1. A copper-containing amine oxidase enzyme characterized by being (a) or (b):

(a) a protein consisting of an amino acid sequence shown in SEQ ID No. 2;

(b) and (b) a protein derived from (a) having a copper-containing amine oxidase activity, wherein the amino acid sequence in (a) is substituted, deleted or added with one or more amino acids.

2. A gene encoding the copper-containing amine oxidase of claim 1.

3. A recombinant expression plasmid carrying the gene of claim 2.

4. A recombinant microbial cell expressing the copper-containing amine oxidase of claim 1, or carrying the gene of claim 2, or containing the recombinant plasmid of claim 3.

5. The recombinant microbial cell of claim 4, including but not limited to E.coli, Bacillus or yeast.

6. A genetic engineering bacterium is characterized in that escherichia coli is used as a host to express copper-containing amine oxidase shown in SEQ ID No. 2.

7. The genetically engineered bacterium of claim 6, wherein the copper-containing amine oxidase represented by SEQ ID No.2 is expressed by using Escherichia coli BL21 as a host and pET series plasmids as an expression vector.

8. A process for producing a cuprammonium oxidase, which comprises inoculating the genetically engineered bacterium of claim 6 or 7 into a culture medium, culturing, and collecting the enzyme.

9. Use of the copper-containing amine oxidase of claim 1, or the recombinant microbial cell of any of claims 4 to 5, or the genetically engineered bacterium of any of claims 6 to 7 for reducing biogenic amines in the food field.

10. The use according to claim 9, wherein the biogenic amines include, but are not limited to, one or more of tryptamine, phenethylamine, cadaverine, putrescine, histamine, tyramine, spermidine, spermine.

Background

Biogenic amines are low molecular weight nitrogen-containing organic bases formed primarily by decarboxylation of amino acids. Biogenic amines are widely distributed in nature, can be produced by metabolism of microorganisms, plants and animals, and can be taken into the human body through food. A proper amount of biogenic amine has positive effects on human bodies, such as improving the immunity of the human bodies, enhancing the activity of blood vessels, regulating mental activities and the like. However, biogenic amines, when accumulated in large amounts in humans, cause various toxic effects such as headache, hypotension, palpitation, vomiting, etc., and in severe cases are life threatening. The biogenic amine in the food is mainly derived from two parts of food raw materials and a food processing and storing process, wherein the food raw materials such as fruits, vegetables, grains and the like contain a small amount of biogenic amine, and more biogenic amine is generated by the growth and metabolism of microorganisms in the food processing and storing process, so that the biogenic amine content in the fermented food is generally higher, and the reasonable control of the biogenic amine content in the fermented food has important significance.

When biogenic amine exists in fermented food, the inoculation of biogenic amine degrading strains or the application of biogenic amine degrading enzymes is the most effective method, and the two methods have the advantages of high efficiency and safety and have great potential in the aspect of controlling the biogenic amine content in the food. The method for degrading the biogenic amine in the fermented food by utilizing biogenic amine degrading enzyme has little influence on the production process of the food and the flavor of the food. The present studies indicate that amine oxidase is the main biogenic amine-degrading enzyme, and it has been found that amine oxidase derived from microorganisms is mainly flavin-containing amine oxidase and copper-containing amine oxidase. Copper-containing amine oxidase is a copper-containing reductase, and the copper-containing amine oxidase capable of degrading biogenic amine is separated from various microorganisms by scholars, and has certain degradation capability on various biogenic amines such as histamine, phenethylamine, tyramine and the like.

The amine oxidase with the effect of degrading biogenic amine obtained by separation at present is few in types and poor in effect, so that the screening of the amine oxidase with the effect of efficiently degrading biogenic amine has important significance for degrading biogenic amine in fermented foods such as aged yellow rice wine and the like and improving the quality of the fermented foods.

Disclosure of Invention

The invention aims to solve the problem of high biogenic amine content in the traditional fermented food, provides copper-containing amine oxidase capable of degrading biogenic amine from saccharopolyspora fuliginosa, reduces biogenic amine in fermented food such as yellow wine, soy sauce and the like by using a method for degrading biogenic amine by using copper-containing amine oxidase, and improves the quality of the traditional fermented food.

It is a first object of the present invention to provide a copper-containing amine oxidase which is (a) or (b):

(a) a protein consisting of an amino acid sequence shown in SEQ ID No. 1;

(b) and (b) a protein derived from (a) having a copper-containing amine oxidase activity, wherein the amino acid sequence in (a) is substituted, deleted or added with one or more amino acids.

The invention also provides a gene encoding the copper-containing amine oxidase.

In one embodiment, the gene comprises the nucleotide sequence set forth in SEQ ID NO. 1.

The invention also provides a recombinant expression plasmid carrying the gene.

In one embodiment, the recombinant expression plasmid is a pET series plasmid.

The invention also provides recombinant microbial cells expressing the copper-containing amine oxidase.

In one embodiment, the recombinant microbial cell includes, but is not limited to, escherichia coli, bacillus, or yeast.

The invention also provides a genetic engineering bacterium, which takes escherichia coli as a host and expresses the copper-containing amine oxidase shown in SEQ ID NO. 2.

In one embodiment, the genetically engineered bacterium is a host escherichia coli BL 21.

In one embodiment, the genetically engineered bacterium uses a pET series plasmid as an expression vector.

In one embodiment, the genetically engineered bacterium uses pET28a (+) as an expression vector to express the copper-containing amine oxidase shown in SEQ ID NO. 2.

The invention also provides a construction method of the genetic engineering bacteria, which is to connect the gene sequence shown in SEQ ID NO.1 with a vector and transform the gene sequence into an escherichia coli cell.

In one embodiment, the vector is pET28a (+).

The invention also provides a production method of the copper amine oxidase, which comprises the steps of inoculating the genetic engineering bacteria into a culture medium for culture, collecting somatic cells, crushing the cells to obtain a crude enzyme solution, and purifying.

In one embodiment, the strain culture method is to inoculate the genetically engineered bacterium into LB culture medium and culture to 0D₆₀₀When the concentration is 0.6-0.8, adding IPTG to induce for 14-20 h.

In one embodiment, the purification method is nickel column affinity chromatography.

The invention also provides application of the copper-containing amine oxidase in reducing biogenic amine in the field of food.

In one embodiment, the use comprises reducing the biogenic amine content in a fermented food product.

In one embodiment, the application is that the recombinant copper-rich oxidase is added into yellow wine and soy sauce to degrade biogenic amine in the yellow wine and soy sauce.

In one embodiment, the recombinant copper-rich oxidase is added into yellow wine or soy sauce in an amount of 0.5-2 g protein/L, and reacted at 20-45 ℃ for at least 20 h.

In one embodiment, the application is that the recombinant copper-rich oxidase is added into yellow wine or soy sauce in an amount of 1g/L and reacts for at least 24 hours at 20-25 ℃.

In one embodiment, the biogenic amines include, but are not limited to, tryptamine, phenethylamine, cadaverine, putrescine, histamine, tyramine, spermidine, spermine.

The invention has the beneficial effects that:

(1) the copper-containing amine oxide recombinase provided by the invention has strong performance of degrading biogenic amine, has a wide degradation spectrum, can degrade tryptamine, phenethylamine, cadaverine, histamine and tyramine within 24h, and has degradation rates respectively as high as 32.28%, 67.14%, 22.34%, 68.25% and 60.58%.

(2) The recombinase has certain tolerance ability to ethanol, and CuAO^ShirThe residual enzyme activity is more than 40% in the environment of 18% vol ethanol, and the method has a certain application value in fermented wine such as yellow wine, grape wine and the like.

(3) The recombinase has obvious degradation effect on common biogenic amine in the food such as phenylethylamine, histamine and tyramine, the total biogenic amine degradation rate of the commercially available yellow wine and the commercially available soy sauce is respectively 30.25% and 18.29%, and the safety of fermented food is further improved.

Drawings

Fig. 1 is a gel electrophoresis validation of s.hirsuta F1902 copper-containing amine oxidase gene: m: DNA marker; k: negative control; 1: and (5) PCR amplification products.

FIG. 2 shows the results of enzyme digestion; m: DNA marker; 1: the empty plasmid pET-28a (+) is subjected to single enzyme digestion; 2: pET-28a (+) -CuAO^ShirSingle enzyme digestion fragment; 3: pET-28a (+) -CuAO^ShirNde I and EcoR I.

FIG. 3 is a schematic representation of recombinant cuprammonium oxidase CuAO^ShirThe result of purification (2). (a) A process diagram for purifying the recombinant protein by using the nickel column HP; (b) is CuAO^ShirElectrophoresis chart of protein separation and purification process; m: an Unstained Protein Ladder; 1: CuAO^ShirPurifying the pre-protein; 2: CuAO^ShirAnd (5) purifying the protein.

FIG. 4 is CuAO^ShirAbility to degrade a single biogenic amine.

FIG. 5 is a plan view ofCuAO at the same pH^ShirThe enzyme activity of (a); (a) the substrate is phenethylamine; (b) the substrate is histamine; (c) the substrate being tyramine

FIG. 6 is a graph of CuAO at different temperatures^ShirThe enzyme activity of (1).

FIG. 7 is a graph of CuAO in environments with different ethanol concentrations^ShirThe enzyme activity of (a); (a) the substrate is phenethylamine; (b) the substrate is histamine; (c) the substrate is tyramine.

FIG. 8CuAO^ShirCapability of degrading biogenic amine in the commercial yellow wine.

FIG. 9CuAO^ShirAbility to degrade biogenic amines in commercially available soy sauce.

Detailed Description

The biogenic amine content was determined by High Performance Liquid Chromatography (HPLC).

The enzyme activity determination method comprises the following steps: the activity of the biological amine oxidase is determined by using an indirect determination method, the amine oxidase acts on the biological amine to degrade the biological amine into corresponding aldehydes and hydrogen peroxide, under the condition that peroxidase exists, the hydrogen peroxide, 4-aminoantipyrine and 2,4, 6-tribromo-3-hydroxybenzoic acid generate a hydroquinone dye, the product has a maximum absorption value at 510nm, the activity of the amine oxidase is in a linear relation with the color depth of the product within a certain range, and the activity of the amine oxidase can be determined by determining the change of A510. The reaction was carried out in a 96-well plate, and the reaction system included 10. mu.L of enzyme solution (150 mg. multidot.L)^-1) 100 μ L of the prepared solution (including 200 mmol. multidot.L)^-1Potassium phosphate buffer solution (pH 7.6), 1.5 mmol. multidot.L^-14-Aminoantipyrine, 1 mmol. L^-12,4, 6-tribromo-3-hydroxybenzoic acid), to start the reaction, 20 μ L of biogenic amine solution (10 mmol. multidot.l) was added^-1) And 70. mu.L peroxidase (1.4 mg. multidot.mL)^-1) The absorbance was measured at 510nm, the reaction temperature at 37 ℃ and the reaction time at 10 min.

Definition of enzyme activity: will generate 1. mu. moL of H per minute₂O₂The amount of enzyme required is defined as one unit of enzyme activity (U).

Example 1: PCR amplification of copper-containing amine oxidase Gene in S.hirsuta J2

According to Saccharopolyspora capensis (Saccharopolyspora hirs) in NCBI databaseuta) of the amine oxidase gene (Protein ID is WP _150069050.1), and s.hirsuta J2 (accession number is CCTCC NO: m2020103 disclosed in the patent application publication No. CN 111961615A) genome as a template, and a copper oxidase gene was amplified. The primers required for amplification were as follows: the upper primer sequence (5'→ 3') is ATGATGGCGATGCACCCGCTGG; the lower primer sequence (5'→ 3') was TCAGGACTCGCAGCAGTGGG. According toPreparing a PCR reaction solution according to the requirement of a reaction system of HS DNA Polymerase with GC Buffer, wherein the PCR amplification system comprises the following steps: pre-denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 30s, extension at 72 ℃ (1 min. kb)^-1) The cycle was 30 times.

Carrying out PCR amplification by taking the genome of S.hirsuta J2 as a template, verifying the amplification result by 1% agarose gel electrophoresis of the PCR product, wherein the amplified sequence size is the same as the target gene sequence size and is about 1900bp as shown in FIG. 1, which indicates that S.hirsuta J2 contains a copper-containing amine oxidase gene, purifying the PCR product and then sending the purified PCR product to a company for sequencing, and the sequencing result is shown in SEQ ID NO. 1.

Example 2: genetically engineered bacterium E.coli BL21-pET28a-CuAO^ShirConstruction of

(1) Obtaining the target fragment.

Using s.hirsuta J2 whole genome sequence as template, PCR amplification was performed with primers and whole genome DNA together, the PCR reaction system and amplification procedure were the same as described in example 1, and the PCR product gel with the correct band verification was carefully cut, recovered and purified.

(2) And (4) enzyme digestion and connection.

The plasmid pET-28a (+) and the target fragment were subjected to double digestion with restriction enzymes Nde I and EcoR I, respectively, as shown below: the target gene fragment was 40. mu.L, the plasmid was 40. mu.L, each of the restriction enzymes Nde I and EcoR I was 2.5. mu.L, and the Green Buffer was 5. mu.L. And (3) fully and uniformly mixing the components in the enzyme digestion system, and then placing the mixture in a metal bath at 37 ℃ for reaction for 45 min. And (3) recovering and purifying the gene fragment and the plasmid subjected to double enzyme digestion, and performing the following steps according to a molar ratio of 4-10: 1, adding Solution I ligase in the same volume, fully and uniformly mixing, and then placing in a metal bath at 16 ℃ for heat preservation overnight.

(3) And (4) transformation.

Placing E.coli BL21(DE3) competent cells preserved at-80 ℃ on ice for 5-10 min, sucking 5-10 mu L of a ligation product to be transformed by using a pipette, adding the ligation product into the competent cells, gently blowing and sucking the ligation product uniformly, uniformly mixing the mixture, and performing ice bath for 30 min. And (4) after the ice bath is finished, thermally shocking for 90s at 42 ℃, immediately taking out and placing in ice for 2-5 min. Then 700. mu.L LB liquid medium, 37C, 200 r.min was added^-1And carrying out shake culture for 45-60 min. 8000r min^-1Centrifuging for 2min, discarding most of supernatant, and keeping about 100 μ L of supernatant to resuspend the thallus. The bacterial liquid is uniformly coated on the surface of the substrate containing 30 mg.L^-1And (3) putting the flat plate on an LB solid culture medium of kanamycin in an incubator at 37 ℃ for overnight culture, and after single bacteria grow out, carrying out PCR (polymerase chain reaction) verification and screening positive transformants.

(4) And (5) enzyme digestion verification.

Extracting plasmid of recombinant bacteria, carrying out Nde I and EcoR I double enzyme digestion, respectively obtaining 5369bp pET-28a (+) fragment and 1927bp target fragment as shown in figure 2, sending the target fragment to a company for sequencing, ensuring that the sequencing result is consistent with the target gene sequence, and verifying the recombinant bacteria E.coli BL21-pET28a-CuAO^ShirSuccessfully constructed, and the recombinase expressed by the strain is named as CuAO^Shir。

Example 3: recombinase CuAO^ShirInduced expression and purification of

(1) Recombinase CuAO^ShirInduced expression of

The recombinant bacterium constructed in example 2 was inoculated to a medium containing 50 mg.L^-1Ampicillin in LB medium at 37 ℃ at 150 r.min^-1Culturing under the condition for 12 h. The seed solution was transferred to a medium containing 50 mg.L at an inoculum size of 2% (v/v)^-1Kanamycin in TB fermentation medium at 37 deg.C and 160 r.min^-1Culturing under the condition of OD₆₀₀0.6, a final concentration of 0.25 mmol. multidot.L was added^-1IPTG (isopropyl-beta-D-thiogalactoside) at 25 ℃ and 160 r.min^-1After culturing for 12h under the condition, bacterial liquid OD₆₀₀Is 1.5. The bacterial liquid is heated to 12000 r.min at 4 deg.C^-1Centrifuging for 10min and collectingAdding 0.2 mol/L of lower layer thallus^-1After resuspending the cells in sodium phosphate buffer (pH 7.4), the cells were collected by centrifugation and the above procedure was repeated twice. And (3) crushing the thallus by using an ultrasonic cell crusher under the ultrasonic conditions that: 400W, 1s of work, 1s of interval and 5-15 min of crushing time. After the completion of the crushing, the temperature is 12000 r.min at 4 DEG C^-1Centrifuging to collect supernatant, filtering with 0.45 μ M filter membrane, and storing at low temperature, wherein the enzyme activity of the supernatant is 40U/L.

(2) Recombinase CuAO^ShirPurification of (2)

Affinity chromatography column HisTrap^TMHP (GE healthcare) purified protein, and AKTA avant 25 instrument is adopted to separate and purify the target protein, and the operation steps are as follows:

1. machine self-checking, software opening, program setting, pump washing and post connection.

2. 15 column volumes were equilibrated with phosphate buffer containing 20mM imidazole, pH 7.4, at a flow rate of 1mL min^-1。

3. Suspending the recombinant engineering bacteria in a buffer (50 mmol. multidot.L)^-1PBS, pH 7.40, 0.50M NaCl), obtaining a crude enzyme solution by ultrasonication, filtering the crude enzyme solution with a 0.45 μ M filter membrane, loading the filtered crude enzyme solution on the column after the above equilibration, and controlling the flow rate to be 1 mL/min^-1。

4. Washing 5-10 bed volumes with 20mM imidazole, pH 7.4 phosphate buffer at a flow rate of 1 mL/min^-1。

5. The elution was performed in a linear fashion with phosphate buffer containing 500mM imidazole at pH 7.4 (slope 5, 20 column volumes washed, buffer 2 concentration from 0 to 100%, then 100% buffer 2 wash 8-10 column volumes) at a flow rate of 1mL min^-1The molecular weight and purity of the eluted protein at each stage were determined by SDS-PAGE, and the protein purification process and SDS-PAGE results are shown in FIG. 3, in which the amount of protein was 200 mg/L.

6. Washing 5-10 column volumes with pure water, then washing 3-5 volumes with 20% alcohol at a flow rate of 1 mL/min^-1。

Example 4: recombinase CuAO^ShirDegradation of biogenic amines

To recombinant enzyme CuAO^ShirThe enzyme activity is measured and the enzyme activity is measured,the oxidative deamination of 8 biogenic amines was studied and it is known from Table 1 that tryptamine, phenethylamine, cadaverine, histamine and tyramine have different degrees of oxidative power, among which the oxidative power of phenethylamine, histamine and tyramine is stronger, and when phenethylamine is used as a substrate, the specific activity is 0.50 U.mg^-1When histamine was used as a substrate, the specific activity was 0.45 U.mg^-1When tyramine is used as a substrate, the specific activity is 0.47 U.mg^-1. The biogenic amine content in 8 monoamine solutions before and after the addition of the enzyme was determined by HPLC, and as can be seen from FIG. 4, the recombinase CuAO^ShirThe degrading capacities of the phenylethylamine, the histamine and the tyramine are the most obvious, and the degrading rates are 67.14%, 68.25% and 60.58% respectively after the enzyme is added for 24 hours; secondly, tryptamine is used, and the degradation rate is 32.28%; the degradation capability of the compound is very weak to putrescine, spermidine and spermine, and the degradation rate is not less than 10%.

TABLE 1 CuAO^ShirOxidation activity on various biogenic amines

Example 5: recombinase CuAO^ShirStudy of the enzymatic Properties

(1) Recombinase CuAO^ShirOptimum reaction pH of

Changing the pH value of a reaction system to 4-9, and measuring the recombination enzyme CuAO under different pH reaction conditions^ShirThe enzyme activity of (A) is calculated by taking the highest enzyme activity as 100%, and the relative enzyme activity of each pH point is calculated, and the result is shown in figure 5, CuAO^ShirHas high activity in neutral environment, and CuAO when the substrates are phenylethylamine, histamine and tyramine respectively^ShirThe optimum pH value of the p-phenylethylamine is 6.5, the optimum pH values of the histamine and the tyramine are 7, and the relative enzyme activity can be maintained to be more than 80% between the pH values of 6.5-7.5.

(2) Recombinase CuAO^ShirOptimum reaction temperature of

Changing the reaction temperature to 20-70 ℃, and measuring the recombination enzyme CuAO under different temperature reaction conditions^ShirThe relative enzyme activity of each temperature point was calculated with the highest enzyme activity as 100%, and the results are shown in FIG. 6, at the reaction temperatureThe enzyme activity is higher when the temperature is 35-60 ℃, and when the substrates are respectively phenethylamine, histamine and tyramine, CuAO^ShirThe optimal reaction temperature is 45 ℃, and the relative enzyme activity can be maintained to be more than 80% between 45 ℃ and 50 ℃.

(3) Ethanol on recombinase CuAO^ShirInfluence of enzyme Activity

The enzyme activity was measured by placing the enzyme solution in a buffer containing 0, 3, 7, 10, 15, 18, 20% (v/v) ethanol for 1h under the conditions of optimum reaction pH and temperature for the recombinase. The relative enzyme activity in each ethanol concentration environment was calculated with the highest enzyme activity being 100%, and the results are shown in FIG. 7, low concentration ethanol versus CuAO^ShirThe enzyme activity is not greatly influenced, and when the ethanol concentration is 3 percent, the recombinase CuAO^ShirRelative enzyme activity of greater than 89%, thus, CuAO^ShirThe method has good application potential in food containing low-concentration ethanol; and CuAO^ShirThe residual enzyme activity is more than 40% under the environment with higher ethanol content (15-18% vol), and simultaneously, compared with phenylethylamine, CuAO^ShirThe residual enzyme activity to histamine and tyramine is higher in the environment with higher ethanol concentration, so that CuAO^ShirHas certain ethanol tolerance and certain application value in yellow wine, grape wine and other fermented wine.

Example 6: recombinase CuAO^ShirApplication in yellow wine

Adding the recombinant amine oxidase into commercial yellow wine (the content is 1g protein. L)^{Yellow wine-1}) And standing at room temperature for 24h, and determining the content of biogenic amine, wherein the control group is commercial yellow wine without enzyme. As shown in FIG. 8, the commercial yellow wine contains 6 kinds of biogenic amines except tryptamine and spermine, and the total biogenic amine content is 59.58 mg.L^-1Tyramine and cadaverine are main biogenic amines, and recombinase CuAO^ShirThe total biogenic amine degradation rate of the commercial yellow wine is 30.25 percent, and the highest degradation rate of tyramine is 38.09 percent.

Example 7: recombinase CuAO^ShirApplication in soy sauce

Adding the recombinant amine oxidase into commercial yellow wine (the content is 1 g.L)^-1) Standing at room temperature for 24h, determining the content of biogenic amine,the control group was commercial yellow wine without enzyme. As shown in FIG. 9, the total degradation rate of biogenic amine was 18.29% for commercial soy sauce, and the degradation rates of histamine and tyramine, which are main biogenic amines, were 25.02% and 24.45%, respectively.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of south of the Yangtze river

South of the Yangtze university (Shaoxing) industry and technology research institute

Zhejiang Guyue Longshan Shaoxing Wine Co.,Ltd.

<120> cuprammonuine oxidase capable of degrading biogenic amine and derived from saccharopolyspora shasuensis and application thereof

<130> BAA210772A

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 1914

<212> DNA

<213> Saccharopolyspora hirsuta

<400> 1

atgacgatgc acccgctgga accgctgagc gcggcggagg tcctgcgcaa ccgagatgtc 60

ctgcagcagg cgggcctgct gcgcgagtcg acccgcttcc ccctggtgca gctggcggaa 120

ccggacaagg ccaccgtgct cgcgcaccgc gacggcgacc cggtggagcg ccgggcgcgc 180

tcggtgctgc tggacgtcaa gaccggggag ctgaccacca ccctggtctc gctgaccagc 240

ggtgaagtgg tgggcaaggc cgtggtgaac ccggtcgagc agggccagcc gccggtgatg 300

ctcgacgagt acgagctggt cgagcgcgtc gtgcgcgacg acgagacctg gcagcgcgcc 360

atccgcgacc gcggcttcga cgacctcacc aaggtgcggg tgtgcccgct gtcggccggg 420

tggttcggcg tcgccgagga gagcggccgc cgcatgctgc gggccctggc cttcgcccag 480

aacagcccgg acgaactgcc ctgggcgcac ccgatcgacg gactggtggc ctacgtcgac 540

gtgatcgagc agcgggtgct ggaggtggtc gacgaccgga agttcccggt accggccgag 600

agtggcgact acaccgacga ggcggtgacc ggcccgctgc gcgacacgct gcgcccgatc 660

gagatcaccc agcccgaggg gcccagcttc caggtcgacg ggcacgaggt gcggtgggag 720

aactggcgat tccgcatcgg cttcgacccg cgcgaaggcc tggtgctgca ccagctgtcg 780

ttccgcgacg gcgaccgcga gcggccggtg gtctaccggg cctccatcgg cgagatggtg 840

gtcaactacg gcgacccgtc gccggcccgg ttctggcaga actacttcga ctcgggcgag 900

tactcgctgg gcaagctcgc caacgagctg gtgctcggct gcgactgcct cggcgagatc 960

cgctacttcg acgcggtggt ggcccaggag gacggcacgc cgcgcaccct gcgcaacgcg 1020

gtgtgcatgc acgaggagga cttcggggtg ctgtggaagc acaccgacgt gttcaccggc 1080

acggccgaga cccggcggca gcggcggctg gtggtgtcct tcttcgtctc cgtcggcaac 1140

tacgactacg gcttctactg gtacctctac ctggacggca ccatccagct ggagaccaag 1200

gcgaccggca tcgtgttcac ctcggcctac ccggaggagg gcacgcgctg ggccaacgag 1260

ctcgcccccg gcctcggcgc cccgtaccac cagcacctgt tcggcgcgcg gctggacatg 1320

atggtggacg gcacccgcaa cgcggtggac gaggtggcgg cccagcgggt gccgatcagc 1380

gcggacaacc cgcacggcaa cgccttcacc cgcagcgtca cccggttggc gcgggagagc 1440

gatggcgggc gcgaggcgga tccggccgcg ggccgcgcct ggcacgtggt caacaccgag 1500

cgcaccaacc gcctcggcca gccggtcggc tacgcgctgc tcccgcaggg caccccggtg 1560

ctgctggccg acccggagtc ctcgatcgcc cagcgcgccg cgttcgcgac caagcacctg 1620

tgggtcaccc agcacgccga ggatgagcgc tacccggcgg gggagtgggt gaaccagagc 1680

cacggcggtg cgggcatccc ggcgttcacc gcggcggacc gcagcatcga cggcgaggac 1740

atcgtgctgt ggcacacctt cggcctgacc cacttccccc gccccgagga ctggccgatc 1800

atgccggtgg actactgcgg cttcaccctg aagccggtgg gcttcttcga ccgcaacccc 1860

accctcgacg tcccacccaa ccccagcacc ggctcccact gctgcgagag ctga 1914

<210> 2

<211> 637

<212> PRT

<213> Saccharopolyspora hirsuta

<400> 2

Met Thr Met His Pro Leu Glu Pro Leu Ser Ala Ala Glu Val Leu Arg

1 5 10 15

Asn Arg Asp Val Leu Gln Gln Ala Gly Leu Leu Arg Glu Ser Thr Arg

20 25 30

Phe Pro Leu Val Gln Leu Ala Glu Pro Asp Lys Ala Thr Val Leu Ala

35 40 45

His Arg Asp Gly Asp Pro Val Glu Arg Arg Ala Arg Ser Val Leu Leu

50 55 60

Asp Val Lys Thr Gly Glu Leu Thr Thr Thr Leu Val Ser Leu Thr Ser

65 70 75 80

Gly Glu Val Val Gly Lys Ala Val Val Asn Pro Val Glu Gln Gly Gln

85 90 95

Pro Pro Val Met Leu Asp Glu Tyr Glu Leu Val Glu Arg Val Val Arg

100 105 110

Asp Asp Glu Thr Trp Gln Arg Ala Ile Arg Asp Arg Gly Phe Asp Asp

115 120 125

Leu Thr Lys Val Arg Val Cys Pro Leu Ser Ala Gly Trp Phe Gly Val

130 135 140

Ala Glu Glu Ser Gly Arg Arg Met Leu Arg Ala Leu Ala Phe Ala Gln

145 150 155 160

Asn Ser Pro Asp Glu Leu Pro Trp Ala His Pro Ile Asp Gly Leu Val

165 170 175

Ala Tyr Val Asp Val Ile Glu Gln Arg Val Leu Glu Val Val Asp Asp

180 185 190

Arg Lys Phe Pro Val Pro Ala Glu Ser Gly Asp Tyr Thr Asp Glu Ala

195 200 205

Val Thr Gly Pro Leu Arg Asp Thr Leu Arg Pro Ile Glu Ile Thr Gln

210 215 220

Pro Glu Gly Pro Ser Phe Gln Val Asp Gly His Glu Val Arg Trp Glu

225 230 235 240

Asn Trp Arg Phe Arg Ile Gly Phe Asp Pro Arg Glu Gly Leu Val Leu

245 250 255

His Gln Leu Ser Phe Arg Asp Gly Asp Arg Glu Arg Pro Val Val Tyr

260 265 270

Arg Ala Ser Ile Gly Glu Met Val Val Asn Tyr Gly Asp Pro Ser Pro

275 280 285

Ala Arg Phe Trp Gln Asn Tyr Phe Asp Ser Gly Glu Tyr Ser Leu Gly

290 295 300

Lys Leu Ala Asn Glu Leu Val Leu Gly Cys Asp Cys Leu Gly Glu Ile

305 310 315 320

Arg Tyr Phe Asp Ala Val Val Ala Gln Glu Asp Gly Thr Pro Arg Thr

325 330 335

Leu Arg Asn Ala Val Cys Met His Glu Glu Asp Phe Gly Val Leu Trp

340 345 350

Lys His Thr Asp Val Phe Thr Gly Thr Ala Glu Thr Arg Arg Gln Arg

355 360 365

Arg Leu Val Val Ser Phe Phe Val Ser Val Gly Asn Tyr Asp Tyr Gly

370 375 380

Phe Tyr Trp Tyr Leu Tyr Leu Asp Gly Thr Ile Gln Leu Glu Thr Lys

385 390 395 400

Ala Thr Gly Ile Val Phe Thr Ser Ala Tyr Pro Glu Glu Gly Thr Arg

405 410 415

Trp Ala Asn Glu Leu Ala Pro Gly Leu Gly Ala Pro Tyr His Gln His

420 425 430

Leu Phe Gly Ala Arg Leu Asp Met Met Val Asp Gly Thr Arg Asn Ala

435 440 445

Val Asp Glu Val Ala Ala Gln Arg Val Pro Ile Ser Ala Asp Asn Pro

450 455 460

His Gly Asn Ala Phe Thr Arg Ser Val Thr Arg Leu Ala Arg Glu Ser

465 470 475 480

Asp Gly Gly Arg Glu Ala Asp Pro Ala Ala Gly Arg Ala Trp His Val

485 490 495

Val Asn Thr Glu Arg Thr Asn Arg Leu Gly Gln Pro Val Gly Tyr Ala

500 505 510

Leu Leu Pro Gln Gly Thr Pro Val Leu Leu Ala Asp Pro Glu Ser Ser

515 520 525

Ile Ala Gln Arg Ala Ala Phe Ala Thr Lys His Leu Trp Val Thr Gln

530 535 540

His Ala Glu Asp Glu Arg Tyr Pro Ala Gly Glu Trp Val Asn Gln Ser

545 550 555 560

His Gly Gly Ala Gly Ile Pro Ala Phe Thr Ala Ala Asp Arg Ser Ile

565 570 575

Asp Gly Glu Asp Ile Val Leu Trp His Thr Phe Gly Leu Thr His Phe

580 585 590

Pro Arg Pro Glu Asp Trp Pro Ile Met Pro Val Asp Tyr Cys Gly Phe

595 600 605

Thr Leu Lys Pro Val Gly Phe Phe Asp Arg Asn Pro Thr Leu Asp Val

610 615 620

Pro Pro Asn Pro Ser Thr Gly Ser His Cys Cys Glu Ser

625 630 635

<210> 3

<211> 22

<212> DNA

<213> Artificial sequence

<400> 3

atgatggcga tgcacccgct gg 22

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence

<400> 4

tcaggactcg cagcagtggg 20