the pluripotent stem cell is more prone to the M1 state of proinflammatory tumor inhibition, and the pluripotent stem cell can be further differentiated to obtain macrophages and is more beneficial to tumor inhibition.

In a sixth aspect, the present invention provides a monocyte capable of differentiating to obtain the above-mentioned macrophage, said monocyte comprising a gene encoding said chimeric antigen receptor;

the mononuclear cells are differentiated from pluripotent stem cells.

In a seventh aspect, the invention provides the use of a macrophage, pluripotent stem cell or monocyte in the manufacture of a product for the treatment of glioma.

The macrophage provided by the invention can maintain the polarization state of M1 and has strong target killing property on GBM, so that the macrophage can be used for preparing a product for treating glioma, and the pluripotent stem cells can be differentiated to obtain the macrophage, so that the macrophage can also be used for preparing a product for treating glioma.

In an eighth aspect, the invention provides a product for use in the treatment of glioma, said product comprising the above-mentioned macrophage.

The macrophage provided by the invention can maintain the polarization state of M1, has strong target killing property on GBM, and products including the macrophage also have the effect of treating glioma.

The invention is further illustrated by the following specific examples and comparative examples, but it should be understood that these examples are for purposes of illustration only and are not to be construed as limiting the invention in any way.

Example 1

Constructing GBM cell line expressing EGFRvIII antigen.

An expression sequence of GBM specific membrane protein EGFRvIII is obtained, and is cloned into a lentivirus expression plasmid Lenti-EF1A-PGK-Puro by means of a molecular cloning method to construct an obtained EGFRvIII lentivirus expression system, as shown in A in figure 1. GBM specific membrane protein EGFRvIII is expressed in GBM cell lines U87MG and LN-229 by means of a lentivirus expression system to obtain U87MG stably expressing the membrane protein^EGFRvIIIA cell line.

Western Blotting was used to detect the expression levels of total EGFR and EGFRvIII in U87MG cells after lentiviral infection, and the experimental procedure was as follows:

1. preparation of samples of Total cellular protein

(1) Wild-type U87MG cells and U87MG cells overexpressing EGFRvIII by lentivirus were seeded into 6CM cell culture dishes at 37 ℃/5% CO₂Culturing in a cell culture box until the culture dish is full.

(2) The cell culture fluid was discarded with a pipette. 3ml of 4 ℃ pre-cooled 1 XPBS (0.01M pH 7.2-7.3) was added to each dish. The cells were washed by gentle shaking for 1min and then the wash solution was discarded. The above operation was repeated twice, and the cells were co-washed three times to wash out the culture solution. The PBS was discarded and the dishes were placed on ice.

(3) 500ul of RIPA lysate containing protease inhibitors was added to each cell culture dish and lysed on ice for 30min, and the dishes were gently shaken on a shaker to allow for sufficient lysis of the cells.

(4) After lysis, the cells were scraped to one side of the flask with a clean scraper (faster action) and the cell debris and lysate were then transferred to a 1.5ml centrifuge tube with a gun.

(5) Centrifuge at 12000rpm for 20min at 4 ℃.

(6) The centrifuged supernatant was aliquoted and transferred to a new 1.5ml centrifuge tube.

(7) 5 xSDS loading buffer containing beta-mercaptoethanol and having a final concentration of 1 x was added to the cell lysate obtained in the previous step. After mixing, the mixture was heated in a metal bath at 95 ℃ for 5 minutes to denature the protein. Storing at-20 deg.C or on ice for use.

SDS gel electrophoresis and membrane transfer

(8) A gel electrophoresis system was prepared, and 10ul each of the protein samples obtained in the previous step and 5ul of protein marker were added to the corresponding loading wells.

(9) Setting the electrophoresis condition as constant voltage of 100V, stopping electrophoresis until bromophenol blue just runs out, and carrying out membrane transfer.

(10) And (3) placing the gel obtained in the last step in a wet type membrane transferring system, and carrying out electric rotation for about 120 minutes under the condition of constant pressure of 100V, so that the protein in the gel is fully transferred to the PVDF membrane.

3 immune response

(11) And (3) quickly taking out the PVDF membrane transferred with the proteins in the last step, putting the PVDF membrane into a TBST solution, washing the PVDF membrane transfer solution, transferring the PVDF membrane into 5% skimmed milk prepared by TBST, and sealing the PVDF membrane for 1 hour at room temperature. During which the table is shaken gently on a horizontal shaker.

(12) The positions of target proteins (EGFRvIII, EFGR and internal reference beta-ACTIN) are predicted through the mark of a protein marker on PVDF, and membranes containing the target proteins are cut to be proper in size by scissors.

(13) The membranes containing the target protein obtained above were placed in 5% skim milk containing EGFRvIII, EFGR and β -ACTIN primary antibody, respectively, and incubated overnight (10-12 hours) at 4 ℃.

(14) The PVDF membrane incubated with the primary antibody was removed from the upper part and washed three times with TBST on a horizontal shaker at room temperature for 10 minutes each.

(15) According to the species matching principle, the PVDF membrane cleaned in the previous step is placed in 5% skimmed milk diluted with a secondary antibody which is derived from the same species and coupled with HRP, and is incubated for 1 hour in a shaking table at room temperature.

(16) The PVDF membrane incubated with the primary antibody was removed from the upper part and washed three times with TBST on a horizontal shaker at room temperature for 10 minutes each.

4 chemical imaging

(17) And (4) absorbing the TBST on the PVDF membrane cleaned in the previous step by using absorbent paper, wherein the front side of the TBST faces upwards, and placing the PVDF membrane in a chemiluminescence imager. And (3) quickly applying a proper amount of pre-prepared ECL chemiluminescence liquid to the front surface of the membrane by using a pipette. And after the imaging conditions are set, imaging and storing.

The results are shown in FIG. 1B and FIG. 1C, indicating that the constructed U87MG^EGFRvIIIIn cell lines, EGFR and EGFRvIII were highly expressed.

The immunofluorescence assay procedure was as follows:

the first day:

1. wild-type U87MG cells and U87MG cells overexpressing EGFRvIII by lentivirus were seeded into 24-well cell culture plates plated with cell crawlers.

2. At 37 deg.C/5% CO₂The cells were cultured in a cell incubator for 12 hours.

The next day:

3. slides that have crawled cells are washed 3 times with PBS for 3min each time in the culture plate.

4. Fixing the slide with 4% paraformaldehyde for 15min, and washing the slide with PBS for 3 times, each for 3 min.

5.0.5% Triton X-100 (in PBS) was permeabilized for 20min at room temperature (antigen expressed on cell membranes omitted this step).

PBS was soaked in the slide 3 times for 3min each, the PBS was blotted dry with absorbent paper, 2.5% BSA was added dropwise to the slide, and the slide was blocked at room temperature for 30min (or 37 ℃ for 20 min).

7. Absorbing sealing liquid by absorbent paper, and dripping enough diluted liquid on each glass slide without washing; EGFRvIII primary antibody is placed in a wet box and incubated overnight (typically greater than 18 hours) at 4 ℃ or at 37 degrees for 1-2 hours.

And on the third day:

8. adding a fluorescent secondary antibody: soaking PBST in the climbing sheet for 3 times (3 min each time), sucking the excessive liquid on the climbing sheet with absorbent paper, dripping diluted fluorescent secondary antibody, incubating at 20-37 deg.C for 1h in a wet box, and soaking PBST in the climbing sheet for 3 times (3 min each time); note that: all subsequent processing steps were performed as dark as possible from the addition of the fluorescent secondary antibody.

9. Counterstaining the nucleus: adding DAPI dropwise, incubating for 5min in a dark place, staining the specimen for nucleus, and washing off redundant DAPI for 5minx4 times by PBST; 8. and (3) absorbing the liquid on the slide by using absorbent paper, sealing the slide by using sealing liquid containing an anti-fluorescence quenching agent, and observing and acquiring an image under a fluorescence microscope.

Immunofluorescence detection experiments showed that EGFRvIII was localized to the cell membrane surface after overexpression in U87MG cells (D in fig. 1).

Example 2

CAR-iMAC is constructed, and the targeting killing function of the CAR-iMAC on the GBM cell line is explored through in vitro experiments.

1. Method for constructing induced differentiation of iPSC into iMAC

1) Reprogramming PBMCs to iPSCs

PBMC separated from fresh blood has the advantages of large quantity and easy acquisition, and is an excellent material for inducing iPSC. After PBMC is obtained through separation, expression vectors expressing five transcription factors including OCT3/4, SOX2, KLF4, L-MYC and LIN28A are transfected into the PBMC through an electrotransfer method to induce reprogramming of the PBMC, and iPSC is finally obtained.

2) The following experimental steps were performed based on the induction of iPSC differentiation into monocytes (imoo) and M1-type macrophages (iMAC) by pseudoligand (EB) formation:

EB formation (day 0). When the ipscs were cultured to cover 60-80% of the area of the dish, they were digested into single cells or smaller clumps of cells using versene. After centrifugation at 600rpm/3min, it was resuspended in mTeSR1 medium containing Y-27632 and placed in a 1:2 or 1:3 into a six well low adsorption plate. At 37 deg.C/5% CO₂In the incubator, shaking culture was performed for about 24 hours. EB can be formed.

2. Primitive streak and mesoderm induction (day 1). The medium used to culture the EBs in step 1 was removed. MI medium (APEL II medium +10ng/mL BMP4+5ng/mL bFGF) was added. The cultivation was continued under the conditions of step 1 for 24 hours.

3. Hematopoietic Stem Cell (HSC) induction (days 2-7). The MI medium in step 2 was removed. HS medium (APEL II medium +10ng/mL BMP4+5ng/mL bFGF +50ng/mL VEGF +100ng/mL SCF) was added. The culture was continued under the conditions of step 1.

4. Myeloid cells and Mononuclear Precursor Cells (MPCs) were expanded (days 8-10). The HS medium in step 3 is removed. ME-1 medium (APEL II medium +5ng/mL bFGF +50ng/mL VEGF +100ng/mL SCF +10ng/mL IGF1+25ng/mL IL-3+50ng/mL M-CSF +50ng/mL GM-CSF) was added. The culture was continued under the conditions of step 1.

Induction of iMONO (about day 11). The EBs from step 4 were transferred to Matrigel (Matrigel) coated six well plates. ME-2 medium (StemBan-XF medium +5ng/mL bFGF +50ng/mL VEGF +100ng/mL SCF +10ng/mL IGF1+25ng/mL IL-3+50ng/mL M-CSF +50ng/mL GM-CSF) was added at 37 ℃/5% CO₂And (5) standing and culturing in an incubator. During this time there will be a constant floating of the mono in the medium in the single cell state. And (5) changing the liquid and centrifuging to collect iMONO.

Maturation of iMAC (ca. 17 th). The iMONO collected in step 5 was collected into a new Matrigel coated six well plate. MM medium (StemBan-XF medium +5ng/mL bFGF +50ng/mL VEGF +100ng/mL SCF +10ng/mL IGF1+25ng/mL IL-3+100ng/mL M-CSF +100ng/mL GM-CSF) was added at 37 ℃/5% CO₂And (5) standing and culturing in an incubator. During this time period, the smaller iMONO will be seen maturing into the larger and vacuolated iMAC.

M1 polarization of iMAC. The iMAC matured in step 6 was collected and the polarized iMAC was obtained approximately 24 hours after addition of MS medium (RPMI1640+100ng/mL M-CSF +100ng/mL GM-CSF) containing 100ng/mL LPS and 100ng/mL IFN- γ.

This process only requires 13-28 days to induce differentiation. There will be constant iMONO and iMAC production during this time. Therefore, the iMONO and iMAC with high differentiation efficiency and good activity provide guarantee for the follow-up large-scale immune cell demand.

3) Testing macrophage characteristics of iMAC from iPSC

The iSC is successfully induced and differentiated into M1 type iMAC by the methods of detecting iMAC surface marker antigen by a flow analysis technology, analyzing iMAC gene expression profile by a single cell RNA-seq technique, detecting cytokine secretion by an ELISA technology and the like.

2. Construction of CAR-iMONO or CAR-iMAC with Targeted GBM function

1) Design of chimeric antigen receptor for specifically recognizing EGFRvIII

Obtaining the gene expression sequence of sc-Fv targeting EGFRvIII. The sequence is cloned into a lentivirus expression plasmid Lenti-EF1A-T2A-EGFP-Puro by combining a transmembrane domain gene expression sequence of CD8 alpha and a TIR and CD3ZETA domain expression sequence by a molecular cloning method to form a fusion expressed CAR sequence (A in figure 2). Meanwhile, a CAR without an intracellular activation domain (scFv-CD8-DELTA-CAR) was designed as a negative control to examine whether the intracellular signaling domain can exert an immune activation function.

Wherein the signal peptide is a short peptide chain containing a hydrophobic amino acid sequence. Has the function of guiding newly synthesized protein to pass through membrane or be secreted to the outside of cell. The expression sequence of the signal peptide is expressed by a nucleic acid sequence shown in SEQ ID NO. 1:

ATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCTGGCCTTGCTGCTCCACGCCGCCAGGCCG(SEQ ID NO.1)。

the expression sequence of sc-Fv is expressed by the nucleotide sequence shown in SEQ ID NO. 2:

GACATCCAGATGACCCAGAGCCCTAGCAGCCTGAGCGCCAGCGTGGGCGACAGAGTGACCATCACCTGTCGGGCCAGCCAGGGCATCAGAAACAACCTGGCCTGGTATCAGCAGAAGCCCGGCAAGGCCCCCAAGAGACTGATCTACGCTGCCAGCAATCTGCAGAGCGGCGTGCCCAGCAGATTCACCGGAAGCGGCTCCGGCACCGAGTTCACCCTGATCGTGTCCAGCCTGCAGCCCGAGGACTTCGCCACCTACTACTGCCTGCAGCACCACAGCTACCCTCTGACCAGCGGCGGAGGCACCAAGGTGGAGATCAAGCGGACCGGCAGCACCAGCGGCAGCGGCAAGCCTGGCAGCGGCGAGGGAAGCGAGGTCCAGGTGCTGGAATCTGGCGGCGGACTGGTGCAGCCTGGCGGCAGCCTGAGACTGAGCTGTGCCGCCAGCGGCTTCACCTTCAGCAGCTACGCCATGTCTTGGGTCCGGCAGGCTCCTGGAAAGGGCCTGGAATGGGTGTCCGCCATCAGCGGCTCTGGCGGCTCCACCAACTACGCCGACAGCGTGAAGGGCCGGTTCACCATCAGCCGGGACAACAGCAAGAACACCCTGTATCTGCAGATGAACAGCCTGAGAGCCGAGGACACCGCCGTGTACTACTGTGCCGGCAGCAGCGGGTGGAGCGAGTACTGGGGCCAGGGCACACTGGTCACAGTGTCTAGC(SEQ ID NO.2)。

CD8 alpha is expressed by the nucleotide sequence shown in SEQ ID NO. 3:

ATCTACATCTGGGCGCCCTTGGCCGGGACTTGTGGGGTCCTTCTCCTGTCACTGGTTATCACCCTTTACTGC(SEQ ID NO.3)。

TIR is expressed by a nucleotide sequence shown in SEQ ID NO. 4:

AACATCTATGATGCCTTTGTTATCTACTCAAGCCAGGATGAGGACTGGGTAAGGAATGAGCTAGTAAAGAATTTAGAAGAAGGGGTGCCTCCATTTCAGCTCTGCCTTCACTACAGAGACTTTATTCCCGGTGTGGCCATTGCTGCCAACATCATCCATGAAGGTTTCCATAAAAGCCGAAAGGTGATTGTTGTGGTGTCCCAGCACTTCATCCAGAGCCGCTGGTGTATCTTTGAATATGAGATTGCTCAGACCTGGCAGTTTCTGAGCAGTCGTGCTGGTATCATCTTCATTGTCCTGCAGAAGGTGGAGAAGACCCTGCTCAGGCAGCAGGTGGAGCTGTACCGCCTTCTCAGCAGGAACACTTACCTGGAGTGGGAGGACAGTGTCCTGGGGCGGCACATCTTCTGGAGACGACTCAGAAAAGCCCTGCTGGATGGT(SEQ ID NO.4)。

the CD3ZETA is expressed by the nucleotide sequence shown in SEQ ID NO. 5:

AGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACAAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAGAACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCCCCCTCGC(SEQ ID NO.5)。

GM-CSFR alpha/beta is expressed by the nucleotide sequence shown in SEQ ID NO. 6:

AAAAGGTTCCTTAGGATACAGCGGCTGTTCCCGCCAGTTCCACAGATCAAAGACAAACTGAATGATAACCATGAGGTGGAAGACGAGATCATCTGGGAGGAATTCACCCCAGAGGAAGGGAAAGGCTACCGCGAAGAGGTCTTGACCGTGAAGGAAATTACCGGTGGCGGTGGCTCGGGCGGTGGTGGGTCGGGTGGCGGCGGATCTCGCTTCTGTGGCATCTACGGGTACAGGCTGCGCAGAAAGTGGGAGGAGAAGATCCCCAACCCCAGCAAGAGCCACCTGTTCCAGAACGGGAGCGCAGAGCTTTGGCCCCCAGGCAGCATGTCGGCCTTCACTAGCGGGAGTCCCCCACACCAGGGGCCGTGGGGCAGCCGCTTCCCTGAGCTGGAGGGGGTGTTCCCTGTAGGATTCGGGGACAGCGAGGTGTCACCTCTCACCATAGAGGACCCCAAGCATGTCTGTGATCCACCATCTGGGCCTGACACGACTCCAGCTGCCTCAGATCTACCCACAGAGCAGCCCCCCAGCCCCCAGCCAGGCCCGCCTGCCGCCTCCCACACACCTGAGAAACAGGCTTCCAGCTTTGACTTCAATGGGCCCTACCTGGGGCCGCCCCACAGCCGCTCCCTACCTGACATCCTGGGCCAGCCGGAGCCCCCACAGGAGGGTGGGAGCCAGAAGTCCCCACCTCCAGGGTCCCTGGAGTACCTGTGTCTGCCTGCTGGGGGGCAGGTGCAACTGGTCCCTCTGGCCCAGGCGATGGGACCAGGACAGGCCGTGGAAGTGGAGAGAAGGCCGAGCCAGGGGGCTGCAGGGAGTCCCTCCCTGGAGTCCGGGGGAGGCCCTGCCCCTCCTGCTCTTGGGCCAAGGGTGGGAGGACAGGACCAAAAGGACAGCCCTGTGGCTATACCCATGAGCTCTGGGGACACTGAGGACCCTGGAGTGGCCTCTGGTTATGTCTCCTCTGCAGACCTGGTATTCACCCCAAACTCAGGGGCCTCGTCTGTCTCCCTAGTTCCCTCTCTGGGCCTCCCCTCAGACCAGACCCCCAGCTTATGTCCTGGGCTGGCCAGTGGACCCCCTGGAGCCCCAGGCCCTGTGAAGTCAGGGTTTGAGGGCTATGTGGAGCTCCCTCCAATTGAGGGCCGGTCCCCCAGGTCACCAAGGAACAATCCTGTCCCCCCTGAGGCCAAAAGCCCTGTCCTGAACCCAGGGGAACGCCCGGCAGATGTGTCCCCAACATCCCCACAGCCCGAGGGCCTCCTTGTCCTGCAGCAAGTGGGCGACTATTGCTTCCTCCCCGGCCTGGGGCCCGGCCCTCTCTCGCTCCGGAGTAAACCTTCTTCCCCGGGACCCGGTCCTGAGATCAAGAACCTAGACCAGGCTTTTCAAGTCAAGAAGCCCCCAGGCCAGGCTGTGCCCCAGGTGCCCGTCATTCAGCTCTTCAAAGCCCTGAAGCAGCAGGACTACCTGTCTCTGCCCCCTTGGGAGGTCAACAAGCCTGGGGAGGTGTGT(SEQ ID NO.6)。

2) construction of CAR-iMONO or CAR-iMAC

The expression sequences of three different CARs were integrated into ipscs separately using a lentiviral system. Obtaining a cell line (CAR-iPSC) stably expressing CAR by means of technical means such as green fluorescence expression and single-cell RNA-seq. The three CAR-ipscs were then further induced to differentiate into CAR-imo or CAR-iMAC dependent on CAR activation.

CAR-iMAC is constructed, and nonspecific basic phagocytosis function test is carried out, and the experimental steps are as follows:

1. an amount of CAR-iMAC expressing green fluorescent protein was inoculated into six-well plates and polarized for 24 hours in RPMI1640 medium containing 100ng/ml lps, 100ng/ml human INF- γ, 100ng/ml M-CSF and 100ng/ml GM-CSF. During the period, the mixture is placed at 37 ℃/5% CO₂A cell culture box.

2. Obtained by the above stepsPolarized CAR-iMAC and wild type LN-229 cells expressing tdTomato red fluorescent protein were seeded at 10/1 in glass dishes in RPMI1640 medium with 100ng/ml M-CSF and 100ng/ml GM-CSF at 37 ℃/5% CO₂The cells were co-cultured in a cell incubator for 24 hours.

3. And (3) placing the glass vessel in the previous step in a confocal fluorescence scanning microscope, scanning and observing the co-location condition of the red fluorescence and the green fluorescence after setting parameters, and photographing and storing.

The construction of CAR-iMAC and the examination of its nonspecific basic phagocytic function are shown in FIG. 2, and the results show that CAR-iMAC has a basic phagocytic function.

Example 3

The ability of CAR-iMAC to kill GBM cell lines was evaluated in vitro.

Respectively comparing the three different CAR-iMAC and the control group iMAC expressing the same with U87MG expressing luciferase in vitro according to the effective target ratios of 3:1, 5:1 and 10:1^EGFRvIIICells were co-cultured in a live cell workstation, enhancing the effect of CAR-iMAC targeting GBM and promoting its immune activation compared to CARs containing different intracellular activation domains. Luciferase assay and tumor cell flow-counting assay detect different CAR-iMAC targeted killing effects. Comparison of the effects of scFv-CD8-TIR-CAR vs. scFv-CD8-DELTA-CAR and scFv-CD8-CD3ZETA-CAR on CAR-iMAC polarization and activation according to the above criteria. The results are shown in FIG. 3.

The experimental steps of A in FIG. 3 are as follows:

1. a number of 3 CAR-iMAC and WT-iMAC expressing green fluorescent protein were inoculated into six well plates and polarized for 24 hours in RPMI1640 medium containing 100ng/ml LPS, 100ng/ml human INF- γ, 100ng/ml M-CSF and 100ng/ml GM-CSF. During the period, the cells were placed in a 37 ℃/5% CO2 cell incubator.

2. The polarized 3 CAR-iMAC and WT-iMAC obtained above were mixed with U87 mgegfrviii cells expressing tdTomato red fluorescent protein at a ratio of 10:1 in a ratio of 1, and CO-cultured in RPMI1640 medium containing 100ng/ml M-CSF and 100ng/ml GM-CSF in a 37 ℃/5% CO2 cell culture chamber for 12 hours.

3. And (3) placing the glass bottom plate in the previous step in an OLYPUS fluorescence microscope, setting parameters, observing the distribution conditions of red fluorescence and green fluorescence, and photographing and storing.

The experimental procedure for B in fig. 3 is as follows:

1. a number of 3 CAR-iMAC and WT-iMAC expressing green fluorescent protein were inoculated into six well plates and polarized for 24 hours in RPMI1640 medium containing 100ng/ml LPS, 100ng/ml human INF- γ, 100ng/ml M-CSF and 100ng/ml GM-CSF. During the period, the mixture is placed at 37 ℃/5% CO₂A cell culture box.

2. The polarized 3 CAR-iMAC and WT-iMAC obtained above were separately combined with U87MG expressing tdTomato red fluorescent protein^EGFRvIIThe cells were cultured in a 10:1 into a glass petri dish, using RPMI1640 medium containing 100ng/ml M-CSF and 100ng/ml GM-CSF at 37 ℃/5% CO₂The cells were co-cultured in a cell incubator for 24 hours.

3. And (3) placing the glass substrate in the last step in a confocal fluorescence scanning microscope, scanning and observing the co-location condition of the red fluorescence and the green fluorescence after setting parameters, and photographing and storing.

Experimental procedure for panels a and B in fig. 4:

1. 3 CAR-iMAC expressing green fluorescent protein and WT-iMAC expressing WT-iMAC are polarized for 24 hours and then respectively compared with U87MG expressing tdTomato red fluorescent protein^EGFRvIICells were differentiated by 3: co-culture in six-well plates at 1,5:1, and 10:1 ratios for 24 hours (method as in panel B of FIG. 3).

2. Trypsinized and co-cultured cells collected, detected and statistically analyzed in a flow analyzer for 3 CAR-iMAC, WT-iMAC and U87MG^EGFRvIIThe number of cells. The setting parameters are as follows: the green fluorescent protein is FITC channel, and tdTomato is PE channel.

Panel C experimental procedure in figure 4:

1. after polarizing 3 kinds of CAR-iMAC expressing green fluorescent protein for 24 hours, the protein is respectively compared with U87MG expressing luciferase gene luciferase^EGFRvIIThe cells were cultured in a 10:1 in 96-well plates protected from light for 24 hours. And only U87MG is arranged^EGFRvIICulture well of cells asNegative Control (NC) (method same as B in FIG. 3).

2. 100ul of luciferin with the concentration of 10mg/ml is added into each hole in the co-culture system, and the wells are quickly placed in a multifunctional microplate reader to detect fluorescent signals.

Graph D experimental procedure in figure 4:

1. the culture supernatant of the co-culture system in Panel A was collected and centrifuged at 1000rpm for 20 minutes.

2. Adding 100ul of the culture medium supernatant obtained in the previous step into a corresponding detection hole of an interleukin 12(IL-12) enzyme-linked immunosorbent assay kit. 3 CAR-iMAC and WT-iMAC were detected by ELISA assay to be respectively associated with U87MG expressing tdTomato red fluorescent protein^EGFRvIIThe cells were cultured in a 10:1 to IL-12 secretion after co-cultivation, the assay data were counted and analyzed.

The results show that three CAR-iMAC (EGFP) and U87MG targeting EGFRvIII^EGFRvIII(tdTomato) in vitro Co-culture for 12 hours, it was shown that different CAR-iMAC pairs U87MG relative to WT-iMAC^EGFRvIIIStronger adhesion, and U87MG^EGFRvIIIThe cell body is significantly larger than CAR-iMAC (a in fig. 3). Confocal scanning showed that all three CAR-iMAC and WT-iMAC had cell gnawing U87MG^EGFRvIIIAbility (B in fig. 3).

Flow analysis technology is adopted to count the effective target ratio of the three CAR-iMAC and WT-iMAC to U87MG in 3:1, 5:1 and 10:1 respectively^EGFRvIIINumber of tumor cells surviving after 24 hours of co-culture. The results show that both scFv-CD8-TIR-CAR-iMAC and scFv-CD8-CD3ZETA-CAR-iMAC possess significant killing U87MG^EGFRvIIIAnd the killing effect is more significant with increasing effective target ratio (a and B in fig. 4).

The three CAR-iMAC respectively and stably expressed luciferase U87MG according to different effective target ratios^EGFRvIIIAfter 24 hours of in vitro co-culture, the survival rate of the tumor cells is characterized by detecting the activity of luciferase. The results are shown as C in figure 4, indicating that scFv-CD8-TIR-CAR-iMAC and scFv-CD8-CD3ZETA-CAR-iMAC have significant killing U87MG relative to scFv-CD8-DELTA-CAR-iMAC at an effective target ratio of 5/1 and 10/1^EGFRvIIIThe capacity of the cell.

Three CAR-iMAC and WT-iMAC at 10/1 target-to-target ratios with U87MG^EGFRvIIIAfter 24 hours of co-incubation, the ELISA assay measures the release of the immune activator. The results are shown as F in 3, indicating that scFv-CD8-TIR-CAR-iMAC and scFv-CD8-CD3ZETA-CAR-iMAC are significantly upregulated relative to WT-iMAC and scFv-CD8-DELTA-CAR-iMAC secreted pro-inflammatory factor IL 12.

Example 4

The results of examination of iPSC-derived imacs for in vivo survival and solid tumor tissue infiltration are shown in fig. 5. NSG mice were injected intraperitoneally with fluorescent dye Dir labeled iMAC and viability signals and time of iMAC were detected by in vivo imaging as shown in a in fig. 5. Data were statistically analyzed for viability of imacs in panel a of fig. 5 (B of fig. 5). The iMAC from the iPSC can exist in the tumor model for more than 30 days, and the requirement of tumor immune cell therapy on the survival time of immune cells is met.

Intraperitoneal injection of 1X 10 into NSG mice⁶U87MG cells over-expressing Luciferase (Luciferase) gene were injected with the same amount of iMAC in situ after 4 hours, and after 30 days, tumor tissues were isolated and observed for iMAC infiltration in tumor tissues by Dir and Luciferin imaging, respectively. The results are shown as D in fig. 5, indicating the presence of iMAC in the GBM. Further detecting the infiltration condition of iMAC in the tumor tissue by adopting an immunohistochemical experiment, wherein the experimental steps are as follows:

1. tumor tissues were isolated 30 days after injecting iMAC in the intraperitoneal GBM mouse model. And fixed in 4% PFA for a week.

2. Embedding tissues: adding liquid paraffin into an iron mould, slightly cooling, placing the tumor tissue fixed in the previous step into the paraffin, covering a plastic mould box, adding a little liquid paraffin, and freezing to make the paraffin become solid.

3. Slicing: the embedded tumor tissue is removed from the mold and placed on a paraffin microtome, which adjusts the tissue up and down and left and right to conform to the cutting direction, then adjusts the thickness of the section, typically 5 μm, pulls the cut slide outward with a stylus, and places the slide containing the intact tissue in warm water at 40 degrees celsius with small forceps.

4. Fishing out the tissue: removing bubbles in the water bath, heating and spreading the tissue, fishing 5-6 tissues in the same direction by using 1/2 below the glass slide, placing the fished glass slide on a shelf, and drying in a 37-DEG incubator.

5. Dewaxing: and sequentially putting the glass slide into dimethylbenzene-dimethylbenzene, 100% alcohol, 95% alcohol, 90% alcohol, 80% alcohol and 70% alcohol for dewaxing, and putting each reagent for 10-15 min.

6. Antigen retrieval: washing in clear water for a period of time after dewaxing, adding citric acid buffer solution, and steaming in microwave oven for 3min (middle fire) until boiling. Cooled at room temperature and then cooked once more to room temperature to expose the antigen sites.

7. Serum blocking: after cooling to room temperature, the citric acid buffer was poured off, washed 2 times with water, and the slides were placed in PBS for 5min, washed 2 times, and the PBS surrounding the tissue was wiped dry. Serum was immediately added ten-fold diluted in PBS to block some non-specific sites and then placed in a 37 ℃ incubator for half an hour.

8. Adding a primary antibody: the slides were removed from the incubator and the serum surrounding the reverse and front tissues of the slides was wiped dry with absorbent paper and primary antibodies to CD11b, CD86 and CD206 were added dropwise, respectively. Stored overnight in a 4 degree refrigerator.

9. Adding a secondary antibody: the slides were removed from the freezer, washed 3 times in PBS for 5min each, wiped dry with PBS surrounding the tissue, then secondary antibodies of the same genus species were added, and placed in a 37 ℃ incubator for half an hour.

10. Adding SABC: the slide was removed from the incubator, washed 3 times in PBS for 5min each, wiped to dry the PBS surrounding the tissue, added with SABC diluted 100 times in PBS, and then placed in a 37 ℃ incubator for half an hour.

11. Adding a color developing agent: the slide was taken out of the incubator, washed in PBS for 3 times, 5min each time, wiped to dry the PBS surrounding the tissue and then color-developing agent was added. (color reagent preparation: 1 drop of color reagent A is added into 1ML water, and shaken up, then 1 drop of color reagent B is added, and shaken up, then 1 drop of color reagent C is added, and shaken up, A: DAB, B: H202, C: phosphate buffer solution.

12. Counterdyeing: washing the developed slices with clear water for a period of time, and soaking in hematoxylin for staining, wherein animal tissue is half a minute, and plant tissue is 3-5 min.

13. And (3) dehydrating: after the counterdyed slices are placed in water for washing, the glass slides are sequentially placed in 70% alcohol, 80% alcohol, 90% alcohol, 95% alcohol, 100% alcohol, xylene and xylene. Each reagent is placed for 2min, finally soaked in xylene and moved to a fume hood.

14. Sealing: dropping neutral gum on the side of tissue, lightly covering with cover glass (placing one side flat and the other side slightly to avoid air bubble generation), sealing, and air drying in a fume hood.

15. Imaging: the tumor histochemical samples thus obtained were placed in an OLYMPUS upright microscope and imaged for photography.

The results are shown as E in fig. 5, indicating that imacs have the ability to infiltrate into solid tumors and are present as M2-type macrophages.

Example 5

Construction of GBM mouse abdominal tumor model

Respectively mixing 2 × 10⁶U87MG overexpressing luciferase gene^EGFRvIIICells are inoculated into the abdominal cavity of an NSG mouse in an intraperitoneal injection mode to construct an abdominal GBM mouse model.

Verification of CAR-iMAC antitumor Capacity in GBM model

The three different CAR-imacs above, and their control cells iMAC, were adoptively transplanted into the celiac GBM mouse model. And timely observing and recording the change of the tumor and the change of the weight and the survival state of the mouse by a mouse living body imaging technology. The results are shown in FIG. 6.

After three CAR-iMAC (scFv-CD8-DELTA-CAR-iMAC, scFv-CD8-TIR-CAR-iMAC, scFv-CD8-CD3ZETA-CAR-iMAC) (DiR) and PBS were injected into the abdominal cavity model of the NSG mouse GBM, the killing effect of the three CAR-iMAC on GBM (Luciferin biotin luminescence) was shown by in vivo imaging technique at the target ratio of 10/1 as shown in a in fig. 6, and the change of tumor signal of GBM in the presence of the three CAR-iMAC and the survival time of GBM mouse after treatment (B and C in fig. 6), respectively, showed that scFv-CD8-TIR-CAR-iMAC has stronger in vivo anti-tumor function than scFv-CD8-CD3 ZETA-CAR-iMAC.

Example 6

A chimeric antigen receptor CD8-GM-CSFR α/β -CAR, whose structural and activation schemes are shown in figure 7, a in figure 7 shows that CD8-GM-CSFR α/β -CAR consists of a scFv protein sequence that recognizes EGFRvIII extracellularly, a CD8 α transmembrane domain, and an intracellular signaling domain. The intracellular signal transduction domain is composed of an intracellular signal activation domain of a receptor GM-CSFR alpha and an intracellular signal activation domain of a receptor GM-CSFR beta which are linked by a Linker sequence. Linker sequences allow flexibility in changing conformation. FIG. 7B shows that after extracellular scFv of CD8-GM-CSFR α/β -CAR contact EGFRvIII protein to form immune synapses, the GM-CSFR α and GM-CSFR β activation domains inside the packet form heterodimers via Linker conformation changes, which in turn are activated, ultimately promoting CAR-iMAC proliferation, immune activation, and phagocytosis.

Example 7

The effects of CD8-GM-CSFR α/β -CAR-iMAC targeted killing and CAR-dependent immune activation were verified in vitro.

Following the experimental procedure of panel B of FIG. 3 of example 3, CD8-GM-CSFR α/β -CAR-iMAC and CD8-DELTA-CAR-iMAC were combined in vitro with U87MG expressing luciferase^EGFRvIIICells were co-cultured in a live cell workstation and after 24h of in vitro co-culture, both CD8-GM-CSFR α/β -CAR-iMAC (EGFP) and CD8-DELTA-CAR-iMAC (EGFP) without intracellular signaling domain were shown to have phagocytic U87MG by confocal scanning^EGFRvIIICapacity of the cells (a in fig. 8). WT-iMAC, CD8-DELTA-CAR-iMAC and CD8-GM-CSFR alpha/beta-CAR-iMAC were each compared to U87MG at an effective-to-target ratio of 10/1^EGFRvIIIAfter 24h of in vitro co-culture of the cells, the secretion of macrophage immune activation factors IL-12 and TNF alpha is detected by ELISA experiment. The results are shown in B and C in FIG. 8, indicating that CD8-GM-CSFR α/β -CAR-iMAC has a significant ability to secrete IL-12 and TNF α relative to WT-iMAC and CD 8-DELTA-CAR-iMAC. The WT-iMAC,CD8-DELTA-CAR-iMAC and CD8-GM-CSFR alpha/beta-CAR-iMAC at 10/1 effective target ratios, respectively, to U87MG expressing luciferase^EGFRvIIIAfter the cells are co-cultured for 24 hours in vitro, detecting U87MG by a multifunctional microplate reader^EGFRvIIIFluorescent signal in cells. The results are shown in D in FIG. 8, indicating that U87MG^EGFRvIIIThe fluorescent signal was significantly down-regulated after co-culturing cells with CD8-GM-CSFR α/β -CAR-iMAC. It was further demonstrated that CD8-GM-CSFR α/β -CAR-iMAC kills U87MG more significantly than WT-iMAC and CD8-DELTA-CAR-iMAC^EGFRvIIIThe capacity of the cell.

Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.

SEQUENCE LISTING

<110> Zhejiang university

<120> macrophage specific chimeric antigen receptor, controllable polarized monocyte/macrophage expressing the receptor and preparation thereof

Preparation method and application

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 63

<212> DNA

<213> Artificial sequence

<400> 1

atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60

ccg 63

<210> 2

<211> 720

<212> DNA

<213> Artificial sequence

<400> 2

gacatccaga tgacccagag ccctagcagc ctgagcgcca gcgtgggcga cagagtgacc 60

atcacctgtc gggccagcca gggcatcaga aacaacctgg cctggtatca gcagaagccc 120

ggcaaggccc ccaagagact gatctacgct gccagcaatc tgcagagcgg cgtgcccagc 180

agattcaccg gaagcggctc cggcaccgag ttcaccctga tcgtgtccag cctgcagccc 240

gaggacttcg ccacctacta ctgcctgcag caccacagct accctctgac cagcggcgga 300

ggcaccaagg tggagatcaa gcggaccggc agcaccagcg gcagcggcaa gcctggcagc 360

ggcgagggaa gcgaggtcca ggtgctggaa tctggcggcg gactggtgca gcctggcggc 420

agcctgagac tgagctgtgc cgccagcggc ttcaccttca gcagctacgc catgtcttgg 480

gtccggcagg ctcctggaaa gggcctggaa tgggtgtccg ccatcagcgg ctctggcggc 540

tccaccaact acgccgacag cgtgaagggc cggttcacca tcagccggga caacagcaag 600

aacaccctgt atctgcagat gaacagcctg agagccgagg acaccgccgt gtactactgt 660

gccggcagca gcgggtggag cgagtactgg ggccagggca cactggtcac agtgtctagc 720

<210> 3

<211> 72

<212> DNA

<213> Artificial sequence

<400> 3

atctacatct gggcgccctt ggccgggact tgtggggtcc ttctcctgtc actggttatc 60

accctttact gc 72

<210> 4

<211> 441

<212> DNA

<213> Artificial sequence

<400> 4

aacatctatg atgcctttgt tatctactca agccaggatg aggactgggt aaggaatgag 60

ctagtaaaga atttagaaga aggggtgcct ccatttcagc tctgccttca ctacagagac 120

tttattcccg gtgtggccat tgctgccaac atcatccatg aaggtttcca taaaagccga 180

aaggtgattg ttgtggtgtc ccagcacttc atccagagcc gctggtgtat ctttgaatat 240

gagattgctc agacctggca gtttctgagc agtcgtgctg gtatcatctt cattgtcctg 300

cagaaggtgg agaagaccct gctcaggcag caggtggagc tgtaccgcct tctcagcagg 360

aacacttacc tggagtggga ggacagtgtc ctggggcggc acatcttctg gagacgactc 420

agaaaagccc tgctggatgg t 441

<210> 5

<211> 336

<212> DNA

<213> Artificial sequence

<400> 5

agagtgaagt tcagcaggag cgcagacgcc cccgcgtaca agcagggcca gaaccagctc 60

tataacgagc tcaatctagg acgaagagag gagtacgatg ttttggacaa gagacgtggc 120

cgggaccctg agatgggggg aaagccgaga aggaagaacc ctcaggaagg cctgtacaat 180

gaactgcaga aagataagat ggcggaggcc tacagtgaga ttgggatgaa aggcgagcgc 240

cggaggggca aggggcacga tggcctttac cagggtctca gtacagccac caaggacacc 300

tacgacgccc ttcacatgca ggccctgccc cctcgc 336

<210> 6

<211> 1518

<212> DNA

<213> Artificial sequence

<400> 6

aaaaggttcc ttaggataca gcggctgttc ccgccagttc cacagatcaa agacaaactg 60

aatgataacc atgaggtgga agacgagatc atctgggagg aattcacccc agaggaaggg 120

aaaggctacc gcgaagaggt cttgaccgtg aaggaaatta ccggtggcgg tggctcgggc 180

ggtggtgggt cgggtggcgg cggatctcgc ttctgtggca tctacgggta caggctgcgc 240

agaaagtggg aggagaagat ccccaacccc agcaagagcc acctgttcca gaacgggagc 300

gcagagcttt ggcccccagg cagcatgtcg gccttcacta gcgggagtcc cccacaccag 360

gggccgtggg gcagccgctt ccctgagctg gagggggtgt tccctgtagg attcggggac 420

agcgaggtgt cacctctcac catagaggac cccaagcatg tctgtgatcc accatctggg 480

cctgacacga ctccagctgc ctcagatcta cccacagagc agccccccag cccccagcca 540

ggcccgcctg ccgcctccca cacacctgag aaacaggctt ccagctttga cttcaatggg 600

ccctacctgg ggccgcccca cagccgctcc ctacctgaca tcctgggcca gccggagccc 660

ccacaggagg gtgggagcca gaagtcccca cctccagggt ccctggagta cctgtgtctg 720

cctgctgggg ggcaggtgca actggtccct ctggcccagg cgatgggacc aggacaggcc 780

gtggaagtgg agagaaggcc gagccagggg gctgcaggga gtccctccct ggagtccggg 840

ggaggccctg cccctcctgc tcttgggcca agggtgggag gacaggacca aaaggacagc 900

cctgtggcta tacccatgag ctctggggac actgaggacc ctggagtggc ctctggttat 960

gtctcctctg cagacctggt attcacccca aactcagggg cctcgtctgt ctccctagtt 1020

ccctctctgg gcctcccctc agaccagacc cccagcttat gtcctgggct ggccagtgga 1080

ccccctggag ccccaggccc tgtgaagtca gggtttgagg gctatgtgga gctccctcca 1140

attgagggcc ggtcccccag gtcaccaagg aacaatcctg tcccccctga ggccaaaagc 1200

cctgtcctga acccagggga acgcccggca gatgtgtccc caacatcccc acagcccgag 1260

ggcctccttg tcctgcagca agtgggcgac tattgcttcc tccccggcct ggggcccggc 1320

cctctctcgc tccggagtaa accttcttcc ccgggacccg gtcctgagat caagaaccta 1380

gaccaggctt ttcaagtcaa gaagccccca ggccaggctg tgccccaggt gcccgtcatt 1440

cagctcttca aagccctgaa gcagcaggac tacctgtctc tgcccccttg ggaggtcaac 1500

aagcctgggg aggtgtgt 1518