Mutant p-hydroxyphenylpyruvate dioxygenase, nucleic acid encoding same and use thereof
1. A mutant hydroxyphenylpyruvate dioxygenase (HPPD) protein, or a biologically active fragment thereof, wherein the amino acid sequence of said mutant hydroxyphenylpyruvate dioxygenase (HPPD) protein has one or more mutations selected from the group consisting of: 93S, 103S, 141R, 141K, 141T, 165V, 191I, 220K, 226H, 276W, 277N, 336D, 337A, 338D, 338S, 338Y, 346C, 346D, 346H, 346S, 346Y, 370N, 377C, 386T, 390I, 392L, 403G, 410I, 418P, 419F, 419L, 419V, 420S, 420T, 430G, and 431L.
2. The mutant hydroxyphenylpyruvate dioxygenase (HPPD) protein or biologically active fragment thereof of claim 1, wherein the amino acid sequence of said mutant hydroxyphenylpyruvate dioxygenase protein further has an amino acid sequence which has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity with the amino acid sequence indicated in SEQ ID NO. 2.
3. A mutant hydroxyphenylpyruvate dioxygenase (HPPD) protein or a biologically active fragment thereof as claimed in claim 1, wherein the mutant hydroxyphenylpyruvate dioxygenase protein has the amino acid sequence shown in SEQ ID NO:2, with the difference that it has one or more amino acid mutations as defined in claim 1.
4. A mutant hydroxyphenylpyruvate dioxygenase (HPPD) protein or a biologically active fragment thereof as claimed in any one of claims 1 to 3, wherein the amino acid sequence of the mutant hydroxyphenylpyruvate dioxygenase protein has one or more mutations selected from the group consisting of: r93, a103, H141, a165, V191, R220, G226, L276, P277, P336, P337, N338, R346, D370, I377, P386, L390, M392, E403, K410, K418, G419, N420, E430 and Y431.
5. The mutant hydroxyphenylpyruvate dioxygenase (HPPD) protein or biologically active fragment thereof of claim 4, wherein said mutant hydroxyphenylpyruvate dioxygenase protein has the amino acid sequence SEQ ID NO 4, SEQ ID NO 6, SEQ ID NO 8, SEQ ID NO 10, SEQ ID NO 12, SEQ ID NO 14, SEQ ID NO 16, SEQ ID NO 18, SEQ ID NO 20, SEQ ID NO 32, SEQ ID NO 34, SEQ ID NO 36, SEQ ID NO 38, SEQ ID NO 40, SEQ ID NO 42, SEQ ID NO 44, SEQ ID NO 46, SEQ ID NO 48, SEQ ID NO 50, SEQ ID NO 52, SEQ ID NO 54, SEQ ID NO 56, SEQ ID NO 58, SEQ ID NO 60, SEQ ID NO 62, SEQ ID NO, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82 or 84.
6. The mutant hydroxyphenylpyruvate dioxygenase (HPPD) protein or biologically active fragment thereof of claim 4, wherein the amino acid sequence of said mutant hydroxyphenylpyruvate dioxygenase protein has the following amino acid mutations: H141/D370, H141/N338, K418/G419, G419/N420, H141/N420, G338/K418, P277/N338, L276/P277, H141/N338/N420, P336/N338/R346, K418/G419/N420, P277/N338/N420, or P277/N338/N419/K418/G419.
7.A mutant hydroxyphenylpyruvate dioxygenase (HPPD) protein or a biologically active fragment thereof as claimed in claim 6, wherein the mutant hydroxyphenylpyruvate dioxygenase protein has the amino acid sequence shown by SEQ ID NO 24, SEQ ID NO 86, SEQ ID NO 92, SEQ ID NO 94, SEQ ID NO 100, SEQ ID NO 102, SEQ ID NO 104, SEQ ID NO 106, SEQ ID NO 116, SEQ ID NO 118, SEQ ID NO 150, SEQ ID NO 154, SEQ ID NO 156, SEQ ID NO 188, SEQ ID NO 226, SEQ ID NO 228, SEQ ID NO 230, SEQ ID NO 232, SEQ ID NO 234, SEQ ID NO 236, SEQ ID NO 238, SEQ ID NO 240 or SEQ ID NO 242.
8. A fusion protein comprising a mutated HPPD protein according to any one of claims 1 to 7, or a biologically active fragment thereof, and further components fused thereto, such as a tag peptide, e.g. 6 xhis, or a plastid targeting peptide, e.g. a peptide that targets chloroplasts.
9. An isolated polynucleotide comprising a nucleic acid sequence encoding a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein of any one of claims 1 to 7 or a biologically active fragment thereof, or a fusion protein as set forth in claim 8, or a complement thereof; said polynucleotide is preferably DNA, RNA or a hybrid thereof; the polynucleotide is preferably single-stranded or double-stranded.
10. The polynucleotide of claim 9 having a nucleic acid sequence selected from the group consisting of:
(1) encoding SEQ ID NO 4, SEQ ID NO 6, SEQ ID NO 8, SEQ ID NO 10, SEQ ID NO 12, SEQ ID NO 14, SEQ ID NO 16, SEQ ID NO 18, SEQ ID NO 20, SEQ ID NO 32, SEQ ID NO 34, SEQ ID NO 36, SEQ ID NO 38, SEQ ID NO 40, SEQ ID NO 42, SEQ ID NO 44, SEQ ID NO 46, SEQ ID NO 48, SEQ ID NO 50, SEQ ID NO 52, SEQ ID NO 54, SEQ ID NO 56, SEQ ID NO 58, SEQ ID NO 60, SEQ ID NO 62, SEQ ID NO 64, SEQ ID NO 66, SEQ ID NO 68, SEQ ID NO 70, SEQ ID NO 72, SEQ ID NO 74, SEQ ID NO 76, SEQ ID NO 62, SEQ ID NO 64, SEQ ID NO 66, SEQ ID NO 68, SEQ ID NO 70, SEQ ID NO 72, SEQ ID NO 74, SEQ ID NO 76, SEQ ID NO, 78, 80, 82, 84, 86, 92, 94, 100, 102, 104, 106, 116, 118, 150, 154, 156, 188, 226, 228, 230, 232, 234, 236, 238, 240 or 242 or a complementary sequence thereof;
(2) 3, 5, 7, 9, 11, 13, 15, 17, 19, 23, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 91, 93, 99, 101, 103, 105, 115, 117, 149, 153, 155, 187, 225, 227, 229, 231, 233, 235, 237, 239 or 241 SEQ ID NO;
(3) a nucleic acid sequence which hybridizes with the sequence shown in (1) or (2) under a strict condition; and
(4) a nucleic acid sequence which encodes the same amino acid sequence as that of the sequence shown in (1) or (2) due to the degeneracy of the genetic code, or a complementary sequence thereof.
11. The polynucleotide of claim 10, wherein the nucleic acid sequence is optimized for expression in a plant cell.
12.A nucleic acid construct comprising the polynucleotide of any one of claims 9-11 operably linked to regulatory elements.
13. An expression vector comprising the polynucleotide of any one of claims 9-11 operably linked to an expression control element.
14. A host cell comprising the polynucleotide of any one of claims 9-11, the nucleic acid construct of claim 12 or the expression vector of claim 13, preferably said host cell is a plant cell.
15. A method of producing a plant with increased resistance or tolerance to an herbicide comprising regenerating the plant cell of claim 14 into a plant.
16. A plant produced by the method of claim 15.
17.A method of increasing HPPD-inhibiting herbicide resistance or tolerance of a plant cell, plant tissue, plant part or plant comprising expressing in the plant cell, plant tissue, plant part or plant a mutant p-hydroxyphenyl pyruvate dioxygenase (HPPD) protein or biologically active fragment thereof according to any one of claims 1 to 7 or a fusion protein according to claim 8;
or which comprises crossing a plant expressing a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a biologically active fragment thereof according to any of claims 1 to 7 or a fusion protein according to claim 8 with another plant and selecting plants or parts thereof which have an increased resistance or tolerance to HPPD-inhibiting herbicides;
or wherein a gene editing of an endogenous HPPD protein of said plant cell, plant tissue, plant part or plant is comprised to achieve expression therein of a mutant p-hydroxyphenylpyruvate dioxygenase protein, or a biologically active fragment thereof, according to any one of claims 1 to 7, or a fusion protein according to claim 8.
18. Use of a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a biologically active fragment thereof according to any one of claims 1 to 7, a fusion protein according to claim 8 or a polynucleotide according to any one of claims 9 to 11 for increasing the resistance or tolerance of a host cell or plant cell, plant tissue, plant part or plant to a HPPD-inhibiting herbicide, preferably the host cell is a bacterial cell or a fungal cell.
19. A method of controlling weeds at a plant locus, wherein the plants comprise the plant of claim 16 or a plant prepared by the method of any one of claims 15 and 17, the method comprising applying to the locus a weed controlling effective amount of one or more HPPD inhibiting herbicides; preferably, the HPPD-inhibiting herbicide comprises at least one of the following active ingredients: 1) triketones: sulcotrione, mesotrione, flurtamone, tembotrione, benzofuranone, and benzobicyclon; 2) diketonitriles: 2-cyano-3-cyclopropyl-1- (2-methylsulfonyl-4-trifluoromethylphenyl) propane-1, 3-dione, 2-cyano-3-cyclopropyl-1- (2-methylsulfonyl-3, 4-dichlorophenyl) propane-1, 3-dione, 2-cyano-1- [4- (methylsulfonyl) 2-trifluoromethylphenyl ] -3- (1-methylcyclopropyl) propane-1, 3-dione; 3) isoxazoles: isoxaflutole, isoxaclomazone, clomazone; 4) pyrazoles: topramezone, pyraclostrobin, pyraflutole, topramezone, bicyclopyrone and tembotrione; 5) benzophenones; 6) other classes: lancotrione, fenquinolone; more preferably, the HPPD-inhibiting herbicide comprises at least one of the following active ingredients: tembotrione, topramezone, bicyclopyrone, topramezone, mesotrione and topramezone.
20. The plant of claim 16, the method of any one of claims 17 and 19, or the use of claim 18, wherein the plant is a dicot or monocot, such as a food crop, a legume crop, an oil crop, a fiber crop, a fruit crop, a root crop, a vegetable crop, a flower crop, a pharmaceutical crop, a raw crop, a pasture crop, a sugar crop, a beverage crop, a lawn plant, a tree crop, a nut crop, and the like.
21. A method of making a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein which retains or potentiates the property of catalyzing the conversion of p-Hydroxyphenylpyruvate (HPP) to homogentisate and which is significantly less sensitive to an HPPD-inhibiting herbicide than the wild-type HPPD, which comprises mutating a nucleic acid encoding a wild-type HPPD, fusing and ligating the mutated nucleic acid in an expression vector in frame with a nucleic acid sequence encoding a solubility-enhancing component to form a fusion protein coding sequence, transforming the resulting recombinant expression vector into a host cell, expressing the fusion protein under suitable conditions containing the HPPD-inhibiting herbicide and an HPPD enzymatic substrate and screening for a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein which retains or potentiates the property of catalyzing the conversion of p-Hydroxyphenylpyruvate (HPP) to homogentisate and which has a significantly reduced sensitivity to an HPPD-inhibiting herbicide; the solubility enhancing component is preferably NusA, which forms a fusion protein with the mutated HPPD protein of the invention; the expression vector is preferably a pET-44a vector; the host cell is preferably a bacterial cell, a fungal cell or a plant cell.
Background
Hydroxyphenylpyruvate dioxygenase (HPPD) is an enzyme that catalyzes the reaction of Hydroxyphenylpyruvate (HPP) to convert it into a homogentisate. This reaction occurs in the presence of enzyme-bound iron and oxygen. Herbicides that act by inhibiting HPPD are well known and include various types such as isoxazoles, diketonitriles, triketones, and pyrazoline salts, among others. Inhibition of HPPD blocks the biosynthesis of Plastoquinone (PQ) from tyrosine. PQ is an essential cofactor in the biosynthesis of carotenoid pigments, which are essential for photoprotection in photosynthetic centers. HPPD-inhibiting herbicides are bleaches that are mobilized through the phloem, causing new meristems and leaves exposed to light to appear white. In the absence of carotenoids, chlorophyll is photo-destructive and itself becomes a photo-lytic agent by the photosensitization of singlet oxygen.
Technical routes and methods for providing plants tolerant to HPPD inhibiting herbicides are also known, including over-expressing HPPD enzymes to produce large quantities of HPPD enzymes in plants that are sufficiently related to a given herbicide to have enough available functional enzyme (despite its inhibitor present), or mutating the target HPPD enzyme to a functional HPPD that is less sensitive to the herbicide. HPPD inhibiting herbicides are a broad class which covers many different types. While a given mutant HPPD enzyme may provide a useful level of tolerance to one or some HPPD-inhibiting herbicides, the same or a single mutant HPPD may not be sufficient to provide a commercial level of tolerance to another or another different, more desirable HPPD-inhibiting herbicide (see, e.g., U.S. application publication No. 2004/0058427; and PCT application publications nos. WO98/20144 and WO 02/46387; also see U.S. application publication No. 2005/0246800, which relates to the identification and labeling of soybean varieties that are relatively tolerant to HPPDs). Moreover, different HPPD-inhibiting herbicides can vary in the range of weeds they control, the crop objects used, the cost of manufacture, and the environmental benefits. Thus, there remains a need in the art for novel mutant HPPDs for conferring resistance/tolerance to HPPD-inhibiting herbicides to different crops and crop varieties.
In the aspect of creating herbicide tolerant crops and crop varieties, transgenic technology is widely applied. However, the use of transgenic crops has been limited by the high cost of registration. This current situation can be changed by the advancement of gene editing technology represented by CRISPR/Cas 9. CRISPR/Cas9 is a new gene site-directed editing technique that has emerged since 2012 (Jinek, m., chlylinski, k., Fonfara, i., Hauer, m., Doudna, j.a., and charpienter, e.2012.a programmable dual-RNA-guided DNA endlinking, enzyme in adaptive tissue, science.337:816 @.;. Cong, l.a., Ran, f.a., Cox, d.line, s.barretto, r, libob, n., p.d., Wu, wu.x., wiring, w.e., raffini, l.a., and Zhang, f.2013.multiple gene engineering, g.g., gene. The recognition of the editing target by the CRISPR/Cas9 system depends on the complementary base pairing between nucleic acid molecules, and any target sequence of 20bp which is followed by PAM (NGG) can be edited. In addition, the CRISPR/Cas9 system is simple to operate, only 20-30bp of target nucleotide sequence on the original vector needs to be replaced for each targeting, and the method is suitable for high-throughput operation. Multiple sites of the same gene can be edited simultaneously as well as multiple different genes. At present, the technology has a great application prospect in the aspects of biomedicine, Functional Genomics, animal and Plant trait Improvement, new trait creation and the like, and is generating revolutionary promotion effect on animal and Plant breeding (Hui Zhang, jin shan Zhang, Zhaobo Lang, Jose Ramon Botelled, and Jian-Kang Zhu.2017 genome edition-Principles and Applications for Functional Genomics Research and Crop Improvement, clinical Reviews in Plant Sciences 36:4,291 309 and DOI 10.1080/07352689.2017.1402989).
The CRISPR/Cas9 is used as a third-generation gene editing tool, and the site-specific editing is realized mainly through three modes. The first is the site-directed knockout of the gene to obtain mutants. Specifically, Cas9 recognizes and cleaves a target under the guidance of a targeting rna (grna), generating a double-stranded DNA break; fragmented DNA is usually repaired by non-homologous end joining (NHEJ); it is easy to generate frame shift mutation to destroy the gene during repair. The efficiency of fixed point knockout is high. The second is homologous substitution of the target to replace the target sequence or site-directed insertion. When a double-stranded DNA break is created, homologous substitution or site-directed insertion may occur if a homologous repair template is present nearby. Homologous substitution is less efficient and becomes even less as the length of the sequence to be substituted increases. The third is single base editing (Komor AC, Kim YB, Packer MS, Zuris JA, Liu DR. Programming editing of a target base in genomic DNA without double-stranded DNA clean. Nature.2016May 19; 533(7603):420-4.doi:10.1038/nature 17946; Gaudelli NM, Komor AC, Rees HA, Packer MS, Badran AH, Bryson DI, Liu DR. Programming base editing of A.T.G.C in genomic DNA without DNA clean. Nature.2017Nov 23; 551 7681: 464-471.doi:10.1038/nat 644. Epubu 2017 ct 25. managing Ouim in Nature 2.8May). Single base editing is a gene editing method that uses the CRISPR/Cas9 system to target deaminase to a specific site in the genome, thereby modifying a specific base. This method has been successfully practiced in rice. Such as: yan f., Kuang y., Ren b., Wang j., Zhang d., Lin h., Yang b., Zhou x., and Zhou h. (2018). High-efficient a.t to g.c base injection by Cas9 n-shaped tRNA amino kinase in rice.mol.plant.doi:10.1016/j.mol p.2018.02.008.
In addition, CRISPR/Cpf1 can be used for gene editing as well (Zetsche, B., Gootenberg, J.S., Abudayyeh, O.O., Slaymaker, I.M., Makarova, K.S., Essletzbichler, P., Volz, S.E., Joung, J.Oost, J.Gev., A.Koonin, E.V., and Zhang, F.2015.Cpf1a single RNA-bound end effector of a Class 2CRISPR Cas. cell.163: 759. gene 771; Endo, A.A., Masafumi, M.Kaya, H.and Toki, S.2016a.instant branched gene of Francisco. 1. Sciogel). CRISPR/Cpf1 has two main components: cpf1 enzyme and crRNA that determines system specificity. Although the CRISPR/Cpf1 and CRISPR/Cas9 systems are similar, there are some important differences (Hui Zhang, Jinshan Zhang, Zhaobo Lang, Jos re Ram Lou n Botella & Jian-Kang Zhu (2017) Genome Editing-Principles and Applications for Functional Genomics Research and Crop Improvement, Critical Reviews in Plant Sciences,36:4, 291-. First, the CRISPR/Cpf1 system does not require transactivation of crrna (tracrrna), but instead CRISP/Cas9 is necessary. Therefore, it is relatively short, having only 42-44 nucleotides, including a 19 nucleotide repeat and a 1-23-25 nucleotide long spacer. Third, unlike Cas9 which cleaves DNA double strands at the same position (3-4 bp upstream of PAM) to generate blunt ends, the target sequence cleavage position for Cpf1is 23bp downstream of PAM sequence and the non-target single strand is 18bp downstream of PAM sequence to generate a 5bp overhanging sticky end. The resulting sticky ends may increase the efficiency of HDR-mediated insertion of donor DNA into the Cpf1 cleavage site. Fourth, the CRISPR/Cpf1 system only needs one promoter to drive multiple small crRNAs arrays when editing multiple targets or genes, and is very suitable for multi-target editing. Fifth, the CRISPR/Cas9 system requires a G-rich (5 '-NGG-3') PAM sequence at the 3 'end of the target sequence, and the CRISPR/Cpf1 system requires a T-rich (5' -TTTN-3 'or 5' -TTN-3 ') PAM sequence at the 5' end of the target sequence, suitable for editing multiple A/T DNA or genes. Three engineered CRISPR/Cpf1 systems have been developed, including FnCpf1 from Francisella novicida (Francisella), ascif 1 from Acidaminococcus sp., and LbCpf1 from Lachnospiraceae bacteria (lachnospirillum). Three Cpf1 systems have been used as plant genome editing on the following species: rice, arabidopsis, tobacco and soybean (Endo, a., Masafumi, m., Kaya, h., and Toki, s.2016a. efficient targeted mutagenesis of rice and tobaca genes using Cpf1 from Francisella novicida.sci.rep.6: 38169; Kim, h., s.t., Ryu, j., Kang, b.c., Kim, j.s., and Kim, s.g.2017.CRISPR/Cpf1-mediated DNA-free genome injection. nat.8: 14406.; Tang, x., Lowder, L.g., Zhang, t.t., major, a.a., Zheng, z.g., Zhang, Zhang, T.t.zhahang, J.r.t.t., cement, m.r.m., m.m., m.m.t.m.t.m. 3, m.t.t.m.t. 3. r.t. t. 1. r.m, m.t.t. t. 2. c., r.t. t. 1. f., r.t. rice, m, m.g., r.r.g., Zhang, g., Zhang, J. 3. t. 3. g., r.g., gene, m.g., gene, r.g., gene, m. 3, m, m.g., gene, r.g., gene.
The improvement of herbicide tolerance of important crops through gene editing-mediated homologous replacement, site-directed modification or single base editing is one of the hotspots in the current gene editing research field, and several successful examples have been reported, but all focused on the anti-Acetolactate synthase (ALS) inhibiting herbicides (Yongwei Sun, Xin Zhang, Chuanyin Wu, ubing He, Youzhi Ma, Han Hou, Xiuping Guo, Wenming Du, Yunde Zhao and Lanqin Xia.2016.engineering Herbicide-Resistant Rice Plants through CRISPR/Cas 9-medial Homologous combination of acetic synthase Synthesis Plant 9, 628. quadrature. org/10.1016/j. molp.2016.01.001; Yiyu Cheng Wang, Hanwen Ni, Yongg Xu, Qianjun Cheng, Linjiian J.7.017/20126-20120. crispr.27. K.27. K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K. This requires the continued research and development of new methods for increasing the tolerance of crops to different types of herbicides.
Disclosure of Invention
Based on this, the present application provides a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) conferring HPPD-inhibiting herbicide resistance or tolerance to plants, which mutant HPPD retains or potentiates its property of catalyzing the conversion of p-Hydroxyphenylpyruvate (HPP) to homogentisate, while being significantly less sensitive to HPPD-inhibiting herbicides than the wild-type HPPD. The invention also relates to a biological active fragment of the mutant p-hydroxyphenylpyruvate dioxygenase, a polynucleotide for coding the protein or the fragment and application thereof.
Accordingly, in one aspect, the present invention provides a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein having one or more mutations selected from the group consisting of at positions 93, 103, 141, 165, 191, 220, 226, 276, 277, 336, 337, 338, 342, 346, 370, 377, 386, 390, 392, 403, 410, 418, 419, 420, 430 and 431 in the amino acid sequence of the wild-type rice p-hydroxyphenylpyruvate dioxygenase protein shown in SEQ ID NO: 2: 93S, 103S, 141R, 141K, 141T, 165V, 191I, 220K, 226H, 276W, 277N, 336D, 337A, 338D, 338S, 338Y, 342D, 346C, 346D, 346H, 346S, 346Y, 370N, 377C, 386T, 390I, 392L, 403G, 410I, 418P, 419F, 419L, 419V, 420S, 420T, 430G, and 431L. Preferably, the amino acid sequence of said mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein further has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity with the amino acid sequence depicted in SEQ ID NO. 2. More preferably, the mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein has the amino acid sequence shown in SEQ ID NO:2, differing only in having one or more mutations selected from the group consisting of: 93S, 103S, 141R, 141K, 141T, 165V, 191I, 220K, 226H, 276W, 277N, 336D, 337A, 338D, 338S, 338Y, 342D, 346C, 346D, 346H, 346S, 346Y, 370N, 377C, 386T, 390I, 392L, 403G, 410I, 418P, 419F, 419L, 419V, 420S, 420T, 430G, and 431L.
In another aspect, the invention provides a biologically active fragment of a mutant hydroxyphenylpyruvate dioxygenase (HPPD) protein, which has a deletion of a portion of one or more (e.g., 1-50, 1-25, 1-10 or 1-5, e.g., 1,2, 3,4 or 5) amino acid residues from the N-and/or C-terminus of the protein, but which still retains the desired biological activity of the full-length protein, i.e., retains or potentiates its property of catalyzing the conversion of Hydroxyphenylpyruvate (HPP) to homogentisate, while being significantly less sensitive to HPPD-inhibiting herbicides than the wild-type HPPD or its corresponding biologically active fragment.
The invention furthermore relates to a fusion protein comprising a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein according to the invention or a biologically active fragment thereof and further components, such as peptide or polypeptide components, fused thereto. Preferably, the components confer desirable properties to the fusion protein, such as facilitating its isolation, purification, improving its stability, prolonging its half-life, providing additional biological activity, directing the fused HPPD protein into a target region, e.g. a plastid such as a chloroplast, etc. The choice of the corresponding components is well known to the person skilled in the art.
In another aspect, the invention provides an isolated polynucleotide comprising a nucleic acid sequence encoding said mutant hydroxyphenylpyruvate dioxygenase (HPPD) protein or a biologically active fragment or fusion protein thereof.
The invention also provides nucleic acid constructs comprising the polynucleotides and regulatory elements operably linked thereto.
In a further aspect, the present invention provides an expression vector comprising the polynucleotide and an expression control element operably linked thereto.
In yet another aspect, the invention provides a host cell comprising the polynucleotide, nucleic acid construct or expression vector.
The invention also provides a method of producing a plant with increased resistance or tolerance to an HPPD-inhibiting herbicide.
The invention further relates to plants produced by the above method.
The present invention also provides a method of increasing the resistance or tolerance of a plant to a HPPD inhibiting herbicide, comprising expressing in said plant a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein, or a biologically active fragment or fusion protein thereof, of the present invention.
The present invention further provides a method of increasing the resistance or tolerance of a plant to a HPPD inhibiting herbicide, comprising crossing a plant expressing a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein, or a biologically active fragment or fusion protein thereof, of the present invention with another plant.
The invention further provides a method for increasing the resistance or tolerance of a plant to a HPPD-inhibiting herbicide, comprising genetically editing an HPPD protein endogenous to said plant cell, plant tissue, plant part or plant.
The present invention further relates to the use of a mutant hydroxyphenylpyruvate dioxygenase (HPPD) protein, or a biologically active fragment or fusion protein thereof, of the present invention for increasing HPPD-inhibiting herbicide resistance or tolerance in plants.
The present invention further relates to a method of controlling weeds at a locus of plants, comprising applying to the locus comprising plants or seeds of the invention a weed controlling effective amount of one or more HPPD inhibiting herbicides and not significantly affecting said plants.
Drawings
FIG. 1 shows the color reaction of the culture broth of recombinant E.coli transformed with wild-type or mutant rice HPPD gene cultured in 96-well plate. Wherein the recombinant Escherichia coli expresses one of wild type rice HPPD (WT) or single-site mutant rice HPPD, and the wild type rice HPPD or the single-site mutant rice HPPD contains herbicides of tembotrione (left) or topramezone metabolized products (right, the structural formula is as follows:) The culture under the conditions of (1) shows color change to various degrees. In a well with the same concentration of herbicide, darker color represents higher resistance/tolerance to this herbicide.
FIG. 2 shows the color reaction of the culture broth of recombinant E.coli transformed with wild-type or mutant rice HPPD gene cultured in 96-well plate. Wherein the recombinant Escherichia coli expresses wild-type rice HPPD (WT) and each of the single-site mutant rice HPPDs, and they show color changes of different degrees when cultured in a culture solution containing different concentrations of the herbicide ciclopirox or topramezone. In a well with the same concentration of herbicide, darker color represents higher resistance/tolerance to this herbicide.
FIG. 3 shows the color reaction of the culture broth of recombinant E.coli transformed with wild-type or mutant rice HPPD gene cultured in 96-well plate. Wherein the recombinant Escherichia coli expresses wild-type rice HPPD (WT) and each of the single-site mutant rice HPPDs, and they show color reactions of different degrees when cultured in a culture solution containing the herbicide mesotrione at different concentrations. In a well with the same concentration of herbicide, darker color represents higher resistance/tolerance to this herbicide.
FIG. 4 shows color reaction of recombinant E.coli culture broth transformed with wild-type or mutant rice HPPD gene cultured in 96-well plate. Wherein the recombinant Escherichia coli expresses wild rice HPPD (WT) or one of single-site mutant H141R, G342D and D370N or a combination thereof, and the wild rice HPPD (WT) or the single-site mutant H141R, G342D and D370N show color change to different degrees when cultured under the condition of containing different concentrations of herbicide tembotrione (upper) or after-metabolism products of topramezone. In a well with the same concentration of herbicide, darker color represents higher resistance/tolerance to this herbicide.
FIG. 5 shows color reaction of recombinant E.coli culture broth transformed with wild-type or mutant rice HPPD gene cultured in 96-well plate. Wherein the recombinant Escherichia coli expresses wild-type rice HPPD (WT) or single-site mutant H141R, G342D, D370N or a combination thereof (141+342 represents H141R/G342D; 141+370 represents H141R/D370N; 342+370 represents G342D/D370N; 141+342+370 represents H141R/G342D/D370N), and the recombinant Escherichia coli can show color change with different degrees when cultured in the presence of different concentrations of herbicide cyflufenac (upper) or topramezone (lower). In a well with the same concentration of herbicide, darker color represents higher resistance/tolerance to this herbicide.
FIG. 6 shows color reaction of recombinant E.coli culture broth transformed with wild-type or mutant rice HPPD gene cultured in 96-well plate. Wherein the recombinant Escherichia coli culture fluid expresses wild-type rice HPPD (WT) or single-site mutant H141R, G342D, D370N or a combination thereof, and the wild-type rice HPPD, the single-site mutant H141R, the G342D, the D370N or the combination thereof shows color changes to different degrees when cultured under the conditions containing different concentrations of herbicide mesotrione. In a well with the same concentration of herbicide, darker color represents higher resistance/tolerance to this herbicide.
FIG. 7 shows all amino acid mutations noted on the rice HPPD wild-type enzyme protein.
FIG. 8 shows color reaction of recombinant E.coli culture broth transformed with mutant rice HPPD gene cultured in 96-well plate. Wherein the recombinant Escherichia coli culture solution expresses various combinations of near mutation points 336-338-342-346 and 141R +342D +370N (336D, 338S, 338Y, 342D, 346C, 346H and 346S respectively represent P336D, N338D, N338S, N338Y, G342D, R346C, R346H and R346S, and 141R +342D +370N represents H141R/G342D/D370N), and the combinations are mixed in a medium containing different concentrations of herbicide diaxazone metabolite (code number is 101, and the structural formula is as follows:) The culture under the conditions of (1) shows color changes of different degrees. In a well with the same concentration of herbicide, darker color represents higher resistance/tolerance to this herbicide.
FIG. 9 shows color reaction of recombinant E.coli culture broth transformed with mutant rice HPPD gene cultured in 96-well plate. Wherein the recombinant Escherichia coli culture solution expresses three and four mutation point combinations (141R, 336D, 338S, 338Y, 342D, 346C, 346S, 346H, 370N, 418P and 419F respectively represent H141R, P336D, N338D, N338S, N338Y, G342D, R346C, R346S, R346H, D370N, K418P and G419F), and the three and four mutation point combinations are cultured under the condition containing different concentrations of herbicide diaxazone metabolites to show different degrees of color change. In a well with the same concentration of herbicide, darker color represents higher resistance/tolerance to this herbicide.
FIG. 10 shows the inhibition curves of the metabolites of topramezone against OsHPPD WT and the respective mutants, with the abscissa representing the concentration of compound 101 and the ordinate representing the reaction rate at 0 concentration of inhibitor as 100%, representing the residual activity of the enzyme at different concentrations of 101, and the numbers in the graphs represent the respective mutation sites. As can be seen from the figure, wild-type WT was very sensitive to 101, with complete inhibition of activity at a 101 concentration of about 60uM, whereas each mutant showed a strong increase in resistance. From this result, it was possible to calculate the IC50 value for 101 inhibition of activity of each mutant, which also demonstrated that each mutant exhibited significantly improved resistance to wild-type OsHPPD (where 141R, 338D, 342D, 346C, 346H, 370N, 386T, 418P, 419F, 420S represent H141R, N338D, G342D, R346C, R346H, D370N, P386T, K418P, G419F, N420S, respectively).
FIG. 11 shows sensitivity of transgenic rice (Zhonghua 11) to the HPPD inhibitor herbicide tembotrione. OsHPPD3M (H141R/G342D/D370N) expressing mutant rice can keep green in a medium containing 3uM tembotrione, but the Michely seedlings expressed by negative Control (CK) are also seriously whitened in a medium containing 1.0uM tembotrione (phytotoxicity).
FIG. 12 shows tolerance of transgenic rice (middle flower 11) to the HPPD inhibitor herbicide, topramezone. Plants expressing OsHPPD3M of rice plants of the T0 generation can tolerate 8-16 g of the active ingredient of topramezone per mu, but die quickly after severe albinism of a non-transgenic Control (CK) (A, B); plants expressing OsHPPD3M from T1 generation plants tolerated 32-64 grams of the active ingredient topramezone per acre, but died soon after severe albinism in the non-transgenic controls (C, D).
FIG. 13 shows rice HPPD single base editing vectors.
FIG. 14 shows sequence analysis of single base edited rice seedlings and their target H141R (CAC > CGC).
A: single base editing seedlings: in a culture medium with 0.4uM cyclosulfoketone, the person which is not successfully edited whitens (phytotoxicity), and the person which is successfully edited keeps green;
b: sequence of single base editing target: the wild type of the 141 th amino acid of the rice HPPD is histidine His, the codon is CAC (upper graph), the codon is arginine Arg after editing, and the codon is CGC (in the example, heterozygote, double peak appears).
FIG. 15 shows the structure of the rice hppd gene (Oshppd > NC029257.1), displaying two exons (exon), one intron (intron), three mutation sites (141, 342, 370) and designed targeted cleavage sites (gRNA1-2, gRNA 2-1).
FIG. 16 shows the structure of a template DNA. The length of the core replacement region of the three mutant amino acids 141-342-370-1056 bp, the left and right homologous arms are 350bp respectively, and after cutting from the vector, the left and right ends are respectively left with 6bp, and the total length of the template is 1768 bp; in order to facilitate rapid genotype identification of a PCR product after PCR amplification, the NcoI enzyme cutting site in the PCR product is removed; and PAM (NGG) at the original cutting site on the template is also removed to avoid re-cutting after replacement.
FIG. 17 shows homologous substitution triple mutation points of rice HPPD gene (H141R-G342D-D370N).
A: rice HPPD gene editing seedling: in the presence of 0.4uM tembotrione, unsuccessfully edited (wild type WT) whitened (phytotoxicity), and successfully edited 2 seedlings (AW2, AW3) remained green;
b: after homologous substitution, the codons at amino acids 342 and 370 were changed, GGC to GAC and GAC to AAC (heterozygote; resulting in portions G342D and D370N); H141R (CAC > CGC) was also successfully edited (sequence not shown).
Detailed Description
Some terms used in the present specification are defined as follows.
In the present invention, an "HPPD-inhibiting herbicide" is a substance which is itself herbicidally active or which is combined with other herbicides and/or additives capable of modifying its effect and which is capable of acting by inhibiting HPPD. Substances which are themselves capable of acting herbicidally by inhibiting HPPD are well known in the art and include many types, 1) triketones, for example, Sulcotrione (CAS number: 99105-77-8); mesotrione (Mesotrione, CAS number 104206-82-8); fluroxyprione (bicyclopyrone, CAS number: 352010-68-5); tembotrione (CAS number: 335104-84-2); mesotrione (tefuryltrione, CAS number 473278-76-1); benzobicylon (Benzobicyclon, CAS number: 156963-66-5); 2) diketonitriles, for example, 2-cyano-3-cyclopropyl-1- (2-methylsulfonyl-4-trifluoromethylphenyl) propane-1, 3-dione (CAS number: 143701-75-1); 2-cyano-3-cyclopropyl-1- (2-methylsulfonyl-3, 4-dichlorophenyl) propane-1, 3-dione (CAS number: 212829-55-5); 2-cyano-1- [4- (methylsulfonyl) -2-trifluoromethylphenyl ] -3- (1-methylcyclopropyl) propane-1, 3-dione (CAS number: 143659-52-3); 3) isoxazoles, for example, isoxaflutole (isoxaflutole, CAS number: 141112-29-0); isoxachlorotole (isoxachlorotolole, CAS number 141112-06-3) clomazone (CAS number 81777-89-1); 4) pyrazoles, for example, topramezone (CAS number: 210631-68-8); sulfonylopyrazole (pyrasulfotole, CAS number: 365400-11-9); benzoxazole (pyrazoxyfen, CAS number: 71561-11-0); pyrazolate (pyrazolite, CAS number: 58011-68-0); bifenac (benzofenap, CAS number: 82692-44-2); topramezone (CAS number: 1622908-18-2); tolpyralate (CAS number: 1101132-67-5); benzoxaflutole (CAS number: 1992017-55-6); bicyclopyrone (CAS number: 1855929-45-1); mesotrione triazolate (CAS number: 1911613-97-2); 5) benzophenones; 6) other classes: lancotrione (CAS number: 1486617-21-3); fenquinolones (CAS number: 1342891-70-6). Preferably, the herbicide is tembotrione, topramezone, mesotrione, topramezone, or any combination thereof, and the like.
A plant that "has increased tolerance to an HPPD-inhibiting herbicide" or "has increased resistance to an HPPD-inhibiting herbicide" refers to a plant that has increased tolerance or resistance to the HPPD-inhibiting herbicide as compared to a plant containing a wild-type HPPD gene. An HPPD enzyme that "has increased tolerance to an HPPD-inhibiting herbicide" or "has increased resistance to an HPPD-inhibiting herbicide" refers to an HPPD enzyme that exhibits at least 10%, preferably at least 15%, more preferably at least 20% greater enzyme activity than the wild-type HPPD enzyme at a concentration of herbicide known to inhibit the activity of the corresponding wild-type HPPD enzyme protein. In the present invention, the terms "HPPD-inhibiting herbicide tolerance" and "HPPD-inhibiting herbicide resistance" are used interchangeably and refer to both tolerance to HPPD-inhibiting herbicides and resistance to HPPD-inhibiting herbicides.
The term "wild-type" refers to a nucleic acid molecule or protein that can be found in nature.
The terms "protein", "polypeptide" and "peptide" are used interchangeably herein to refer to a polymer of amino acid residues, including polymers in which one or more amino acid residues are chemical analogues of a natural amino acid residue. The proteins and polypeptides of the invention may be produced recombinantly or may be chemically synthesized. The term "mutein" or "mutant protein" refers to a protein having substitutions, insertions, deletions and/or additions of one or more amino acid residues compared to the amino acid sequence of the wild-type protein.
The terms "polynucleotide" and "nucleic acid" are used interchangeably and include DNA, RNA, or hybrids thereof, whether double-stranded or single-stranded.
In the present invention, a "host organism" is understood to be any unicellular or multicellular organism into which a nucleic acid encoding a mutated HPPD protein can be introduced, including, for example, bacteria such as e.coli, fungi such as yeasts (e.g. saccharomyces cerevisiae), molds (e.g. aspergillus), plant cells and plants, and the like.
In the context of the present invention, "plant" is understood to be any differentiated multicellular organism capable of photosynthesis, in particular monocotyledonous or dicotyledonous plants, such as: (1) grain crops: oryza (Oryza spp.), such as rice (Oryza sativa), broadleaf rice (Oryza latifolia), rice (Oryza sativa), and palea (Oryza glaberrima); triticum spp, such as Triticum aestivum, durum wheat (t.turgidumssp. durum); hordeum spp, such as barley (Hordeum vulgare), arizona barley (Hordeum arizonicum); rye (Secale cereale); avena species (Avena spp.) such as oats (Avena sativa), wild oats (Avena fatua), barnacle oats (Avena byzantina), Avena fatua var.sativa, hybrid oats (Avena hybrida); echinochloa spp, for example, pearl millet (Pennisetum glaucum), Sorghum (Sorghum bicolor), triticale (triticale vulgare), maize or corn, millet, rice (rice), millet, broom millet, Sorghum bicolor, millet, Fagopyrum (Fagopyrum spp.), millet (Panicum), millet (Setaria italica), Zizania indica (Zizania palustris), Icelia carinata (Eragrostis tef), millet (Panicum milliaceum), and Uncaria paniculata (Eleusco tara); (2) bean crops: glycine (Glycine spp.), for example, Glycine (Glycine max), Glycine (Soja hispida), Glycine max, Vicia (Vicia spp.), Vigna (Vigna spp.), Pisum (Pisum spp.), Pisum (field bean), Lupinus (Lupinus spp.), Vicia (Vicia), tamarind (tamarind indica), lentil (Lens culinaris), lathyrium (lathyrius spp.), physalis (Lablab lab), fava bean, mung bean, red bean, and tonka bean; (3) oil crops: peanuts (Arachis hypogaea), groundnut (Arachis spp), flax (Sesamum spp.), sunflower (Helianthus spp.), soybean (soybean annuus), oil palm (Elaeis) such as oil palm (Eiaeis guineensis, Elaeis americana (Elaeis oleifera), soybean (soybean), oilseed rape (Brassicananus), canola, sesame, mustard (Brassicajuncea), rapeseed oilseed rape (oilsedandrae), camellia oleifera, oil palm, olive, castor oil, European rape (Brassica napus L.), canola (canola); (4) fiber crops: sisal (Agave sisalana), cotton (cotton, Gossypium barbadense, Gossypium hirsutum), kenaf, sisal, abaca, flax (Linum usittissimum), jute, ramie, hemp (Cannabis sativa), or hemp; (5) fruit crops: ziziphus (Ziziphus spp.), cucurbita (Cucumis spp.), passion fruit (Passiflora edulis), Vitis (Vitis spp.), Vaccinium (Vaccinium spp.), Pyrus (Pyrus communis), Prunus (Prunus spp.), Psidium guava (Psidium spp.), Punica (Punica grantum), Malus (Malus spp.), watermelon (Citrus latus, Citrus (Citrus spp.), fig (Ficus Carica), aurantium (Fortunella spp.), strawberry (fraga spp.), Crataegus (Crataegus spp.), persimmon (Diospyros persica spp.), red fruit (mangifera spp.), Cucumis (Cucumis spp.), pruus (Prunus spp.), Prunus spp.), Prunus spp (Prunus spp.), Prunus spp., mangus (Prunus spp.), Prunus spp., mangus spp.), Prunus spp. (Citrus spp.), Prunus spp.) (Citrus spp.) (mangus spp.), Prunus spp.) (mangus spp.) (mangifera), Prunus spp.) (mangifera), Prunus spp.) (mangifera), Prunus spp.) (mangifera), Prunus spp.) (mangifera) and Prunus spp.) (mangifera) a (mangifera) a (mangifera) and mangifera (mang, Guava (Psidium guajava), apple peel (Mammea americana), mango (Mangifera indica), olive (oleaeuropaa), papaya (cariapaya), coconut (Cocos nucifera), acerola (Malpighia emarginata), naseberry (manikala zapota), pineapple (anaas comosus), Annona (Annona spp.), Citrus tree (Citrus spp.), aronia (Artocarpus spp.), Litchi (lichenis spp.), scirpus (triquetrum), scirpus (Ribes spp.), Rubus (russpp), pear, apricot, plum, bayberry, lemon, orange, rose, strawberry (strawberries, melon, coconut, blueberry, peach, walnut; (6) root crops: cassava (Manihot spp.), sweet potato (Ipomoea batatas), taro (Colocasia esculenta), tuber mustard, onion, water chestnut, nutgrass flatsedge, yam; (7) vegetable crops: spinach (Spinacia spp.), Phaseolus (Phaseolus spp.), lettuce (Lactuca sativa), Momordica charantia (Momoracia spp.), parsley (Petroselinum crispum), Capsicum (Capsicum spp.), Solanum (Solanum spp.) (such as potato (Solanum tuberosum), red tomato (Solanum integrifolium) or tomato (Solanum lycopersicum)), Lycopersicum (Lycopersicon spp.) (such as tomato (Lycopersicon esculentum), tomato (Lycopersicon esculentum), tomato shaped tomato (Lycopersicon esculentum), potato (Brassica oleracea), potato (Brassica), tomato (Brassica oleracea), potato (Brassica oleracea (Brassica), potato (Brassica oleracea), potato (Brassica oleracea), potato (Brassica oleracea), potato (Brassica oleracea ), potato (Brassica oleracea (L. sp.) (Brassica oleracea ), potato (L.sp.) (Brassica oleracea), potato (L.) (Brassica oleracea), potato (L.sp.) (Brassica oleracea, Brassica oleracea (L.) (Brassica oleracea, Brassica) and Brassica oleracea, Brassica oleracea), potato (L.) (Brassica oleracea), potato (L.) (Brassica oleracea, or Brassica oleracea, and Brassica oleracea, and Brassica oleracea) and Brassica oleracea (L. sp., Brassica oleracea) and (L.sp.) (Brassica oleracea) and Brassica oleracea L., White gourd (Benincasa hispida), Asparagus (Asparagus officinalis), celery (Apium graveolens), Amaranthus (Amaranthus spp.), Allium (Allium spp.), Abelmoschus spp. (abelmosmus spp.), endive (Cichorium endivia), Cucurbita (Cucurbita spp.), coriander (coriandem sativum), eruca sativa (b. carinata), radish (Rapbanus sativus), Brassica species (e.g. european rape (Brassica napus), Brassica rapa (Brassica rapa), Brassica napus), Brassica rapa (Brassica rapa Brassica oleracea), Brassica oleracea, Brassica rapa, Brassica oleracea, Brassica juncea, Brassica oleracea, Brassica rapa, Brassica oleracea, Brassica napus; (8) flower crop: trollius chinensis (tropaeolium minus), trollius chinensis (tropaeolium maju), Canna indica (cana indica), Opuntia (Opuntia spp.), marigold (Tagetes spp.), orchid, crinum asiaticum, kaffir lily, hippeastrum, roses, jasmine flowers, tulip, cherry blossom, morning glory, calendula, lotus, daisy, carnation, petunia, tulip, lily, plum blossom, narcissus, welcome spring, primrose, daphne, magnolia liliifolia, jojobi, juniper, kaffir, peony, Chinese flowering apple, clove, azalea, smile, meadowrue, juniper berry, chinaberry bark, golden belt flower, iris, yunnan yellow jasmine, azalea, cyclamen, dendrobium, feverfew, butterfly, begonia, calendula, begonia, calamus; (9) medicinal crops: safflower (Carthamus tinctorius), Mentha (Mentha spp.), Rheum undulatum (Rheum rhabararum), Crocus sativus (Crocus sativus), medlar, polygonatum odoratum, rhizoma polygonati, rhizoma anemarrhenae, radix ophiopogonis, bulbus fritillariae cirrhosae, radix curcumae, fructus amomi, polygonum multiflorum, Rheum officinale, liquorice, radix astragali, ginseng, pseudo-ginseng, acanthopanax, angelica sinensis, ligusticum wallichii, radix bupleuri, stramonium, flos daturae, mint, leonurus, wrinkled gianthyssop, scutellaria baicalensis, selfheal, pyrethrum, ginkgo biloba, cinchona japonica, natural rubber trees, alfalfa and pepper; (10) raw material crops: rubber, castor (Ricinus communis), tung tree, mulberry, rose, birch, alder, sumac; (11) pasture crops: agropyron spp, axyrium spp, Miscanthus (Miscanthus sinensis), Pennisetum (Pennisetum sp.), Phalaris (Phalaris arundinacea), switchgrass (Panicum virgatum), grassland (prairie grass), Indian grass (Indian grass), Big-bristlegrass (Big bluestem grass), Phleum pratense, turfgrasses (turf), Cyperaceae (tall-fleabane, sedge (Carex pedioformis), low-bristlegrass, alfalfa, ladder grass, lucerne, tamarisk, field-grass, red duckweed, water tassel, lupine, trefoil, sargentgloryvine, water lettuce, peanut, black grass; (12) sugar crops: sugar cane (Saccharum spp.), sugar beet (Beta vulgaris); (13) beverage crops: camellia Sinensis (Camellia Sinensis), Camellia Sinensis (tea), coffee (Coffea spp.), Theobroma cacao, and hops (hop); (14) lawn plants: grass of the genus Poa (Poa spp.) (Poa pratensis (blue grass)), Agrostis species (Agrostis spp.) (grass of the species Agrostis cut (Agrostis pulustris), Agrostis stolonifera (Agrostis pulustris), Hami grass species (Lolium spp.), Imperata species (Festuca spp.) (Lemongrass aethiopica), Hamamelis species (Zoysia spp.) (Hamames virginiana (Zoysia japonica)), Bermuda species (Cynodon spp.) (Bermuda grass ), Bluegrass (Stenothera segetum (Stenothaplocalyx secudum) (Ocimum stostegia sp.), Echinus species (Pacifia spp.) (Paulo sporum spp.) (grass), Erythium grass (Buchloa spp.) (grass of the species (Buchloa sporum), Setaria (Buchloa spp.) (grass of the species (Bulletia), Setaria (Populus spp.) (grass of the species (Populus sp.), Nepalustaria), Setaria (Populus spp.), Nepalustris (Bullens), Selaginella (Bullens (Populus spp.) (Populus spp.), Selaginella (Populus spp.), Selagineus (Populus spp.), Selagineus spp.) (Populus spp.), Selagineus spp.) (Populus spp.), Selagineus spp.) (Populus spp.) (Populus spp.) (Populus spp.), P), Populus spp.) (Populus spp.), P. sp.), Populus spp.) (Populus spp.), P. sp.), shortleaf kyllinga (Kylingbraflifolia), Amur sedge (Cyperusaamuricius), erigeron canadensis (Erigerontacanderensis), Hydrocotyle sativa (Hydrocotyle polytrichoides), Orthosiphon aristatus (Kummerowiata), Euphorbia humifusa (Euphorbia humifusa), Viola odorata (Violaarvensis), Carex alba (Carex alba), Carex isoprocarpus, and Triperus viridis (turf); (15) and (3) tree crops: pinus (Pinus spp.), Salix sp.), Acer (Acer spp.), Hibiscus spp.), Eucalyptus (Eucalyptus sp.), Ginkgo biloba (Ginko biloba), Bambusa (Bambusa sp.), Populus (Populus spp.), Mucuna (Prosopis spp.), Quercus spp, Roxburgh Erythrosea (Phoenix spp.), Fagus spp, Centipeda indicus (Fagus spp.), Pinus spp), Cinnamomum camphora (Cinnoma spp.), Corchorus spp, Phragus Phragmitis (Phragmitis spp.), Acipenser (Phyllanthus spp.), Aconitum spp), Potentilla spp, Potentilla camphora (Cinnomomum spp.), Populus spp, Corchorus spp, Populus australis, Populus tremula (Phragmitis spp.), Populus spp, Populus nigra, Populus spp, Populus nigra spp, Populus trex spp, Populus tremulus spp, Populus trex tremulus trex, Populus trex spp, Populus trex tremulus spp, Populus tremulus spp, Populus tremulus spp, Populus tremulus spp, Populus tremulus spp, Populus tremulus spp, Populus tremulus spp, Populus tremulus, Populus tremulus, Davidia involucrata, kapok, acacia redbud, bauhinia variegata, rain tree, albizia julibrissin, tarragon, erythrina indica, southern magnolia, cycas revolute, crape myrtle, conifer, arbor, and shrub; (16) nut crop: brazil chestnut (bertholetia excelsea), Castanea (Castanea spp.), Corylus (Corylus spp.), pecan (Carya spp.), Juglans (Juglans spp.), pistachio (Pistacia vera), cashew (Anacardium occidentale), Macadamia nut (Macadamia integrifolia), pecan nut, Macadamia nut, pistachio nut, almond and nut-producing plants; (17) and others: arabidopsis thaliana, brachiaria, tribulus terrestris, setaria viridis, eleusine indica, Cadaba farinosa, algae (algae), Carex elata, ornamental plants, pseudodamnacanthus macrophyllus (Carissa macrocarpa), Cynara (Cynara spp.), wild carrot (Daucus carota), Dioscorea (Dioscorea spp.), sugarcane (saccharum sp.), Festuca (Erianthus sp.), Festuca (Festuca arundinacea), daylily (hemerallis fulva), Lotus (Lotus spp.), Luzula sylvatica, alfalfa (Medicago sativa), sweet clover (Melilotus spp.), black mulberry (Morus nigra), tobacco (Nicotiana spp.), blackcurrant (Sambucus spp.), garden balsam sp), blackcurrant (trifolium spp.), garden balsam (trifolium spp.), Syzygium (trichocaulon), and eupatorium (trichocaulon), Syzygium (trichocaulon), syphilia, eupatorium (trichocaulon), eupatorium spp.), eupatorium (trichocaulon, eupatorium spp.), eupatorium (trichocaulon, eupatorium spp.), eupatorium fort (trichocaulon, eupatorium fort, eupatorium spp.), eupatorium fort (trichocaulon.
In the present invention, the term "plant tissue" or "plant part" includes plant cells, protoplasts, plant tissue cultures, plant calli, plant pieces, as well as plant embryos, pollen, ovules, seeds, leaves, stems, flowers, branches, seedlings, fruits, kernels, ears, roots, root tips, anthers and the like.
In the present invention, "plant cell" is understood to be any cell derived from or found in a plant, which is capable of forming, for example: undifferentiated tissue such as callus, differentiated tissue such as embryos, plant parts, plants or seeds.
For the terms used in the specification with respect to amino acid substitutions, the first letter represents the naturally occurring amino acid at a position in the specified sequence, the following numbers represent the position relative to SEQ ID NO. 2, and the second letter represents the different amino acid that substituted the natural amino acid. For example, A103S shows that the alanine in position 103 is replaced by a serine in relation to the amino acid sequence of SEQ ID NO. 2. By amino acid substitution where the first letter is absent, it is meant that the natural amino acid is substituted by the amino acid represented by the letter following the number at the position corresponding to SEQ ID NO:2, relative to the amino acid sequence of its wild-type protein. For double or multiple mutations, each mutation is separated by a "/". For example, H141R/G342D/D370N indicates that, relative to the amino acid sequence of SEQ ID NO:2, histidine at position 141 is substituted with arginine, glycine at position 342 is substituted with aspartic acid, and aspartic acid at position 370 is substituted with asparagine, all three mutations being present within the particular mutant HPPD protein.
In one aspect, the present invention discloses a mutant HPPD protein or biologically active fragment thereof that retains the activity of catalyzing the conversion of Hydroxyphenylpyruvate (HPP) to homogentisate while having improved resistance or tolerance to HPPD-inhibiting herbicides as compared to the wild-type p-hydroxyphenylpyruvate dioxygenase protein. Specifically, the mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein of the invention has one or more mutations selected from the group consisting of: 93S, 103S, 141R, 141K, 141T, 165V, 191I, 220K, 226H, 276W, 277N, 336D, 337A, 338D, 338S, 338Y, 342D, 346C, 346D, 346H, 346S, 346Y, 370N, 377C, 386T, 390I, 392L, 403G, 410I, 418P, 419F, 419L, 419V, 420S, 420T, 430G, and 431L. Preferably, the amino acid sequence of said mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein further has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity with the amino acid sequence depicted in SEQ ID NO. 2. More preferably, the mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein has the amino acid sequence shown in SEQ ID NO:2, differing only in having one or more mutations selected from the group consisting of: 93S, 103S, 141R, 141K, 141T, 165V, 191I, 220K, 226H, 276W, 277N, 336D, 337A, 338D, 338S, 338Y, 342D, 346C, 346D, 346H, 346S, 346Y, 370N, 377C, 386T, 390I, 392L, 403G, 410I, 418P, 419F, 419L, 419V, 420S, 420T, 430G, and 431L.
In one embodiment, the amino acid sequence of a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein of the invention has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the wild-type rice p-hydroxyphenylpyruvate dioxygenase protein amino acid sequence shown in SEQ ID No. 2 and has one or more mutations selected from the group consisting of: 93S, 103S, 141R, 141K, 141T, 165V, 191I, 220K, 226H, 276W, 277N, 336D, 337A, 338D, 338S, 338Y, 342D, 346C, 346D, 346H, 346S, 346Y, 370N, 377C, 386T, 390I, 392L, 403G, 410I, 418P, 419F, 419L, 419V, 420S, 420T, 430G, and 431L. Preferably, the mutant P-hydroxyphenylpyruvate dioxygenase (HPPD) protein of the invention has the amino acid sequence shown in SEQ ID NO:2, differing only in that at one or more of the positions 93, 103, 141, 165, 191, 220, 226, 276, 277, 336, 337, 338, 342, 346, 370, 377, 386, 390, 392, 403, 410, 418, 419, 420, 430 and 431 in the amino acid sequence of the wild-type rice P-hydroxyphenylpyruvate dioxygenase protein shown in SEQ ID NO:2 there are one or more mutations selected from the group consisting of R93, A103, H141, A165, V191, R220, G226, L276, P277, P336, P337, N338, G342, R346, D370, I377, P390, L403, M392, E403, K410, K420, K419, G419, Y and Y386.
The specific amino acid positions (numbering) within the proteins of the invention are determined by aligning the amino acid sequence of the protein of interest with SEQ ID NO. 2 using standard sequence alignment tools, such as the Smith-Waterman algorithm or the CLUSTALW2 algorithm, wherein the sequences are considered aligned when the alignment score is highest. Alignment scores can be calculated according to the method described in Wilbur, W.J. and Lipman, D.J, (1983) Rapid similarity searches of nucleic acid and protein data bases, Proc.Natl.Acad.Sci.USA,80: 726-730. Default parameters are preferably used in the ClustalW2(1.82) algorithm: protein gap opening penalty of 10.0; protein gap extension penalty of 0.2; protein matrix Gonnet; protein/DNA end gap-1; protein/DNA GAPDIST ═ 4.
The position of a particular amino acid within a protein according to the invention is preferably determined by aligning the amino acid sequence of the protein with SEQ ID NO:2 using the AlignX program (part of the vectorNTI set) with default parameters for multiple alignments (gap open penalty: 10og gap extension penalty 0.05).
Amino acid sequence identity can be determined by routine methods, by computerized operating algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics package, Genetics Computer Group), with reference to, for example, the teachings of Smith and Waterman,1981, adv.Appl.Math.2:482, Pearson & Lipman,1988, Proc.Natl.Acad.Sci.USA 85:2444, Thompson et al, 1994, Nucleic Acids Res 22:467380, etc. The BLAST algorithm (Altschul et al, 1990, mol. biol.215:403-10), available from the National Center for Biotechnology Information www.ncbi.nlm.nih.gov /), can also be used, determined using default parameters.
In a further embodiment, the mutant p-hydroxyphenyl pyruvate dioxygenase protein of the invention has the amino acid sequence SEQ ID NO 4, SEQ ID NO 6, SEQ ID NO 8, SEQ ID NO 10, SEQ ID NO 12, SEQ ID NO 14, SEQ ID NO 16, SEQ ID NO 18, SEQ ID NO 20, SEQ ID NO 22, SEQ ID NO 32, SEQ ID NO 34, SEQ ID NO 36, SEQ ID NO 38, SEQ ID NO 40, SEQ ID NO 42, SEQ ID NO 44, SEQ ID NO 46, SEQ ID NO 48, SEQ ID NO 50, SEQ ID NO 52, SEQ ID NO 54, SEQ ID NO 56, SEQ ID NO 58, SEQ ID NO 60, SEQ ID NO 62, SEQ ID NO 64, SEQ ID NO 66, SEQ ID NO 32, SEQ ID NO 34, SEQ ID NO 36, SEQ ID NO 38, SEQ ID NO 40, SEQ ID NO 42, SEQ ID NO 44, SEQ ID NO 46, SEQ ID NO 48, SEQ ID NO 50, SEQ ID NO 52, SEQ ID NO 54, SEQ ID NO 56, SEQ ID, 68, 70, 72, 74, 76, 78, 80, 82 or 84.
In a further embodiment, the mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein of the invention has the following amino acid mutations in its amino acid sequence: H141R/G342D, H141R/D370N, G342D/D370N, H141R/N338D, H141R/G342D, N338D/G342D, K418P/G419F, G419F/N420S, G342D/R346C, G342C/R346C, H141/N420C, G338C/K418C, P277C/N338C, L276C/P277 346, H141/G C/D C, H141C/N338C/N420C, H141/N C/N338C, P336/N338/G342/G C/N338, P C/N336/C, P C/N338/N336/C, P342/N338/N342, P342/N C/N338/N342/N C, N C/N338/N342/N C, N C/N C, N C/C, N C/36342/C, N C/N338/C/36342, N338/C/36342/N C, N/N C/N/C, N338/C, N36342/C, N/C/36342/C, N338/36342/C, N/C/36342/C/36342/C, N338/C/36342/C/N338/C, N338/C, N/C/36342/C, N/36342/C, N/36342/C, N338/C/36342/C/36342R/C, N/C/36342/C, N/C/36342/C, N/C/N/C, N/36342/C, N338R/C, N338/C/36342/C, N/C/36342R/36342/, P336D/N338D/R346C, P336D/N338D/R346H, P336D/N338D/R346S, P336D/N338S/R346C, P336D/N338S/R346H, P336D/N338S/R346S, P336D/N338Y/R346C, P336D/N338D/R36346 72, P336D/N338D/R36346D/R346D/36346 72, H141/N338/G342/G D, H141/G D/K418D, H141/G342/G D/G419/G36342, H D/36342/D, K36392/G D/36342/D/36342, H D/36342/D/36141/D/36342, H D/36342/D/36342, H D/36342/D/36342, H/36141/36342/D/36342, H/D/36342/D/36342, H/36342/D/36141/36342, H/D/36342/D, H/D/36342/D, H/36141/D/36342/D/36342/D, H/D/36141/36342/D, H/36342/D, H/D/36342/D/36141/36342/D, H/36342/36141/D, H/D/36342/D, H/D/36141/D/36342/D, H/36342/D, H/36342/D, P/D, P D/36141/D, P/D/36342/D, P/D/36342/D/36342, P/D, P/36342/D, P/D/36342/D, P/D/36141/D, P/36342/D, P/D/36342H/D, P/36342H, H141/N338/G342, P277/G342/R346, P277/N338/N420, N338/G342/K418, H141/N338/G342/G419, H141/N338/G342/P386, H141/N338/G342/R346, H141/G342/K418/G419, H141/G342/L276/P277, P336/N338/G/R346, P336/N338/G342/R346, P336/N338/G346, P336/N336/G342/R346, P336/N338/G342/R342, P342/N342/G/R342, and P141/G342/P342/G/P342/L346, P336D/N338Y/G342D/R346S, P277N/P336D/N338D/G342D, P277N/N338D/G342D/R346C, P277N/N338D/K418P/G419F, H141R/N338D/G342D/K418P/G419F, H141R/N338D/G342D/G419F/N420S, H141R/G336D/G342D/K418P/G419F/N420S, H141R/N338D/G342D/K418P/G419F/N420S, H141R/N338D/G342D/K418P/G419F/N420T, H141R/N338D/G342D/R346C/K418P/G419F/N420F, H141F/N338F/G342F/R346F/K418F/G419F/N420F, H141F/P277F/G F/K338F/G419F/N F/G36342/K419F/N F/G F/K418/G419F/N419F/G F/K419F/G36419F/N F/G36419/N F/G36419F/N F/G36419F/N36419F/N36363672/N36419F/N36363672/N363672/N36419F/N3636363672.
In still further embodiments, the mutant hydroxyphenylpyruvate dioxygenase (HPPD) protein of the invention has SEQ ID NO 24, SEQ ID NO 26, SEQ ID NO 28, SEQ ID NO 30, SEQ ID NO 86, SEQ ID NO 88, SEQ ID NO 90, SEQ ID NO 92, SEQ ID NO 94, SEQ ID NO 96, SEQ ID NO 98, SEQ ID NO 100, SEQ ID NO 102, SEQ ID NO 104, SEQ ID NO 106, SEQ ID NO 108, SEQ ID NO 110, SEQ ID NO 112, SEQ ID NO 114, SEQ ID NO 116, SEQ ID NO 118, SEQ ID NO 120, SEQ ID NO 122, SEQ ID NO 124, SEQ ID NO 126, SEQ ID NO 128, SEQ ID NO 130, SEQ ID NO 132, SEQ ID NO 96, SEQ ID NO 98, SEQ ID NO 100, SEQ ID NO 102, SEQ ID NO 104, SEQ ID NO 106, SEQ ID NO 108, SEQ ID NO 110, SEQ ID NO 112, SEQ ID NO 114, SEQ ID NO 116, SEQ ID NO 118, SEQ ID NO 120, SEQ ID NO 122, SEQ ID NO 124, SEQ ID NO 126, SEQ ID NO 128, SEQ ID NO 130, SEQ ID NO 132, SEQ ID NO, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 192, 186, 188, 192, 194, 196, 198, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 152, SEQ ID NO: 200. SEQ ID NO: 202. SEQ ID NO: 204. SEQ ID NO: 206. SEQ ID NO: 208. SEQ ID NO: 210. SEQ ID NO: 212. SEQ ID NO: 214. SEQ ID NO: 216. SEQ ID NO: 218. SEQ ID NO: 220. SEQ ID NO: 222. SEQ ID NO: 224. SEQ ID NO: 226. SEQ ID NO: 228. SEQ ID NO: 230. SEQ ID NO: 232. SEQ ID NO: 234. SEQ ID NO: 236. SEQ ID NO: 238. SEQ ID NO: 240. SEQ ID NO: 242. SEQ ID NO: 244. SEQ ID NO: 246. SEQ ID NO: 248. SEQ ID NO: 250. SEQ ID NO: 252. SEQ ID NO: 254. SEQ ID NO: 256. SEQ ID NO:258 or SEQ ID NO:260, or a pharmaceutically acceptable salt thereof.
In the present invention, the wild-type p-hydroxyphenylpyruvate dioxygenase protein may be derived from any plant, in particular from the aforementioned monocotyledonous or dicotyledonous plants. Several sources of wild-type p-hydroxyphenylpyruvate dioxygenase protein sequences, as well as coding sequences, have been disclosed in the prior art documents, which are incorporated herein by reference.
Preferably, the wild-type p-hydroxyphenylpyruvate dioxygenase protein of the invention is derived from rice, in particular rice. More preferably, said wild-type p-hydroxyphenylpyruvate dioxygenase protein has the amino acid sequence shown in SEQ ID No. 2 or an amino acid sequence which has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the amino acid sequence shown in SEQ ID No. 2.
It will also be clear to those skilled in the art that the structure of a protein may be altered without adversely affecting its activity and functionality, for example one or more conservative amino acid substitutions may be introduced in the amino acid sequence of the protein without adversely affecting the activity and/or three-dimensional configuration of the protein molecule. Examples and embodiments of conservative amino acid substitutions will be apparent to those skilled in the art. Specifically, the amino acid residue may be substituted with another amino acid residue belonging to the same group as the site to be substituted, i.e., a nonpolar amino acid residue is substituted for another nonpolar amino acid residue, a polar uncharged amino acid residue is substituted for another polar uncharged amino acid residue, a basic amino acid residue is substituted for another basic amino acid residue, and an acidic amino acid residue is substituted for another acidic amino acid residue. Conservative substitutions where one amino acid is replaced with another amino acid belonging to the same group are within the scope of the present invention, as long as the substitution does not impair the biological activity of the protein.
Thus, the mutated HPPD proteins of the invention may comprise, in addition to the above mentioned mutations, one or more further mutations, such as conservative substitutions, in the amino acid sequence. In addition, mutant HPPD proteins that also comprise one or more other non-conservative substitutions are also encompassed by the present invention, provided that the non-conservative substitutions do not significantly affect the desired function and biological activity of the proteins of the invention.
As is well known in the art, one or more amino acid residues may be deleted from the N-and/or C-terminus of a protein while still retaining its functional activity. Thus, in a further aspect, the present invention also relates to fragments lacking one or more amino acid residues from the N-and/or C-terminus of a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein, while retaining its desired functional activity, which are also within the scope of the present invention, referred to as biologically active fragments. In the present invention, a "biologically active fragment" refers to a part of a mutated HPPD protein of the invention which retains the biological activity of the mutated HPPD protein of the invention, while having an increased tolerance or resistance to HPPD inhibitors compared to a HPPD fragment not having said mutation. For example, a biologically active fragment of a mutant HPPD protein may be a portion of the protein lacking one or more (e.g., 1-50, 1-25, 1-10, or 1-5, e.g., 1,2, 3,4, or 5) amino acid residues at the N-and/or C-terminus, but which still retains the biological activity of the full-length protein.
The invention also provides a fusion protein comprising the mutant HPPD protein of the invention, or a biologically active fragment thereof, and further components fused thereto. In a preferred embodiment, the further component is a plastid targeting peptide, e.g. a peptide that targets the mutated HPPD protein to the chloroplast. In another embodiment, the additional component is a tag peptide, such as 6 × His. In yet another embodiment, the further component is a peptide, e.g. a NusA peptide, that contributes to increasing the solubility of the mutant HPPD protein.
In yet another aspect, the present invention provides an isolated polynucleotide comprising a nucleic acid sequence encoding a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein as described above, or a biologically active fragment thereof, or a complement thereof. The term "isolated" polynucleotide means that the polynucleotide contains substantially no components that normally accompany it in a naturally occurring environment. In one embodiment, the amino acid sequence of the mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein has an amino acid sequence which has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the amino acid sequence shown in SEQ ID No. 2, and further has one or more mutations selected from the group consisting of: 93S, 103S, 141R, 141K, 141T, 165V, 191I, 220K, 226H, 276W, 277N, 336D, 337A, 338D, 338S, 338Y, 342D, 346C, 346D, 346H, 346S, 346Y, 370N, 377C, 386T, 390I, 392L, 403G, 410I, 418P, 419F, 419L, 419V, 420S, 420T, 430G, and 431L. Preferably, the mutation is one or more mutations selected from the group consisting of: R93S, a103S, H141R, H141K, H141T, a165V, V191I, R220K, G226H, L276W, P277N, P336D, P337A, N338D, N338S, N338Y, G342D, R346C, R346D, R346H, R346S, R346Y, D370N, I377C, P386T, L390I, M392I, E36403, K410I, K418I, G419I, N420I, E36430 and Y431I. More preferably, the mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or biologically active fragment thereof is derived from a rice HPPD protein and has one or more amino acid substitutions selected from the group consisting of the above.
It will be apparent to those skilled in the art that due to the degeneracy of the genetic code, there are a variety of different nucleic acid sequences which can encode the amino acid sequences disclosed herein. It is within the ability of one of ordinary skill in the art to generate other nucleic acid sequences encoding the same protein, and thus the present invention encompasses nucleic acid sequences that encode the same amino acid sequence due to the degeneracy of the genetic code. For example, to achieve high expression of a heterologous gene in a target host organism, such as a plant, the gene may be optimized for better expression using codons preferred by the host organism.
Thus, in some embodiments, the polynucleotide of the invention has a nucleic acid sequence selected from the group consisting of:
(1) encoding SEQ ID NO 4, SEQ ID NO 6, SEQ ID NO 8, SEQ ID NO 10, SEQ ID NO 12, SEQ ID NO 14, SEQ ID NO 16, SEQ ID NO 18, SEQ ID NO 20, SEQ ID NO 22, SEQ ID NO 32, SEQ ID NO 34, SEQ ID NO 36, SEQ ID NO 38, SEQ ID NO 40, SEQ ID NO 42, SEQ ID NO 44, SEQ ID NO 46, SEQ ID NO 48, SEQ ID NO 50, SEQ ID NO 52, SEQ ID NO 54, SEQ ID NO 56, SEQ ID NO 58, SEQ ID NO 60, SEQ ID NO 62, SEQ ID NO 64, SEQ ID NO 66, SEQ ID NO 68, SEQ ID NO 70, SEQ ID NO 72, SEQ ID NO 74, SEQ ID NO, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 182, 184, 186, 196, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 258 or 260 amino acid sequences or the complement thereof;
(2) 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 125, 127, 129, 131, 127, 129, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195, 197, 193, 195, SEQ ID NO: 199. SEQ ID NO: 201. SEQ ID NO: 203. SEQ ID NO: 205. SEQ ID NO: 207. SEQ ID NO: 209. SEQ ID NO: 211. SEQ ID NO: 213. SEQ ID NO: 215. SEQ ID NO: 217. SEQ ID NO: 219. SEQ ID NO: 221. SEQ ID NO: 223. SEQ ID NO: 225. SEQ ID NO: 227. SEQ ID NO: 229. SEQ ID NO: 231. SEQ ID NO: 233. SEQ ID NO: 235. SEQ ID NO: 237. SEQ ID NO: 239. SEQ ID NO: 241. SEQ ID NO: 243. SEQ ID NO: 245. SEQ ID NO: 247. SEQ ID NO: 249. SEQ ID NO: 251. SEQ ID NO: 253. SEQ ID NO: 255. SEQ ID NO:257 or SEQ ID NO:259 or a complement thereof;
(3) a nucleic acid sequence which hybridizes with the sequence shown in (1) or (2) under a strict condition; and
(4) a nucleic acid sequence which encodes the same amino acid sequence as that of the sequence shown in (1) or (2) due to the degeneracy of the genetic code, or a complementary sequence thereof.
Further preferably, the polynucleotide has a sequence selected from the group consisting of SEQ ID NO 3, SEQ ID NO 5, SEQ ID NO 7, SEQ ID NO 9, SEQ ID NO 11, SEQ ID NO 13, SEQ ID NO 15, SEQ ID NO 17, SEQ ID NO 19, SEQ ID NO 21, SEQ ID NO 23, SEQ ID NO 25, SEQ ID NO 27, SEQ ID NO 29, SEQ ID NO 31, SEQ ID NO 33, SEQ ID NO 35, SEQ ID NO 37, SEQ ID NO 39, SEQ ID NO 41, SEQ ID NO 43, SEQ ID NO 45, SEQ ID NO 47, SEQ ID NO 49, SEQ ID NO 51, SEQ ID NO 53, SEQ ID NO 55, SEQ ID NO 57, SEQ ID NO 59, SEQ ID NO 61, SEQ ID NO 19, SEQ ID NO 59, SEQ ID NO 61, SEQ ID NO, SEQ ID NO 63, SEQ ID NO 65, SEQ ID NO 67, SEQ ID NO 69, SEQ ID NO 71, SEQ ID NO 73, SEQ ID NO 75, SEQ ID NO 77, SEQ ID NO 79, SEQ ID NO 81, SEQ ID NO 83, SEQ ID NO 85, SEQ ID NO 87, SEQ ID NO 89, SEQ ID NO 91, SEQ ID NO 93, SEQ ID NO 95, SEQ ID NO 97, SEQ ID NO 99, SEQ ID NO 101, SEQ ID NO 103, SEQ ID NO 105, SEQ ID NO 107, SEQ ID NO 109, SEQ ID NO 111, SEQ ID NO 113, SEQ ID NO 115, SEQ ID NO 117, SEQ ID NO 119, SEQ ID NO 121, SEQ ID NO 123, SEQ ID NO 125, SEQ ID NO 127, SEQ ID NO 123, SEQ ID NO 125, SEQ ID NO, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 183, 185, 183, 173, 183, 173, 175, 185, 179, 181, 183, 185, 187, 189, 193, 195, 197, 199, 201, 203, 205, 207, 209, 211, 213, 215, 217, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 233, 237, 239, 241, 251, 253, 259, 257, 241, 251, 243, 245, 247, 249, 251, 253, 255, 259, 257 or 259, A nucleic acid sequence which is degenerate as such or a sequence complementary thereto.
Preferably, the stringent conditions may refer to 6M urea, 0.4% SDS, 0.5 XSSC or their equivalent hybridization conditions, or may refer to more stringent conditions, such as 6M urea, 0.4% SDS, 0.1 XSSC or their equivalent hybridization conditions. In various conditions, the temperature may be above about 40℃, for example, where higher stringency conditions are desired, the temperature may be about 50℃, and further about 65℃.
Still more preferably, the amino acid mutation sites correspond to the following wild-type and mutant codons:
the present invention also provides a nucleic acid construct comprising a nucleic acid sequence encoding a mutant p-hydroxyphenylpyruvate dioxygenase protein of the invention, or a biologically active fragment or fusion protein thereof, operably linked to one or more regulatory elements. The term "regulatory element" as used herein refers to a nucleic acid sequence capable of regulating the transcription and/or translation of a nucleic acid to which it is operably linked.
The regulatory element may be an appropriate promoter sequence recognized by a host cell for expression of a nucleic acid sequence encoding a protein of the invention. The promoter sequence contains transcriptional regulatory sequences that mediate the expression of the protein. The promoter may be any nucleotide sequence which shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell. As the promoter to be expressed in plant cells or plants, a promoter native to p-hydroxyphenylpyruvate dioxygenase or a heterologous promoter active in plants may be used. The promoter may be constitutively expressed or may be inducible. Examples of the promoter include, for example, a histone promoter, a rice actin promoter, a plant virus promoter such as a cauliflower mosaic virus promoter, and the like.
The regulatory element may also be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3' terminus of the nucleic acid sequence encoding the protein of the present invention. Any terminator which is functional in the host cell of choice may be used in the present invention.
The regulatory element may also be a suitable leader sequence, a nontranslated region of an mRNA which is important for translation by the host cell. The leader sequence is operably linked to the 5' terminus of the nucleic acid sequence encoding the protein of the invention. Any leader sequence which is functional in the host cell of choice may be used in the present invention.
The regulatory element may also be a polyadenylation sequence, a sequence operably linked to the 3' terminus of the nucleic acid sequence and which, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence which is functional in the host cell of choice may be used in the present invention.
The regulatory element may also be a signal peptide coding region that encodes an amino acid sequence linked to the amino terminus of the protein and directs the encoded protein into the cell's secretory pathway. The 5' end of the coding sequence of the nucleic acid sequence may inherently contain a signal peptide coding region naturally linked in translation reading frame with the portion of the coding region which encodes the secreted polypeptide. Alternatively, the 5' end of the coding sequence may contain a signal peptide coding region which is foreign to the coding sequence. A foreign signal peptide coding region may be required where the coding sequence does not naturally contain a signal peptide coding region. Alternatively, the foreign signal peptide coding region may simply replace the natural signal peptide coding region in order to facilitate secretion of the polypeptide. In any event, any signal peptide coding region that directs the expressed polypeptide into the secretory pathway of a host cell of choice, i.e., into the culture medium, may be used in the present invention.
Regulatory sequences which allow the regulation of the expression of the polypeptide relative to the growth of the host cell may also be added as appropriate. Regulatory systems are, for example, those which allow gene expression to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound, such as the lac, tec, and tip operator systems, the ADH2 system or the GAL1 system, among others. Other examples of regulatory sequences are those which allow gene amplification. In eukaryotic systems, these include the dihydrofolate reductase gene, which is amplified in the presence of methotrexate, and the metallothionein genes, which are amplified with heavy metals. In these cases, the nucleotide sequence encoding the polypeptide will be operably linked to the control sequences.
In the present invention, the regulatory element may also be a transcriptional activator or enhancer, such as a tobacco mosaic virus translational activator as described in WO87/07644, or an intron or the like, such as the maize adh1 intron, the maize bronze 1gene (maize bronze 1gene) intron, or the rice actin intron 1. They may enhance the expression of the mutant HPPD proteins, biologically active fragments thereof or fusion proteins of the invention in transgenic plants.
The invention also provides an expression vector, which comprises a nucleic acid sequence for encoding the mutant p-hydroxyphenyl pyruvate dioxygenase protein or a biologically active fragment or fusion protein thereof and an expression control element operably connected with the nucleic acid sequence. The expression vector also contains at least one origin of replication for self-replication. The choice of vector will generally depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector may be an autonomously replicating vector, i.e., a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may contain any element which ensures self-replication. Alternatively, the vector may be one which, when introduced into a host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated. Furthermore, a single vector or plasmid or two or more vectors or plasmids which together contain the total DNA to be introduced into the genome of the host cell, or a transposon may be used. Alternatively, the vector may be a vector for gene editing of an HPPD gene endogenous to the host cell.
Vectors may be of the type, for example, plasmids, viruses, cosmids, phages and the like, which are well known to those skilled in the art and are described extensively in the art. Preferably, the expression vector in the present invention is a plasmid. Expression vectors can include promoters, ribosome binding sites for translation initiation, polyadenylation sites, transcription terminators, enhancers, and the like. The expression vector may also contain one or more selectable marker genes for use in selecting host cells containing the vector. Such selectable markers include the gene encoding dihydrofolate reductase, or the gene conferring neomycin tolerance, the gene conferring resistance to tetracycline or ampicillin, and the like.
The vectors of the present invention may contain elements that allow the vector to integrate into the host cell genome or to replicate autonomously within the cell independent of the genome. For integration into the genome of a host cell, the vector may rely on the polynucleotide sequence encoding the polypeptide or any other element of the vector suitable for integration into the genome by homologous or nonhomologous recombination. Alternatively, the vector may comprise additional nucleotide sequences for directing integration by homologous recombination into the genome of the host cell at the exact location in the chromosome. To increase the likelihood of integration at a precise location, the integrational elements should preferably include a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, preferably 400 to 10,000 base pairs, more preferably 800 to 10,000 base pairs, which have a high degree of identity with the corresponding target sequence to increase the probability of homologous recombination. The integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell. Furthermore, the integrational elements may be non-encoding or encoding nucleotide sequences. On the other hand, the vector may integrate into the genome of the host cell by non-homologous recombination. For autonomous replication, the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question. The origin of replication may be any plasmid replicon mediating autonomous replication that functions within the cell. The term "origin of replication" or "plasmid replicon" is defined herein as a nucleotide sequence that enables a plasmid or vector to replicate in vivo.
More than one copy of a polynucleotide of the invention may be inserted into a host cell to increase the yield of the gene product. An increase in the number of copies of a polynucleotide can be achieved by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the polynucleotide, in which case cells containing amplified copies of the selectable marker gene, and thus additional copies of the polynucleotide, can be selected for by artificially culturing the cells in the presence of the appropriate selectable agent.
The nucleic acid sequences of the invention may be inserted into the vector by a variety of methods, for example by ligation following digestion of the insert and vector with appropriate restriction endonucleases. A variety of cloning techniques are known in the art and are within the knowledge of those skilled in the art.
Vectors suitable for use in the present invention include commercially available plasmids such as, but not limited to: pBR322(ATCC 37017), pKK223-3(Pharmacia Fine Chemicals, Uppsala, Sweden), GEM1(Promega Biotec, Madison, Wis., USA) pQE70, pQE60, pQE-9(Qiagen), pD10, psiX174 pBluescript II KS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene), ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5(Pharmacia), pKK232-8, pCM7, pSV2CAT, pOG44, pOG 1, pSG (VK 3), (pBPV, pMSG, and Strvl Pharmacia) and the like.
The invention also provides host cells comprising a nucleic acid sequence, nucleic acid construct or expression vector of the invention. The vector comprising the vector encoding the present invention is introduced into a host cell such that the vector is present as part of a chromosomal integrant or as a self-replicating extra-chromosomal vector as described earlier, or the vector may be capable of gene editing an HPPD gene endogenous to the host cell. The host cell may be any host cell familiar to the person skilled in the art, including prokaryotic cells and eukaryotic food cells, such as bacterial cells, fungal cells, yeast cells, mammalian cells, insect cells or plant cells, examples of which are Escherichia coli (E.coli), Streptomyces (Streptomyces), Bacillus subtilis (Bacillus subtilis), Salmonella typhimurium (Salmonella typhimurium), Pseudomonas (Pseudomonas), Streptomyces (Streptomyces), Staphylococcus (Staphylococcus), Spodoptera Sf9, CHO, COS, etc. The choice of an appropriate host cell is within the ability of those skilled in the art.
In the present invention, the term "host cell" also encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication.
The nucleic acid sequences, nucleic acid constructs or expression vectors of the invention can be introduced into a host cell by a variety of techniques, including transformation, transfection, transduction, viral infection, gene gun or Ti-plasmid mediated gene delivery, as well as calcium phosphate transfection, DEAE-dextran mediated transfection, lipofection or electroporation, and the like (see Davis, L., Dibner, M., Battey, I., Basic Methods in Molecular Biology, 1986).
In a particular embodiment, the mutated HPPD proteins of the invention may be targeted to plastids, e.g. chloroplasts, within plants. This can be achieved by linking in frame a nucleic acid sequence encoding a mutant HPPD protein of the invention to a nucleic acid sequence encoding a plastid leader peptide, e.g., a chloroplast transit peptide. Alternatively, the polynucleotide, nucleic acid construct or expression vector of the invention can be directly transformed into the chloroplast genome of a plant cell. Vectors and methods useful for transforming the chloroplast genome of a plant cell will be apparent to those skilled in the art. For example, the nucleic acid sequence encoding the mutant HPPD protein of the invention may be integrated by bombarding leaves of the target plant with DNA-coated ions and by homologous or non-homologous recombination.
The transformed host cells may be cultured in conventional nutrient media, where appropriate. After transformation of a suitable host cell and cultivation of the host cell to a suitable cell density, the selected promoter may be induced by suitable means, such as temperature change or chemical induction, and the cell may be further cultivated for a period of time such that it produces the mutated HPPD protein of the invention or a biologically active fragment or fusion protein thereof.
Accordingly, the present invention also relates to a method for producing a mutated HPPD protein of the invention, or a biologically active fragment or fusion protein thereof, comprising: (a) culturing the above host cell under conditions conducive to the production of the mutated HPPD protein or biologically active fragment or fusion protein thereof; and (b) recovering the mutated HPPD protein or biologically active fragment or fusion protein thereof.
In the production methods of the invention, the cells are cultured on a nutrient medium suitable for production of the polypeptide using methods well known in the art. For example, the cells are cultured in laboratory or industrial fermentors by shake flask culture and small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in a suitable medium and under conditions allowing the polypeptide to be expressed and/or isolated. The cultivation is carried out on a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts using procedures known in the art. Suitable media are available from commercial suppliers or may be formulated according to published compositions (e.g., on catalogues of the American Type Culture Collection). If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted into the culture medium, it can be recovered from the cell lysate.
The polypeptide may be detected by methods known in the art that are specific for the polypeptide. These detection methods may include the use of specific antibodies, the formation of an enzyme product, or the disappearance of an enzyme substrate.
The resulting polypeptide can be recovered by methods known in the art. For example, cells can be harvested by centrifugation, physically or chemically disrupted, and the resulting crude extract retained for further purification. Transformed host cells expressing a mutated HPPD protein or biologically active fragment or fusion protein thereof of the invention may be lysed by any convenient method, including freeze-thaw cycles, sonication, mechanical disruption, or use of a lytic agent. These methods are well known to those skilled in the art. The mutant HPPD proteins or biologically active fragments thereof of the present invention can be recovered and purified from cultures of transformed host cells by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography, and phytohemagglutinin chromatography, among others.
The present invention also relates to a method for producing a host organism, in particular a plant cell, plant tissue, plant part or plant, which is tolerant or resistant to HPPD-inhibiting herbicides, comprising transforming said host organism with a nucleic acid sequence encoding a mutant p-hydroxyphenylpyruvate dioxygenase protein of the invention or a biologically active fragment thereof, a nucleic acid construct or an expression vector comprising said nucleic acid sequence. Methods for transformation of host cells, such as plant cells, are known in the art and include, for example, protoplast transformation, fusion, injection, electroporation, PEG-mediated transformation, ion bombardment, viral transformation, Agrobacterium-mediated transformation, electroporation or bombardment, and the like. A series of such transformation methods are described in the prior art, for example in EP1186666 for soybean transformation, in WO 92/09696 for monocotyledonous plants, in particular rice transformation, and the like. It may also be advantageous to culture plant explants with Agrobacterium tumefaciens or Agrobacterium rhizogenes to transfer DNA into plant cells. Whole plants can then be regenerated from infected plant material parts (such as leaf fragments, stem segments, roots and protoplasts or suspension-cultured cells) in a suitable medium, which may contain antibiotics or pesticides for selection. Transformed cells grow in the usual way in plants, they can form germ cells and transmit the transformed trait to progeny plants. Such plants can be grown in the normal manner and crossed with plants having the same transforming genetic element or other genetic elements. The resulting heterozygous individuals have the corresponding phenotypic characteristics.
The present invention also provides a method for producing a host organism, in particular a plant cell, plant tissue, plant part or plant, which is tolerant or resistant to an HPPD-inhibiting herbicide, comprising integrating into the genome of the host organism and expressing a nucleic acid encoding a mutant p-hydroxyphenylpyruvate dioxygenase protein, or a biologically active fragment thereof, according to the invention. Suitable vectors and selectable markers are well known to those skilled in the art, and one method of integration into the tobacco genome is described, for example, in WO06/108830, the disclosure of which is incorporated herein by reference. The gene of interest is preferably expressed in the plant cell by a constitutive or inducible promoter. Once expressed, mRNA is translated into protein, thereby incorporating the amino acid of interest into the protein. The gene encoding the protein expressed in the plant cell may be under the control of a constitutive promoter, a tissue specific promoter or an inducible promoter. For example, promoters of bacterial origin such as octopine synthase promoter, nopaline synthase promoter, mannopine synthase promoter; promoters derived from viruses such as cauliflower mosaic virus (35S and 19S), 35T (re-engineered 35S promoter, see U.S. Pat. No.6,166,302, especially example 7E), and the like. Plant promoter regulatory elements may also be used, including but not limited to the small subunit of the ribose-1, 6-diphosphate (RUBP) carboxylase (ssu), the β -conglycinin promoter, the β -phaseolin promoter, the ADH promoter, the heat shock promoter, and tissue-specific promoters. Constitutive promoter regulatory elements can also be used to direct sustained gene expression in all cell types and at all times (e.g., actin, ubiquitin, CaMV35S, etc.). Tissue-specific promoter regulatory elements are also useful in the present invention, which are responsible for gene expression (e.g., zein, oleosin, napin, ACP, globulin, etc.) in a particular cell or tissue type (e.g., leaf or seed). Similarly, promoter regulatory elements that are active (or inactive) at some stage of plant development may also be used. Examples of such promoter regulatory elements include, but are not limited to, pollen-specific, embryo-specific, corn ear silk-specific, cotton fiber-specific, root-specific, seed endosperm-specific, or asexual phase-specific promoter regulatory elements, and the like. In some cases it may be desirable to use inducible promoter regulatory elements which are responsible for gene expression in response to specific signals such as physical stimuli (heat shock genes), light (RUBP carboxylase), hormones (Em), metabolites, chemicals (tetracycline response) and stress. Other desirable transcription and translation elements that function in plants may be used.
The present invention also provides a method for increasing the tolerance or resistance of a plant cell, plant tissue, plant part or plant to an HPPD-inhibiting herbicide, which comprises transforming said plant or part thereof with a nucleic acid molecule comprising a nucleic acid sequence encoding a mutant p-hydroxyphenylpyruvate dioxygenase protein, or a biologically active fragment or fusion protein thereof, of the invention and allowing expression thereof. The nucleic acid molecule may be expressed as an extrachromosomal entity or may be integrated into the genome of the plant cell for expression, in particular by homologous recombination at the location of an endogenous gene in the plant cell. These embodiments are within the scope of the present invention.
The present invention also provides a method of increasing HPPD-inhibiting herbicide tolerance or resistance in a plant or part thereof, comprising crossing a plant expressing a mutant hydroxyphenylpyruvate dioxygenase (HPPD) protein, or a biologically active fragment or fusion protein thereof, according to the invention, with another plant, and screening for plants or parts thereof having increased HPPD-inhibiting herbicide tolerance or resistance.
The present invention also provides a method of increasing HPPD-inhibiting herbicide tolerance or resistance in a plant cell, plant tissue, plant part or plant comprising genetically editing an endogenous HPPD protein of said plant cell, plant tissue, plant part or plant to effect expression therein of a mutant p-hydroxyphenylpyruvate dioxygenase protein, or a biologically active fragment or fusion protein thereof, of the present invention.
The present invention also relates to a method for producing a plant with increased herbicide tolerance or resistance by conventional breeding techniques, which comprises selfing or crossing a plant with a nucleic acid sequence encoding a mutant p-hydroxyphenylpyruvate dioxygenase protein according to the invention or a biologically active fragment thereof integrated in its genome and selecting progeny which comprise said encoding nucleic acid sequence heterozygously or homozygously.
The invention further relates to plant cells, plant tissues, plant parts and plants, and progeny thereof, obtained by the above method.
Preferably, plant cells, plant tissues or plant parts transformed with a polynucleotide of the present invention can be regenerated into whole plants. The invention includes cell cultures, including tissue cell cultures, liquid cultures, and solid plate cultures. Seeds produced by and/or used to regenerate the plants of the invention are also included within the scope of the invention. Other plant tissues and parts are also encompassed by the present invention. The invention likewise includes methods for producing plants or cells which contain the nucleic acid molecules according to the invention. One preferred method of producing such plants is by planting the seeds of the invention. Plants transformed in this way can acquire resistance to a variety of herbicides with different modes of action.
For example, for transforming a plant cell with Agrobacterium, the explant can be mixed with the transformed Agrobacterium and incubated for a sufficient time to allow transformation thereof. After transformation, the Agrobacterium is killed by selection with the appropriate antibiotic and the plant cells are cultured in the appropriate selection medium. Once callus is formed, shoot formation can be promoted by the use of appropriate plant hormones according to methods well known in the art of plant tissue culture and plant regeneration. However, the callus intermediate stage is not always necessary. After bud formation, the plant cells may be transferred to a medium that promotes root formation, thereby completing plant regeneration. The plant may then be grown to produce seeds that may be used to establish future generations. Regardless of the transformation technique, it is preferred that the gene encoding the bacterial protein be incorporated into a gene transfer vector adapted for expression of the gene in a plant cell by incorporating into the vector plant promoter regulatory elements and a 3' untranslated transcription termination region (e.g., Nos, etc.).
The present invention also provides a method of controlling weeds at a plant locus comprising applying to the locus containing plants or seeds of the invention a weed controlling effective amount of one or more HPPD inhibiting herbicides.
In the present invention, the term "locus" includes a field for cultivating the plant of the present invention such as soil, and also includes, for example, plant seeds, plant seedlings and grown plants. The term "weed-controlling effective amount" refers to an amount of herbicide sufficient to affect the growth or development of a target weed, e.g., to arrest or inhibit the growth or development of a target weed, or to kill the weed. Advantageously, the weed controlling effective amount does not significantly affect the growth and/or development of the plant seeds, plant seedlings or plants of the present invention. Such an effective weed-controlling amount can be determined by one skilled in the art by routine experimentation.
The present invention also provides a method for producing a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein which retains or potentiates the property of catalyzing the conversion of p-Hydroxyphenylpyruvate (HPP) to homogentisate and which is significantly less sensitive to HPPD-inhibiting herbicides than the wild-type HPPD, which comprises mutating a nucleic acid encoding a wild-type HPPD, fusing and ligating the mutated nucleic acid in an expression vector in frame with a nucleic acid sequence encoding a solubility-enhancing component to form a fusion protein coding sequence, transforming the resulting recombinant expression vector into a host cell, expressing the fusion protein under suitable conditions comprising the HPPD-inhibiting herbicide and an HPPD enzymatic substrate and screening for a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein which retains or potentiates the property of catalyzing the conversion of p-Hydroxyphenylpyruvate (HPP) to homogentisate and which has a significantly reduced sensitivity to HPPD-inhibiting herbicides. Preferably, the solubility-enhancing component is NusA, which constitutes a fusion protein with the mutated HPPD protein of the invention. More preferably, the expression vector is a pET-44a vector. The host cell may be a bacterial cell, a fungal cell or a plant cell.
As used herein, the terms "a", "an" and "the" mean "at least one" unless specifically stated or implied. All patents, patent applications, and publications mentioned or cited herein are incorporated by reference in their entirety to the same extent as if individually incorporated.
Detailed Description
The present invention is further illustrated by the following examples. All methods and operations described in these embodiments are provided by way of example and should not be construed as limiting. For methods of DNA manipulation reference may be made to Current Protocols in Molecular Biology, volumes 1 and 2, Ausubel F.M., Greene Publishing Associates and Wiley Interscience,1989, Molecular Cloning, T.Maniatis et al, 1982, or Sambrook J.and Russell D.2001, Molecular Cloning: a laboratory Manual, version 3.
Examples
Example 1 cloning of Rice HPPD (OsHPPD) Gene
The rice (Oryza sativa Japonica Group) p-hydroxyphenyl pyruvate dioxygenase (4-hydroxyphenylpyruvate dioxygenase, HPPD) gene is located at the second chromosome Os02g0168100 site. The DNA (OsHPPD) of the coding region (Universal organism, China, Anhui, Chuzhou) is directly synthesized according to the cDNA sequence (NCBI number XP _015626163.1) as a PCR template. Primers NusOsF: acg att gat gac gac gac aag ATGCCTCCCACTCCCACCCC and NusOsR: tccacgagctcccggactcTTA CTAGGATCCTTGAA CTGTAG were designed and synthesized based on the sequences of vectors pET-44a (Novagen) and XP-015626163.1. PCR amplification was performed with these primers, synthesized template and Q5 DNA polymerase (NEB, New England Biolabs, Boston, USA). The amplification conditions were: 2 minutes at 98 ℃; repeating the steps for 35 times at 98 deg.C for 20 seconds, 65 deg.C for 30 seconds and 72 deg.C for 60 seconds; finally, 2 minutes at 72 ℃. The amplified fragment showed 1.3Kb on agarose gel electrophoresis, and its DNA concentration was determined by uv absorption after recovery.
pET-44a (Novagen) plasmid was digested with BoxI (Thermo Fisher Scientific, China, Shanghai) at 37 ℃ for 1 hour, and heated to 65 ℃ to inactivate BoxI. Mixing an equal amount of OsHPPD DNA fragment with a boxI linearized pET-44a vector, adding an equal amount of 2 XGibson Assembly Master Mix (Henan biosome, China, Shanghai), uniformly mixing, incubating at 50 ℃ for one hour, taking 5ul of a ligation product to transform E.coli DH5a competence, coating a bacterial solution on the surface of an LB solid culture medium plate containing 100ppm ampicillin, and culturing at 37 ℃ overnight. The next day, after single colony PCR confirmed correct clones, three correct clones were cultured overnight at 37 ℃ and enough plasmid DNA was extracted and sent to the Scophthal technologies Inc. (Beijing, China) for sequencing by sanger method. The sequencing result proves that the correct full-length rice HPPD coding region DNA is obtained.
Example 2 saturation random mutagenesis of Each amino acid in Rice HPPD (OsHPPD) protein
The rice full-length OsHPPD enzyme has 446 amino acids, and the amino acid sequence is shown in SEQ ID NO. 2. Where amino acids 1-50 are thought to constitute the signal peptide responsible for directing into the chloroplast (Siehl et al plant physiol.2014Nov; 166(3): 1162-. Therefore, saturation random mutation was made for each amino acid from the 51 st amino acid to the 446 th amino acid. This is achieved by bridge PCR using a primer containing the NNK instead of the amino acid coding for the desired mutation and another appropriate conventional primer. In NNK, N stands for A/T/G/C, K stands for G/T, so the NNK codon can code for 20 amino acids and terminator in any one, so this is a saturation mutation. Reference is made to Kille S, Acevedo-Rocha CG, Parra LP, Zhang ZG, Opperman DJ, Reetz MT, Acevedo JP (2013) reduction code reduction and coding effort of combinatorial protein biology. SynACS culture Biol 2(2): 83-92; direct Evolution Library Creation, methods and protocols 2nd edited by Elizabeth M.J.Gillam, Janine N.Copp and David F.Ackerley New York, NY United States, Springer,2014 Doi: 10.1007/978-1-4939-. This will result in a large number of mutants. The mutants were cloned into linearized pET-44a vectors, transformed into E.coli, expressed in 96-well plates in 2 XYT medium with HPPD inhibitor herbicide (e.g.tembotrione, 1-2. mu.M) and substrate tyrosine (1 g/l) on a shaker at 28 ℃ for 24 hours at 150 rpm, and rapidly screened for browning. We screened 10 single amino acid mutants in this way, which were A103S, H141R, H141K, H141T, A165V, V191I, R220K, G342D, D370N and K410I. The color response of these resistant mutants to the post-metabolism products of tembotrione and topramezone relative to the wild type is shown in figure 1, where the color changes of H141R and G342D are most significant and significantly darker than the wild type.
The method improves the solubility of HPPD expressed in bacteria by fusing NusA and rice HPPD protein, thereby simultaneously expressing the protein and carrying out enzymatic reaction at 28 ℃, and greatly saving the screening time and steps.
Likewise, the color response of these mutants to the other three HPPD inhibitor herbicides, ciclopirox, topramezone and mesotrione, was tested, see fig. 2 and 3. The resistance/tolerance of each mutant to these 5 herbicides was roughly estimated according to its shade and the results are shown in table 1. The more plus "+" the darker the colour relative to the wild type, the higher the resistance/tolerance.
TABLE 1 Rice HPPD Single-site mutants and their relative resistance to 5 HPPD inhibitor herbicides
The generation and screening of the H141R mutant are exemplified below to illustrate the overall process.
1. NusOsF and OsHPPD-H141R-R: CACCGCGAGGCCGTGGTCC as primers, the full-length OsHPPD template synthesized and Q5 DNA polymerase (NEB, New England Biolabs, Boston, USA) were PCR amplified to obtain the previous fragment DNA. The amplification conditions were: 98 ℃/2 min; 98 ℃/20 sec → 65 ℃/30 sec → 72 ℃/60 sec (35 repetitions); 72 deg.C/2 sec. After detection by agarose gel electrophoresis, the band of the correct size was recovered. And the concentration was determined by uv absorption. Similarly, the expression of NusOsR and OsHPPD-H141R-F: CACGGCCTCGCGGTGNNKGCCGTGGCGC TGCGCG as primers, the synthesized full-length OsHPPD template and Q5 DNA polymerase (NEB, New England Biolabs, Boston, USA) were subjected to PCR amplification to obtain the latter DNA fragment.
2. The former fragment and the latter fragment overlap by 19 bases in the middle (OsHPPD-H141R-F and OsHPPD-H141R-R). Therefore, these two fragments were mixed in equimolar amounts, and an equal volume of 2 XGlodstar MasterMix (Kang, century Biotechnology Co., Ltd., Beijing) was added, followed by addition of 10pmol of NusOsF and NusOsR primers, to carry out a bridge-up PCR reaction. The amplification conditions were: 2 minutes at 96 ℃; repeating the steps for 30 times at 96 ℃ for 20 seconds, 65 ℃ for 30 seconds and 72 ℃ for 60 seconds; finally 5min at 72 ℃. After detection by agarose gel electrophoresis, the band of the correct size of 1.3Kb was recovered and the concentration was determined by uv absorption.
3. An equal amount of OsHPPDMUT DNA fragment was mixed with the linearized pET-44a vector, an equal amount of 2 XGibson Assembly Master Mix (Henan biosciences) was added, and after incubation at 50 ℃ for one hour, 5ul of the ligation product was taken to transform E.coli DH5a competence, and the bacterial solution was spread on the surface of LB solid medium plate containing 100ppm ampicillin and cultured overnight at 37 ℃. All clones (colonies) on the plate were scraped off, plasmids were extracted and DNA was quantified by UV absorption, 100ng of plasmid was transformed into BL21(DE3) competence, plates were spread, incubated overnight at 37 ℃ and the transformed E.coli plates were temporarily stored for mutant screening at 4 ℃.
4. Screening for HPPD inhibitor herbicide-resistant mutants by color reaction
HPPD-inhibiting herbicides inhibit HPPD enzyme activity, and when tyrosine forms 4-Hydroxyphenylpyruvate (HPP) under the action of tyrosine aminotransferase, the inactivated HPPD fails to oxidize 4-hydroxyphenylpyruvate to Homogentisate (HGA). Homogentisic acid is dark brown. Therefore, if an HPPD mutant is resistant or tolerant to herbicides, the mutant can oxidize 4-hydroxyphenylpyruvate into homogentisate and show dark brown after being expressed in Escherichia coli. Therefore, we cultured E.coli in 2 XYT medium with HPPD inhibitor herbicide and substrate tyrosine using 96-well plates to express HPPD, and rapidly screened these mutants for color change.
(1) 2 XYT medium (1 g/L L-Tyr, 0.1mM IPTG, 0.01mM MnCl was added)2And ampicillin 100 mg/L).
(2) 0.1mL of the above-mentioned medium was added to each well of a 96-well plate, and from the E.coli plate obtained by the above-mentioned transformation, an OsHPPD wild-type or mutant (OsHPPD Mut) expression clone was picked up and subjected to liquid culture in a 96-well plate. Depending on the drug to be screened, HPPD inhibitors are added at a final concentration of 1uM to 20uM, for example: the final concentration of the tembotrione is 1.7uM, the final concentration of the mesotrione is 10uM and the like. When all the components were added, a strong gas-permeable cover sheet was applied (Soulepan Biotech, China, Beijing).
(3) The 96-well plate was incubated on a shaker at 28 ℃ and 150 rpm for 24 hours. The melanin-producing colonies were picked with an inoculating loop by visual inspection or by examining the culture for light absorbance at 400nM, further cultured, and their plasmid DNA extracted for sequencing and further studies such as osppd protein expression, purification and enzyme activity assays.
In the same way, we obtained A103S, A165V, V191I, R220K, D370N and K410I single-site mutants and H141R/G342D/D370N three-site mutants respectively by using the primers described in Table 2.
TABLE 2 primers for the preparation of HPPD mutants
Primer name
Primer sequence (5'-3')
NusOsF
acg att gat gac gac gac aag ATGCCTCCCACTCCCACCCC
NusOsR
tccacgagctcccggactcTTA CTAGGATCCTTGAACTGTAG
OsHPPD-H141R-F
CACGGCCTCGCGGTGNNKGCCGTGGCGCTGCGCG
OsHPPD-H141R-R
CACCGCGAGGCCGTGGTCC
OsHPPD-A103S-F
GCGTTCCTCTTCACCNNKCCCTACGGCGGCGACCACG
OsHPPD-A103S-R
GGTGAAGAGGAACGCGACGGAGGC
OsHPPD-A165V-F
TCGCGGCCGGTGCGCGCCCGNNKTTCCAGCCCG
OsHPPD-A165V-R
CGGGCGCGCACCGGCCGCGAC
OsHPPD-V191I-F
GTCGTGCTCCGCTTCNNKAGCCACCCGG
OsHPPD-V191I-R
GAAGCGGAGCACGACGTCGCC
OsHPPD-R220K-F
CGCCGTGGACTACGGCCTCCGCNNKTTCGACCACG
OsHPPD-R220K-R
GCGGAGGCCGTAGTCCACGGCGC
OsHPPD-D370N-F
CTCGTGGACAGGGATNNKCAGGGGGTGTTGCTCCAGATCT
OsHPPD-D370N-R
ATCCCTGTCCACGAGCACCCC
OsHPPD-K410I-F
TGGGCAGGAGTACCAGNNKGGCGGCTGCGGCG
OsHPPD-K410I-R
CTGGTACTCCTGCCCACTCTCATCC
OsHPPD-H141R/G342D/D370N-F
GGCCTCAACTCGGTGGTGCTCG
OsHPPD-H141R/G342D/D370N-R
GCGAGCACCACCGAGTTGAGGC
In addition, some double mutants composed of single mutations, such as H141R/G342D, H141R/D370N and G342D/D370N, were prepared by bridge PCR-like method.
Example 3 combination of Multi-site mutations in Rice HPPD (OsHPPD) proteins
The color reactions of H141R, G342D, D370N and the mutant HPPD proteins at the compound sites thereof to five HPPD inhibitory herbicides of tembotrione, a product after metabolism of topramezone, bicyclopyrone, topramezone and mesotrione are also tested on 96-well plates at different times. The test results are shown in fig. 4,5 and 6. The resistance/tolerance of these mutants to the corresponding herbicides, estimated according to their shade of color, is shown in table 3. As can be seen from table 3, the two-site mutants as well as the three-site mutants also exhibited higher resistance, and it can be seen that amino acid mutations in the rice HPPD (oshppd) protein can be present in combination, which also achieve higher HPPD inhibiting herbicide resistance/tolerance.
TABLE 3 resistance of Single-and Multi-site mutant Rice HPPD to 5 herbicides
Example 4 saturation mutagenesis was performed again on the basis of the 3-point mutation H141R-G342D-D370N.
1. In the color reaction of Escherichia coli expressing 3-point mutation OsHPPD H141R-G342D-D370N, when the diafentrazone metabolite (code number 101) is used for inhibition, 120uM concentration is needed for no obvious color reaction. Therefore, we used 120uM of 101 for the initial screening. Using the above-described scheme, a pair of primers was designed for each of amino acids 51 to 446 (excluding the 141R, 342D, 370N sites), one of which was designated NNK at the amino acid site to be saturation-mutated, and PCR was performed to generate a series of mutants, which were expressed in E.coli BL21(DE3), and after expression, they were repeatedly screened with 120uM of Compound 101. After finishing screening all single point mutations, 18 new mutation sites are obtained. These new sites are R93S, G226H, L276W, P277N, P336D, P337A, N338D, N338S, N338Y, R346C, R346D, R346H, R346S, R346Y, I377C, P386T, L390I, M392L, E403G, K418P, G419F, G419L, G419V, N420S, N420T, E430G, Y431L. The amino acid changes and nucleotides (bases) of these new mutations and the primers used to generate these new mutations are listed in table 4 and the primer sequences are listed in table 5. In summary, as shown in fig. 7, a total of 26 mutation points are obtained by screening, wherein some sites can be changed from the original amino acid to a plurality of different amino acids, such as H141R, K, T; N338D, S, Y; R346C, D, H, S, Y; G419F, L, V and N420S, T.
TABLE 4 amino acid, base change and primers used for all newly selected mutation sites
TABLE 5 positions of all newly selected mutation sites and primer sequences used
Example 5 combination of mutation sites
Combining the mutation sites based on the following three principles: the similar loci facilitate homologous replacement during gene editing, and the editing efficiency is high; base changes are all A → G/T → C or C → T/G → A to facilitate single base editing; and resistance sites as few as possible to facilitate editing and avoid possible negative effects. The combination, the corresponding primer and the prokaryotic expression vector are respectively designed and constructed according to the principle, and then color reaction screening is carried out to find out the combination which is suitable for editing and has high resistance to implement gene editing.
(1) 33 combinations are designed according to the close distance principle, wherein 24 combinations have 3 mutation sites, and 9 combinations have 4 mutation sites. Table 6 shows these combinations and the primer sequences used.
TABLE 6 mutant site combinations designed according to similar principles (three and four mutant sites)
As shown in FIG. 8, after cloning, expression and color reaction comparison, various combinations of the similar mutation sites are found, wherein the three combinations of N338D/G342D/R346C, N338D/G342D/R346H and N338S/G342D/R346C have the highest resistance and have obvious color reaction in the presence of up to 1000 and 1500uM of the diazoledrone metabolite 101; secondly, two combinations of four mutation sites close to each other, P336D/N338D/G342D/R346C and P336D/N338D/G342D/R346H. (2) According to the principle of being beneficial to single base editing, 6 combinations are designed: H141R/N338D/N420S, H141R/N338S/N420S, H141R/N338D and H141R/N420S, G342D/R346C and G342D/R346H, both C → T/G → A. The primers and sequences that produced these combinations are listed in table 7.
TABLE 7 mutant site combinations designed to facilitate the single base editing principle
Tests show that the color reactions of the 6 combinations are stronger, and the Escherichia coli culture solution with the herbicide 101 concentration of 600-1000uM can also distinguish the color reactions.
(3) Other combinations are shown in table 8.
TABLE 8 combination of two, three, four, etc. mutation sites
Tests show that the color reaction which can be distinguished by naked eyes by the combination of the two points is weaker and is within 101 of 100 uM; among the combinations of three points, four points and more, H141R/G342D/N338D/R346C, H141R/G342D/N338D/R346H, H141R/G342D/N338D/K418P, H141R/G342D/N338D/G419F and H141R/G342D/N338D/G419F/N420S have strong color reaction, even with a 101 concentration of 1000-2000uM (as shown in FIG. 9).
In conclusion, the resistance of the single site is 10-20 uM; the resistance of the two sites is about 0-120uM, which is stronger than that of the single site, and the color is lighter at 100 uM; H141R/N338D/G342D, H141R/G342D/K418P, H141R/G342D/G419F, 338D/342D/346C/H, H141R/G342D/N420S, H141R/N338D/N420S and the like have better combination and ranking resistance, and the color can still be light when the color reaches 1000 uM; the resistance of four or more bit combinations such as H141R/N338D/G342D/K418P, H141R/G342D/K418P/G419F, H141R/N338D/G342D/R346C, H141R/N338D/G342D/R346H, H141R/N338D/G342D/K418P/G419F, H141R/N338D/G342D/G419F/N420S, H141R/N338D/G342D/K418P/G419F/N420S is higher, and the color is still obvious up to 2500uM 101.
Example 6 expression, isolation and purification of OsHPPD enzyme protein
The rice OsHPPD protein and urate oxidase HGD (homogenic enzyme 1,2-dioxygenase) are obtained by heterologous expression of escherichia coli, inserting genes into a pET-15b expression vector, expressing by using a BL21(DE3) expression strain and purifying by Ni-NTA resin.
(1) The HPPD Open Reading Frame (ORF) of the positive clone was recloned into pET-15b vector to form 6His-HPPD expression vector and transformed into BL21(DE3) cells. The expression strain was inoculated into 10mL of 2 XYT medium and cultured overnight at 37 ℃ on a shaker at 200 rpm. 10mL of the culture was inoculated into 1L of 2 XYT medium and cultured to OD600When the temperature reaches 0.6-0.8 ℃, the temperature is reduced to 16 ℃, 0.2mM IPTG (isopropyl thiogalactoside) is induced and expressed overnight, and 2800Xg is centrifuged to collect the bacteria.
(2) The collected cells were resuspended in buffer A (50mM Tris pH 8.0,500mM NaCl,20mM imidazole), added to a final concentration of 1mM PMSF (phenylmethylsulfonyl fluoride), 250ul protease inhibitor cocktail, and mixed well. Cells were disrupted by sonication in an ice bath (40% total power, 3 seconds of operation/6 seconds gap, 2 × 30 minutes (Ningbo New Techno technologies, Inc., China, Ningbo)); centrifugation was carried out at 12000 rpm, 4 ℃ for 30 minutes, and the supernatant was collected and filtered through a 0.22uM filter.
(3) Purifying with Ni-NTA column, combining the supernatant with Ni-NTA resin, washing with buffer A containing 50mM imidazole, and eluting with elution buffer containing 400mM imidazole.
(4) The approximate purity of the target protein was analyzed by SDS-PAGE, and the eluates containing the target protein were combined and concentrated using an ultrafiltration tube (10kDa molecular weight cut-off, Amicon Ultra). And the solution was exchanged and desalted with 20mM Tris-HCl, pH 7.5 solution at least 3 times. Total protein concentration was determined by BCA method. All expressed, purified rice HPPD wild-types and various mutants are shown in table 9.
TABLE 9 Rice HPPD wild type and respective mutant site combinations
(5) Dialyzed or passed through a desalting column and the buffer was changed to stock 50mM Tris pH 8.0,500mM NaCl. Measuring concentration by BCA method, subpackaging, quick freezing with liquid nitrogen, and storing in-80 deg.C refrigerator.
Example 7 determination of various enzymatic parameters of OsHPPD protein by Compounds
1. HPPD activity is measured by that HPPD enzyme catalyzes 4-HPP (4-hydroxyphenylpyruvate) to be converted into HGA (homogentisate), the HGA (homogentisate) is converted into MAA (maleylacetoacetate) under the catalysis of the homogentisate oxidase, the maleylacetoacetate has maximum absorption at 318nm, and the absorption constant is 14.7OD M-1cm-1。
2. 6uL of 4-HPP at a final substrate concentration of 50 fold was added to the enzyme plate by adding 294uL of HEPES (hydroxyethylpiperazine ethanethiosulfonic acid), pH 7, 2mM vitamin C, 10mM FeSO4, 50nM urate oxidase (homogenic citrate) and 5 to 240nM HPPD enzyme at one time to a final concentration of 25 mM. The final concentration of the reaction substrate 4-HPP is generally between 1 and 100 uM.
3. The change of absorbance of the reaction well at 318nm was continuously monitored by an ultraviolet microplate reader (ReadMax1900 type light absorption full-wavelength microplate reader) (Shanghai).
4、OsHPPD Km、KcatAnd Kcat/KmAnd (3) determination:
Vmaxis the maximum catalytic reaction rate, the Michaelis constant K, that can be achieved by enzyme catalysismIs that the enzyme-catalyzed reaction reaches a maximum rate (V)max) Half the time the concentration of the desired substrate, KmThe value is a constant, independent of the enzyme concentration, and varies depending on the kind of substrate to be measured, the temperature, pH and ionic strength of the reaction. KcatIs the catalytic constant of an enzyme, which indicates how many substrates a molecule of enzyme or active center of the enzyme can catalyze to react per second. Kcat/KmIndicating the catalytic efficiency of the enzyme. As shown in Table 10, these enzymatic parameters were determined for the rice HPPD Wild Type (WT) and various mutants. As can be seen from the data in the table, the catalytic efficiency of most mutant HPPDs is enhanced.
TABLE 10 maximum reaction rates VmaxAnd a Michaelis constant KmValue determination
5. Determination of OsHPPD protein inhibition ability IC50 of herbicide 101 and bicyclopyrone
As measured by the inhibition effect of the diafentrazone metabolite 101 and the bicyclopyrone on wild-type (WT) and various mutant OsHPPD proteins of rice, as shown in FIG. 10 and Table 11, the IC50 value of each mutant on 101 and bicyclopyrone herbicide compounds is obviously improved compared with that of the wild type, for example, the IC50 value of H141R/N338D/G342D/K418P/G419F/N420S mutant on 101 herbicide compounds is improved to 13.7 times compared with that of the wild type, and the IC50 value of bicyclopyrone is improved to 1.8 times. An increase in the IC50 values indicated that these mutants had increased tolerance to HPPD herbicides to an extent that was not completely consistent between the two HPPD herbicides due to the unique properties of 101 and bicyclopyrone, respectively, among others.
TABLE 11 inhibitor 101 and ciclopirox versus wild type WT, each mutant OsHPPDIC50 values
6. Assay of OsHPPD protein for inhibitor Fitness (Enzyme Fitness)
Enzyme suitability (Enzyme Fitness) is an index of weak adaptability of Enzyme to inhibitor, the higher the value is, the stronger the resistance of the Enzyme to inhibitor is, because the concentration of substrate is far greater than K during reactionmValue, and the reaction conditions are the same for different OsHPPD mutants, so KcatRate V when catalyzed by the same concentration of enzyme (500nM)maxThe value is replaced. Enzyme Fitness ═ Kcat*Km -1*Ki,Ki=IC50/(1+S/Km) (suppression constant). We tested the inhibition constants and enzyme fitness of the herbicide compound 101 and bicyclopyrone to HPPD wild-type (WT) and various mutants of rice to further evaluate the tolerance of these mutants to herbicides. As shown in Table 12, all mutants had different degrees of enhancement in Enzyme Fitness compared with the wild type, confirming the enhanced tolerance.
TABLE 12 determination of Enzyme Fitness (Enzyme Fitness) of OsHPPD for various compounds
In conclusion, a series of enzymological tests prove that the drug resistance of each mutant of the rice OsHPPD is improved compared with that of the wild type WT. Among them, the tetrad showing the strongest resistance in color reactionThe variant H141R/N338D/G342D/K418P has higher resistance in-vitro enzyme activity experiments, and the results show that the mutants with the K418P site mutation have better resistance improvement but have substrate affinity (K418P site mutation)m) The reduction is realized; the mutant H141R/G342D/P277N is comparable to H141R/N338D/G342D/K418P in resistance and has no substrate affinity (K)m) The problem of becoming low; in addition, the triple mutant H141R/N338D/G342D and the quadruple mutant H141R/N338D/G342D/P386T also have stronger resistance, and KmThere is no reduction; the shortest triple mutant N338D/G342D/R346H also has better resistance and is easy to edit.
Therefore, N338D/G342D/R346H (shortest, suitable for homologous replacement HDR), H141R/N338D/G342D (shorter, suitable for homologous replacement) and H141R/N338D/N420S (suitable for single base editing and strong resistance) are preferably considered for the next test, and after the transgenic and gene-edited plants are made, the tolerance change is tested.
Example 8 transgenic Rice overexpresses triple point mutant OsHPPD3M
1. Construction of overexpression vectors
1) Primer: according to the selected enzyme cutting site and the nucleotide sequence of the gene, a primer is designed for amplifying three-point mutant HPPD (H141R/G342D/D370N) (OsHPPD 3M). The designed primer is synthesized by Beijing Optimalaceae New industry biotechnology Limited: the HPPD-F is a non-linear combination of,GATAGCCGGTACGGGTTCGAGCCACC ATGCCTCCCACT CCCACCC,HPPD–R,GAT CTTTGTAATCGGGGTACCTAGGATCCTTGAACTGTAGGGGC。
2) and (3) PCR amplification: the gene of interest was amplified using synthetic primers and Q5 DNA polymerase (NEB, New England Biolabs, Boston, USA). The amplified product was detected by agarose gel electrophoresis and recovered according to the instructions of the TIANquick Midi Purification kit. After completion of recovery, the extracted DNA concentration was checked by Nanodrop.
3) Construction of rice overexpression vector: the HPPD fragment and plasmid pCAMBIA1301 recovered from KpnI and HindIII enzyme digestion were digested with HB-in fusion of Henan bioscience (Shanghai) Co., LtdTMThe seamless cloning kit is used for constructing a rice overexpression vector pCAMBIA1301-OsHPPD 3M. E.c converted to competentobtaining positive clone by using oligo DH5 alpha, and transforming agrobacterium after sequencing verification and restriction enzyme digestion verification.
2. Agrobacterium transformation and transgenic event generation of rice calli:
1) 1ug each of the rice overexpression vector pCAMBIA1301-OsHPPD3M and pCAMBIA1301 which only expresses mCherry (fluorescent protein marker gene) in idle load is added into the competence of Agrobacterium EH105, and the competence is put on ice for 5 minutes, quickly frozen in liquid nitrogen for 5 minutes, fished out and put at 37 ℃ for 5 minutes, and finally put on ice for 5 minutes. Adding 500 mul YEB liquid culture medium (without antibiotics), and culturing in a shaking table at the temperature of 28 ℃ and 200 r/min for 2-3 h; collecting thallus with 3500 rpm/separation center, spreading the thallus on YEB (clarithromycin + rifampicin) plate, and culturing in 28 deg.C incubator for 2 days; selecting single clone to culture in liquid culture medium, and preserving bacteria at-80 deg.C.
2) And (3) culturing agrobacterium: the transformed Agrobacterium monoclone was picked, shake-cultured in YEB liquid medium (Carramycin + rifampicin) at 28 ℃ until OD600 was 0.5, colonies were collected at 3500 rpm, and the equivalent amount of AAM (1ml AAM + 1. mu.l 1000 × AS) liquid medium was diluted to infect the callus.
3) Inducing rice middle flower 11 callus: before preparing Agrobacterium, rice calli were prepared. Stripping rice seeds, washing the seeds with sterile water until the washed water becomes clear, sterilizing with 70% alcohol for 30 seconds for unlimited times, then placing 5% sodium hypochlorite in a horizontal shaking table for shaking culture for 20 minutes, washing with sterile water for 5 times after sodium hypochlorite sterilization, placing in sterile absorbent paper, air-drying the surface moisture of the seeds, and inoculating on an induction culture medium to culture callus at 28 ℃.
4) Agrobacterium infection rice callus: selecting Huai rice No. 5 callus with the diameter of 3mm for subculture for 10 days, and collecting the callus into a 50ml centrifuge tube; pouring the agrobacterium liquid with the modulated concentration into a centrifuge tube containing callus, and placing the centrifuge tube in a shaker at 28 ℃ and 200 r/min for 20min of infection; after infection, pouring out bacterial liquid, placing the callus on sterile filter paper, air-drying for about 20min, placing on a common culture medium plate, and co-culturing, wherein a piece of sterile filter paper soaked by AAM (1ml of AAM +30 μ l of 1000 × AS) liquid culture medium is laid on the plate; after 3 days of infection, the agrobacteria were washed off (5 times with sterile water and then with 500mg/L cephalosporin antibiotic for 20 minutes) and placed on 50mg/L hygromycin selection medium for selection and culture.
5) Screening, differentiation and rooting of resistant calli: transferring the co-cultured callus to a screening medium for a first round of screening (2 weeks); after the first round of screening, transferring the newly grown callus to a screening medium (containing 50mg/L hygromycin) for second round of screening (2 weeks); after screening is finished, selecting a yellow-white callus with a good growth state for differentiation, adding 1uM-5uM tembotrione into a differentiation culture medium for herbicide resistance screening, and obtaining seedlings about 1cm after 3-4 weeks; transferring the differentiated seedlings to a rooting culture medium for rooting culture; after the seedlings which have finished rooting are hardened, the seedlings are moved to a flowerpot filled with soil and placed in a greenhouse for cultivation; OsHPPD3M 55 seedlings or events were obtained.
3. Primary detection of herbicide resistance of transgenic seedlings (T0 generation): addition of 1-5uM tembotrione to differentiation medium showed that the empty vector control was not tolerant to tembotrione, and that transformed shoots overexpressing 3-point mutant HPPD (H141R/G342D/D370N) were tolerant to 3uM tembotrione, as shown in FIG. 11.
4. Transgenic shoots (T0 generation) were again tested for herbicide resistance: transgenic seedlings of T0 generation were transplanted into large plastic buckets of a greenhouse for cultivation to obtain seeds of T1 generation. At the jointing stage, 2 events were randomly selected from the events overexpressing the mutant type, and a group of rice seedlings of the same growth stage of the non-transgenic middle flower 11 was added to perform herbicide resistance measurement. The herbicide used was diconazole, which is usually applied at a field dose of 4 grams of active ingredient per acre (4g, a.i./mu). The doses of topramezone in this experiment were 8 and 16 grams/acre.
And (3) resistance detection results: on the 5 th day (16 g/mu) and 7 th day (8 g/mu) after spraying, the non-transgenic rice seedlings begin to show albino symptoms, but the transgenic overexpression mutants of Event 1, Event 2, Event 3 and Event 4 are kept in normal green color. Until 32 days later, the sprayed non-transgenic seedlings were nearly dead, but transgenic overexpressing mutants, either treated at 8 g/acre or 16 g/acre, continued to remain green, grew normally, and began spiking (as shown in FIGS. 12A, 12B).
5. Transgenic shoots (T1 generation) were again tested for herbicide resistance:
a) three events, namely Event 20, Event 28 and Event 37 of transgenic over-expression mutant HPPD, and non-transgenic wild type Huai rice No. 5 (the natural tolerance of the Huai rice No. 5 to HPPD topramezone is higher than that of Zhonghua 11, so that the resistance multiple cannot be calculated by using the Huai rice No. 5 as a base number, and the actual resistance should be higher).
b) The dose of the used dicamba is 0, 4, 8, 16, 32 to 64 g/mu, and the symptoms of phytotoxicity show slowly due to the low temperature and weak illumination of the greenhouse in winter. By day 14 post-spray, symptoms were manifested in non-transgenic oryza sativa No. 5 at 32 and 64 g/acre treatments, but none of the transgenic events were symptomatic and remained green (as shown in figures 12C, 12D).
In conclusion, the transgenic rice is enhanced in resistance to the HPPD inhibiting herbicide by over-expressing the three-point mutant OsHPPD3M (H141R/G342D/D370N), and the resistance multiple is at least 4 times. From the initial observation of the growth, development, flowering and fruit setting of transgenic seedlings of the T0 generation and the T1 generation, most of the plants are normal.
Example 9 transgenic Rice overexpression HPPD copy number assay
Hygromycin resistance gene: the GC content of rice hppd (Oshppd) gene is very high, which affects the PCR amplification efficiency, and in addition, rice endogenously has one copy of hppd. Therefore, we selected the selection marker gene hygromycin resistance gene hyg as the foreign gene and Sucrose Phosphate Synthase (SPS) as the endogenous reference gene for copy number estimation. The Sucrose Phosphate Synthase (SPS) gene is a rice-specific gene and is a single copy, and can be used as an endogenous reference gene of rice (Ding Jianyu, Jia Junwei, Yang Li tao et al.differentiation of a rice specific gene, sugar phosphate synthase, used as the endogenous reference gene for a quality and real-time quality PCR detection of genes [ J ]. J.Agric.food Chem.,2004,52: 3372-7). Copy number of over-expressed hppd can be indirectly assessed by determining copy number of hygromycin gene (hyg) of transgenic rice selection marker.
Genomic DNA: the method comprises the steps of extracting and purifying the genomic DNA of the rice leaf by using a plant genomic DNA extraction kit of Tiangen Biochemical technology (Beijing) company, detecting the content and the purity of the DNA by using a nanodrop (nanodrop) and considering that the purity is better when the ratio of OD260/OD280 is within the range of 1.8-2.0 and the ratio of OD260/OD230 is about 2.0.
Primer: two pairs of primers were designed: Hyg-F: 5'-GTACACAAATCGCCCGCAG-3', Hyg-R: 5'-TCTATTTCTTTGCCCTCGGAC-3', and amplifying 111bp long fragment of hygromycin resistance gene; Sps-F: 5'-GTACACAAATCGCCCGCAG-3' and Sps-R: 5'-TCTATTTCTTTGCCCTCGGAC-3', and a 170bp fragment of a Sucrose Phosphate Synthase (SPS) gene is amplified.
Quantitative PCR reaction system: a reaction solution (20. mu.L) was prepared in SYBR Premix ExTaq II system, and real-time fluorescent quantitative PCR was carried out. PCR amplification procedure: pre-denaturation at 95 ℃/30S, followed by 95 ℃/5S → 55 ℃/30S → 72 ℃/30S, for 40 cycles.
And (3) preparing a standard curve: 400bp sequences of the SPS gene and the HYG gene are respectively selected, the selected sequences need to contain fragments amplified by quantitative PCR, the fragments are connected together in a homologous recombination mode, and then the fragments are connected into a pClone007 vector. Digesting the constructed standard plasmid containing HYG gene and SPS gene into linear DNA by using restriction enzyme Psha I, measuring the concentration by using nucleic acid protein detector, and using ddH2Gradient dilution of 106Copy/. mu.L, 105Copy/. mu.L, 104Copy/. mu.L, 103Copy/. mu.L, 102Copies/. mu.L. 5 different dilutions of standards were amplified simultaneously with the blank, setting up three technical replicates per sample. PCR amplification was then performed as described above. Concentration and copy number conversion formula: copy number (copy/mL) — (6.02 × 1023 copies/mol) × (DNA concentration g/mL)/(MW g/mol). Average molecular weight (MW g/mol): dsDNA ═ (number of bases) × (660 daltons/bp).
Calculation of transgene copy number: and each sample to be detected has a cycle number Ct when reaching the threshold value, the Ct value is substituted into the standard curve to obtain the initial template quantity of the sample, and the ratio of the target gene to the initial template quantity of the endogenous gene is the copy number of the target gene. And outputting the data obtained by the experiment through software, and then analyzing the data by using Excel.
Real-time fluorescent quantitative PCR: and analyzing the expression quantity of the related gene of the transgenic rice by adopting a qRT-PCR method, and verifying the over-expression efficiency of the gene. The UBQ5 gene of rice is selected as an internal reference gene. And preparing a reaction solution, and performing real-time fluorescence quantitative PCR. A reaction solution (20. mu.L) was prepared in accordance with SYBR Premix ExTaq II system. The qRT-PCR amplification program was set to: pre-denaturation at 95 ℃ for 30 s; denaturation at 95 ℃ for 5 s; annealing at 60 ℃ for 30 s; extension was carried out at 65 ℃ for 5min for a total of 40 cycles. Data obtained by the experiment are output by software, Excel is adopted for data analysis, and the relative expression quantity of the gene is calculated by using delta-delta CT. All samples were set up for 3 independent biological replicates.
In the experiment, 54 plants with positive PCR detection and 4 non-transgenic control plants are selected, the plant genome DNA extraction kit is used for extracting genome DNA, 3 times of repetition is carried out on each sample, quantitative PCR reaction is carried out to obtain an amplification curve, the setting of a fluorescence domain value is the same as that when a gene standard curve is made, the Ct value of a sample to be detected is obtained, and the equation: HYG0=10(-0.260CT+10.442)Calculating the initial template number of the HYG gene of the sample, and calculating the initial template number according to an equation: SPS0=10(-0.260CT+10.172)The number of initial templates of the Sps gene of the sample was calculated. Because the rice reference gene Sps is a homozygous diploid, and the probability that the exogenous target gene of the current transgenic generation is a homozygote is very small, the copy number of the target gene in the rice genome is obtained by multiplying the data obtained by dividing the number of the HYG initial templates by the number of the SPS initial templates by 2. The results in table 13 show the comparison of the number of initial templates of the gene of interest Hyg and the endogenous reference gene Sps of rice: among the 54 transgenic lines, there were 36 lines with copy number 1, 13 lines with copy number 2, 4 lines with copy number 3, 1 line with copy number 4, and the negative control copy number tested was 0.
TABLE 13 estimation of the copy number of the target Gene in transgenic plants
Note: HYG0And SPS0The initial template numbers of Hyg and Sps genes in PCR reactions are indicated, respectively.
Example 10 Rice Gene editing HPPD inhibiting herbicide resistance
On the basis of obtaining three-point mutations 141, 342, 370 and combinations thereof by carrying out mutation and screening on rice HPPD genes, and in vitro determination of tolerance to HPPD inhibiting herbicides, a mutant combination OsHPPD3M (H141R/G342D/D370N) is overexpressed by transgenic rice to confirm high tolerance to the HPPD inhibiting herbicides, and gene editing is carried out on the HPPD to obtain a non-transgenic rice variety which is tolerant to the HPPD inhibiting herbicides. Firstly, single base editing and homologous replacement of the 141-342-370 three sites are respectively carried out on the amino acids 141, 342 and 370 three sites, and the gene editing process and the results are as follows:
(1) single base editing is a gene editing method that uses the CRISPR/Cas9 system to target deaminase to a specific site in the genome, thereby modifying a specific base. This method has been successfully practiced in rice. Such as: yan f., Kuang y., Ren b., Wang j., Zhang d., Lin h., Yang b., Zhou x., and Zhou h. (2018). High-efficient a.t to g.c base injection by Cas9 n-shaped tRNA amino kinase in rice.mol.plant.doi:10.1016/j.mol p.2018.02.008.
In this example, the amino acids at positions 141, 342 and 370 of the second chromosome Os02g0168100 of the rice HPPD gene were edited, respectively. Rice has edited Histidine (Histidine; codon CAC) at amino acid residue 141 of the HPPD gene to Arginine (Arginine; codon CGC, changing the original A to G) by a single-base editing method. Similarly, Glycine (Glycine; codon GGC) at amino acid residue 342 is edited to Aspartic acid (Aspartic acid; codon GAC, changing the original G to A); the 370 th amino acid residue Aspartic acid (Aspartic acid; codon GAC) was edited to Asparagine (Asparagine; codon AAC, changing from original G to A). The mutant protein xCas9(3.7) -ABE of Cas9 protein with more extensive PAM was selected as editing tool (Hu, J.H.et al.evolved Cas9 variants with branched PAM compatibility and high DNA specificity. Nature http:// dx.doi.org/10.1038/nature26155 (2018)).
According to the DNA sequence near the 141 th amino acid of the rice HPPD gene, a target site of sgRNA is designed: GGTGCaCGCCGTGGCGCTGC-GCG, whereinaIs the site of action of ABE to effect the editing of A to G bases. PAM of the sgRNA is GCG which meets the requirement of xCas9 (3.7).
Similarly, according to the DNA sequence near the 342 th amino acid of the rice HPPD gene, a target site of the sgRNA is designed: GCACGcCGTCGTAGTAGTTG GGC, whereincIs the site of action of the CBE to effect C base to T base editing. PAM of the sgRNA is GGC which meets the requirement of xCas9 (3.7).
Analyzing a DNA sequence near the 370 th amino acid of the rice HPPD gene, and designing a target site of sgRNA: CCTGGTTcATCCCTGTCCACG AGC, whereincIs the site of action of the CBE to effect C base to T base editing. PAM to GGC of the sgRNA also meets the requirement of xCas9 (3.7).
Therefore, we synthesized three pairs of primers 141GE-F: ggcgGTGCaCGCCGTGGCGCTGC and 141 GE-R: aaacGCAGCGCCACGGCGtGCAC, respectively; 342 GE-F: ggcgCACGcCGTCGTAGTAGTTG and 342GE-R: aaacCAACTACTACGACGgCGTG; 370 GE-F: ggcg CCTGGTcATCCCTGTCCACG and 370GE-R: aaacCGTGGACAGGGATgACCAGG. Diluting with ultrapure water to 10uM, mixing in equal amount, placing in boiling water bath, and naturally cooling to room temperature for later use. 1ug of pQY000140 vector was cut with BsaI enzyme at 37 ℃ for one hour, and after detection by agarose gel electrophoresis, the target fragment was recovered and the concentration was determined by UV absorption. And annealing fragment 1: 10 mixed and ligated with T4 DNA ligase (NEB, New England Biolabs, Boston, USA) for 2 hours at 16 ℃. Trans5a competent cells (complete gene, Beijing) were transformed and cultured overnight at 37 ℃. Picking single clone and sequencing single base to edit whether the carrier sequence is correct through sanger. Construction vector pQY000141 is shown in FIG. 13. The E.coli clones with correct sequencing were extracted and transformed into EH105 Agrobacterium (geoOnly, Shanghai).
And (3) transforming the No. 5 callus (at least 3000 callus) of the Huai rice according to the agrobacterium tumefaciens transformation method of the rice callus. After the agrobacterium is infected, transferring the infected callus to a 50mg/L hyg screening culture medium for screening culture. After three rounds (15 days x3) of screening, selecting yellow-white callus with good growth state to differentiate on a differentiation medium, adding 0.2uM tembotrione in the differentiation process to screen for 3-4 weeks, and obtaining about 1500 seedlings with the length of about 1 cm. Of these approximately 1500 differentiated seedlings, the vast majority had whitened, and only 4 were considered to be normally green. These 4 green shoots were transplanted into rooting medium containing 0.4uM tembotrione and cultured for 2 weeks, two of which also whitened and only 2 remained green (FIG. 14A). A small number of leaves were used to extract genomic DNA by the CTAB method. With primer oshppd 54F: TTCCACCACGTCGAGCTC and Oshppd 356R: GGTGAACCCGGAGATGTACG PCR was performed. The amplification products were detected by 1% agarose electrophoresis and subjected to sanger sequencing.
Sequencing results showed that the 2 green shoots (QY000141-1 and QY000141-2) all successfully edited at amino acid 141 (FIG. 14B) while the albino shoot was wild type.
(2) CRISPR/cas9-mediated homologous replacement of rice HPPD mutants to achieve herbicide resistance
After obtaining the transgenic event over-expression 3-point mutant H141R/G342D/D370N, we also carried out homologous replacement on the 3-point mutant combination to obtain herbicide-resistant non-transgenic rice.
The rice hppd gene has two exons (exon) and one intron (intron). The three target sites H141, G342 and D370 are all located in the first exon.
gRNA design: at least one gRNA is designed at the upstream of H141 and the downstream of D370, and cutting is performed once, and then three sites are simultaneously replaced by a homologous replacement method. Inputting exon 1 sequence into http:// crispot. tefor. net/evaluating all possible grnas. the following 2 grnas were selected according to the principle of score of specificity greater than 90(Hsu PD, Scott DA, Weinstein JA, Ran FA, Konermann S, Agarwala V, Li Y, Fine EJ, Wu X, Shalem O, cradic TJ, Marraffini LA, Bao G, Zhang f. nat biotechnol.2013sep; 31(9):827-32.doi:10.1038/nbt.2647. epub.2013 Jul 21) to try to avoid off-target effect and shorten its length: OshppdgRNA-PAM1-2: 5'-GGAACGCGAGCGCCTGGAAC CGG-3' (GC ═ 70%) (bottom strand);
OshppdgRNA-PAM2-1(GC=39%):5’-CACCTCTTTCATGATGAAAA TGG-3’(top strand);
the sequences of PAM are underlined, and the bold G indicates that when the replacement template DNA is designed, this G will be changed to another base on the replacement template to destroy the PAM, and avoid re-cleavage after replacement.
The distribution of these two gRNAs 1-2 and gRNA2-1 on rice genomic DNA is shown in FIG. 15.
Template donor DNA design is shown in fig. 16: according to the cloud laboratory (Sun Y, Zhang X, Wu C, He Y, Ma Y, Hou H, Guo X, Du W, Zhao Y, Xia L. engineering trailer-Resistant Rice Plants through CRISPR/Cas9-media Homologous combination of acetic acid synthesis. mol plant. Apr 4; 9(4):628-31.doi:10.1016/j. mol p.2016.01.001.Epub 2016Jan 6), we first designed the homology arm at 350 bp; to increase the likelihood of homologous substitution, two versions of template donors were designed for each editing vector: directly connecting the template on an editing carrier, so that the gRNA, the Cas9 and the template simultaneously enter the same cell, and once the Cas9 and the gRNA cut the cell genome target DNA, the template donor DNA can be repaired in time; another version is free template donor DNA generated by PCR amplification, and these additional repair templates, will be amplified at 20: 1 (free repair template: editing vector, molar ratio) and editing vector, and bombarding with a gene gun. The length of the core replacement region of the three mutant amino acids 141-342-370 is determined by two selected target RNA cleavage positions (1056bp), the left and right homology arms are 350bp respectively, and after cleavage from the vector, the left and right ends are 6bp respectively, and the total length of the template is 1768 bp; in order to facilitate rapid genotype identification of a PCR product after PCR amplification, the NcoI enzyme cutting site in the PCR product is removed; and PAM (NGG) at the original cutting site on the template is also removed to avoid re-cutting after replacement.
Editing a carrier: the rice U3 promoter is used to express gRNA1-2 and gRNA2-1, respectively. Therefore, the two gRNA expression cassettes were ligated together with a template and then sent to Kingrui Biotech (Nanjing) for synthesis. The synthesized DNA fragment was ligated to the backbone vector pCXUN-Cas9 (from Bo. Dr. Mol plant.2016Apr 4; 9(4):628-31.doi:10.1016/j. molp.2016.01.001.Epub 2016Jan 6.) at KpnI using seamless cloning techniques to generate the editing vector.
Performing gene gun transformation, screening, differentiation, rooting and soil culture of seedlings: the editing vector constructed above was sequenced and verified by multiple enzymatic cleavage, and compared with free template donor DNA generated by PCR amplification, at 20: 1 (free repair template: editing vector, molar ratio) and editing vector, transforming Huai rice No. 5 callus with gene gun. After about 3000 calli were transformed, they were transferred to 50mg/L hyg selection medium for selection and culture in order to obtain transgenic plants first. After three rounds (15 days x3) of screening, selecting yellow-white callus with good growth state to differentiate on a differentiation medium, adding 0.2uM tembotrione in the differentiation process to screen for 3-4 weeks, and obtaining about 1000 seedlings with the length of about 1 cm. Of these approximately 1000 differentiated seedlings, most had whitened, but 21 plants remained green. The 21 green seedlings are transferred to a rooting culture medium containing 0.4uM tembotrione for continuous culture, and the growth of root systems is promoted. After two weeks, 18 more albino seedlings were whitened, and the remaining 2 green seedlings (nos. AW2 and AW3) were transplanted into pots and cultivated in a greenhouse. The green seedlings photographed before transplantation are shown in fig. 17A.
Identification of hppd genotype of edited shoots: to identify the genotype, three pairs of PCR primers were designed to amplify the 342-370 mutation site region, 342-370 region + partial downstream genomic DNA sequence and 141 single site, respectively. These primer pairs were 290-F: AGATACAGACGTACCTGGACCACCA and 1553-R: GCCGGCAAAAAGGAACTGGG (342-370 mutation site region), 90-F: AGATACAGACGTACCTGGACCACCA and donor-out-R: AGTGATTGTACCATCATTTGTC (342-370 region + partial downstream genomic DNA sequence), and 54-F: TTCCACCACGTCGAGCTC and 356-R: GGTGAACCCGGAGATGTACG (141 single point).
The identification result shows that: these 2 green shoots did have a successful edit (FIG. 17B). The band generated after the PCR product is cut by NcoI enzyme accords with the expectation; the sequencing results also showed a change from wild-type histidine His to arginine Arg at point 141 (codon from CAC to CGC), wild-type glycine Gly to aspartic acid Asp at point 342 (codon from GGC to GAC), and wild-type aspartic acid Asp to asparagine Asn at point 370 (codon from GAC to AAC).
Meanwhile, through a plurality of tests, the gene disclosed by the invention is introduced into model plants such as arabidopsis thaliana and brachypodium distachyon, and the drug resistance of the corresponding level is improved. In addition, editing of the above mentioned mutation sites and combinations via the CRISPR/Cpf1 system is also in use. Therefore, when the transgene or the gene is edited into other plants, such as grain crops, bean crops, oil crops, fiber crops, fruit crops, root crops, vegetable crops, flower crops, medicinal crops, raw material crops, pasture crops, sugar crops, beverage crops, lawn plants, tree crops, nut crops and the like, the corresponding resistance traits can be generated, and the industrial value is good.
All publications and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be apparent that certain changes and modifications may be practiced within the scope of the appended claims, and such changes and modifications are intended to be within the scope of the present invention.
Sequence listing
<110> Qingdao Qingyuan Compound Co., Ltd
<120> mutant p-hydroxyphenylpyruvate dioxygenase, nucleic acid encoding same and use thereof
<130> 20190122
<160> 260
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1341
<212> DNA
<213> wild type rice hppd Gene open reading frame sequence (Oshppd _ WT)
<400> 1
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 2
<211> 446
<212> PRT
<213> wild-type Rice HPPD protein amino acid sequence (OsHPPD _ WT)
<400> 2
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 3
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ A103S)
<400> 3
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgctc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcacctccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcat tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 4
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ A103S)
<400> 4
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ser Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ser Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 5
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R)
<400> 5
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 6
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R)
<400> 6
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 7
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ A165V)
<400> 7
atgcctccca ctcccacccc caccgccacc accggcgccg cctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca tgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcaccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggttttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 8
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ A165V)
<400> 8
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Ala Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Thr Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Val Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 9
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ V191I)
<400> 9
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac tttctcaagc tcaagtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc atcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 10
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ V191I)
<400> 10
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His Phe Leu Lys Leu Lys Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Ile Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 11
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ R220K)
<400> 11
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccaccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagt tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcacgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgcaag 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 12
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ R220K)
<400> 12
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His His
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Phe Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Thr Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Lys Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 13
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ D370N)
<400> 13
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggataac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 14
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ D370N)
<400> 14
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asn Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 15
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ K410I)
<400> 15
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagatt ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 16
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ K410I)
<400> 16
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Ile Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 17
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141K)
<400> 17
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
aaggccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 18
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141K)
<400> 18
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Lys Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 19
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141T)
<400> 19
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
accgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 20
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141T)
<400> 20
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Thr Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 21
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ G342D)
<400> 21
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 22
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ G342D)
<400> 22
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 23
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/D370N)
<400> 23
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggataac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 24
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/D370N)
<400> 24
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asn Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 25
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/G342D)
<400> 25
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 26
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/G342D)
<400> 26
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 27
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ G342D/D370N)
<400> 27
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggataac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 28
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ G342D/D370N)
<400> 28
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asn Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 29
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/G342D/D370N)
<400> 29
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggataac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 30
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/G342D/D370N)
<400> 30
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asn Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 31
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ R93S)
<400> 31
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctctcct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 32
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ R93S)
<400> 32
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Ser Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 33
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ G226H)
<400> 33
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtccacaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 34
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ G226H)
<400> 34
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val His Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 35
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ L276W)
<400> 35
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgtggcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 36
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ L276W)
<400> 36
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Trp Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 37
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P277N)
<400> 37
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgaa tctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 38
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P277N)
<400> 38
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Asn Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 39
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P336D)
<400> 39
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 40
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P336D)
<400> 40
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 41
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P337A)
<400> 41
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccggc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 42
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P337A)
<400> 42
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Ala Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 43
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ N338D)
<400> 43
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 44
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ N338D)
<400> 44
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asp Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 45
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ N338S)
<400> 45
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cagctactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 46
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ N338S)
<400> 46
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Ser Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 47
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ N338Y)
<400> 47
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc ctactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 48
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ N338Y)
<400> 48
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Tyr Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 49
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ R346C)
<400> 49
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggtgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 50
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ R346C)
<400> 50
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Cys Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 51
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ R346H)
<400> 51
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggcacgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 52
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ R346H)
<400> 52
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg His Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 53
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ R346S)
<400> 53
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggagcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 54
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ R346S)
<400> 54
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Ser Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 55
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ R346D)
<400> 55
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcgggacgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 56
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ R346D)
<400> 56
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Asp Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 57
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ R346Y)
<400> 57
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggtacgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 58
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ R346Y)
<400> 58
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Tyr Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 59
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ I377C)
<400> 59
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagtg cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 60
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ I377C)
<400> 60
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Cys Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 61
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P386T)
<400> 61
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggacaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 62
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P386T)
<400> 62
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Thr Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 63
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ L390I)
<400> 63
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcatt gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 64
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ L390I)
<400> 64
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Ile Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 65
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ M392L)
<400> 65
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagctgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 66
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ M392L)
<400> 66
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Leu Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 67
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ K418P)
<400> 67
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 68
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ K418P)
<400> 68
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Pro Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 69
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ G419F)
<400> 69
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagttcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 70
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ G419F)
<400> 70
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Phe Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 71
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ G419L)
<400> 71
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagttgaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 72
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ G419L)
<400> 72
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Leu Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 73
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ G419V)
<400> 73
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaaggtgaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 74
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ G419V)
<400> 74
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Val Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 75
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ N420S)
<400> 75
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcagc 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 76
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ N420S)
<400> 76
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Ser Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 77
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ N420T)
<400> 77
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcacc 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 78
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ N420T)
<400> 78
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Thr Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 79
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ E403G)
<400> 79
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatggga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 80
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ E403G)
<400> 80
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Gly Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 81
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ E430G)
<400> 81
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgagggg tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 82
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ E430G)
<400> 82
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Gly Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 83
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ Y431L)
<400> 83
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag ttggagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 84
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ Y431L)
<400> 84
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Leu Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 85
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/N338D)
<400> 85
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 86
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/N338D)
<400> 86
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asp Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 87
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/G342D)
<400> 87
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 88
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/G342D)
<400> 88
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 89
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ N338D/G342D)
<400> 89
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 90
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ N338D/G342D)
<400> 90
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asp Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 91
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ K418P/G419F)
<400> 91
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgttcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 92
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ K418P/G419F)
<400> 92
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Pro Phe Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 93
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ G419F/N420S)
<400> 93
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagttcagc 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 94
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ G419F/N420S)
<400> 94
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Phe Ser Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 95
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ G342D/R346C)
<400> 95
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacgacgtgc ggcggtgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 96
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ G342D/R346C)
<400> 96
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Asp Val Arg Arg Cys Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 97
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ G342D/R346H)
<400> 97
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacgacgtgc ggcggcacgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 98
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ G342D/R346H)
<400> 98
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Asp Val Arg Arg His Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 99
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/N420S)
<400> 99
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcagc 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 100
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/N420S)
<400> 100
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Ser Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 101
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ G338D/K418P)
<400> 101
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 102
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ G338D/K418P)
<400> 102
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asp Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Pro Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 103
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P277N/N338D)
<400> 103
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgaa tctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 104
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P277N/N338D)
<400> 104
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Asn Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asp Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 105
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ L276W/P277N)
<400> 105
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgtggaa tctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 106
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ L276W/P277N)
<400> 106
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Trp Asn Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 107
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/N338D/G342D)
<400> 107
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 108
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/N338D/G342D)
<400> 108
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asp Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 109
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/G342D/K418P)
<400> 109
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 110
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/G342D/K418P)
<400> 110
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Pro Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 111
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/G342D/G419F)
<400> 111
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagttcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 112
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/G342D/G419F)
<400> 112
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Phe Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 113
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/G342D/P386T)
<400> 113
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggacaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 114
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/G342D/P386T)
<400> 114
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Thr Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 115
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ K418P/G419F/N420T)
<400> 115
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgttcacc 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 116
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ K418P/G419F/N420T)
<400> 116
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Pro Phe Thr Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 117
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ K418T/G419F/N420T)
<400> 117
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaccttcacc 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 118
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ K418T/G419F/N420T)
<400> 118
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Thr Phe Thr Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 119
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/G342D/R346C)
<400> 119
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacgacgtgc ggcggtgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 120
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/G342D/R346C)
<400> 120
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Asp Val Arg Arg Cys Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 121
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/G342D/R346H)
<400> 121
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacgacgtgc ggcggcacgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 122
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/G342D/R346H)
<400> 122
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Asp Val Arg Arg His Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 123
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/G342D/N420S)
<400> 123
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcagc 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 124
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/G342D/N420S)
<400> 124
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Ser Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 125
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/G342D/P277N)
<400> 125
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgaa tctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 126
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/G342D/P277N)
<400> 126
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Asn Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 127
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/G342D/P336D)
<400> 127
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc caactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 128
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/G342D/P336D)
<400> 128
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp
325 330 335
Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 129
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/G342D/L276W)
<400> 129
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgtggcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 130
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/G342D/L276W)
<400> 130
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Trp Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 131
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/G342D/R346S)
<400> 131
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacgacgtgc ggcggagcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 132
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/G342D/R346S)
<400> 132
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Asp Val Arg Arg Ser Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 133
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/G342D/L390I)
<400> 133
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcatt gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 134
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/G342D/L390I)
<400> 134
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Ile Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 135
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/G342D/I377C)
<400> 135
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagtg cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 136
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/G342D/I377C)
<400> 136
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Cys Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 137
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/G342D/M392L)
<400> 137
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagctgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 138
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/G342D/M392L)
<400> 138
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Leu Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 139
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/P337A/G342D)
<400> 139
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccggc caactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 140
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/P337A/G342D)
<400> 140
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Ala Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 141
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/N338S/G342D)
<400> 141
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cagctactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 142
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/N338S/G342D)
<400> 142
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Ser Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 143
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/N338Y/G342D)
<400> 143
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc ctactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 144
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/N338Y/G342D)
<400> 144
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Tyr Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 145
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P277N/N338D/G342D)
<400> 145
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgaa tctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 146
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P277N/N338D/G342D)
<400> 146
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Asn Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asp Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 147
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P277N/G342D/R346C)
<400> 147
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgaa tctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacgacgtgc ggcggtgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 148
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P277N/G342D/R346C)
<400> 148
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Asn Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Asp Val Arg Arg Cys Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 149
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P277N/N338D/N420S)
<400> 149
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgaa tctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcagc 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 150
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P277N/N338D/N420S)
<400> 150
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Asn Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asp Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Ser Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 151
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ N338D/G342D/K418P)
<400> 151
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 152
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ N338D/G342D/K418P)
<400> 152
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asp Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Pro Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 153
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/N338D/N420S)
<400> 153
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcagc 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 154
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/N338D/N420S)
<400> 154
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asp Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Ser Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 155
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/N338S/N420S)
<400> 155
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cagctactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcagc 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 156
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/N338S/N420S)
<400> 156
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Ser Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Ser Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 157
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/N338D/G342D/K418P)
<400> 157
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 158
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/N338D/G342D/K418P)
<400> 158
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asp Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Pro Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 159
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/N338D/G342D/G419F)
<400> 159
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagttcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 160
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/N338D/G342D/G419F)
<400> 160
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asp Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Phe Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 161
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/N338D/G342D/P386T)
<400> 161
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggacaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 162
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/N338D/G342D/P386T)
<400> 162
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asp Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Thr Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 163
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/N338D/G342D/R346C)
<400> 163
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020
gacgacgtgc ggcggtgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 164
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/N338D/G342D/R346C)
<400> 164
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asp Tyr Tyr Asp Asp Val Arg Arg Cys Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 165
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/N338D/G342D/R346H)
<400> 165
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020
gacgacgtgc ggcggcacgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 166
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/N338D/G342D/R346H)
<400> 166
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asp Tyr Tyr Asp Asp Val Arg Arg His Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 167
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/G342D/K418P/G419F)
<400> 167
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgttcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 168
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/G342D/K418P/G419F)
<400> 168
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Pro Phe Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 169
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/G342D/L276W/P277N)
<400> 169
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgtggaa tctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 170
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/G342D/L276W/P277N)
<400> 170
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Trp Asn Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 171
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/N338D/G342D/K418P/G419F)
<400> 171
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgttcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 172
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/N338D/G342D/K418P/G419F)
<400> 172
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asp Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Pro Phe Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 173
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/N338D/G342D/G419F/N420S)
<400> 173
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagttcagc 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 174
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/N338D/G342D/G419F/N420S)
<400> 174
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asp Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Phe Ser Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 175
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/N338D/G342D/K418P/G419F/N420S)
<400> 175
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgttcagc 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 176
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/N338D/G342D/K418P/G419F/N420S)
<400> 176
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asp Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Pro Phe Ser Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 177
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/N338D/G342D/K418P/G419F/N420T)
<400> 177
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgttcacc 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 178
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/N338D/G342D/K418P/G419F/N420T)
<400> 178
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asp Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Pro Phe Thr Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 179
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/N338D/G342D/R346C/K418P/G419F/N420S)
<400> 179
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020
gacgacgtgc ggcggtgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgttcagc 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 180
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/N338D/G342D/R346C/K418P/G419F/N420S)
<400> 180
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asp Tyr Tyr Asp Asp Val Arg Arg Cys Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Pro Phe Ser Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 181
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/N338D/G342D/R346H/K418P/G419F/N420S)
<400> 181
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020
gacgacgtgc ggcggcacgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgttcagc 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 182
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/N338D/G342D/R346H/K418P/G419F/N420S)
<400> 182
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asp Tyr Tyr Asp Asp Val Arg Arg His Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Pro Phe Ser Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 183
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P277N/P336D/N338D/G342D)
<400> 183
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgaa tctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc cgactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 184
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P277N/P336D/N338D/G342D)
<400> 184
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Asn Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp
325 330 335
Pro Asp Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 185
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P277N/N338D/G342D/R346C)
<400> 185
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgaa tctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020
gacgacgtgc ggcggtgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 186
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P277N/N338D/G342D/R346C)
<400> 186
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Asn Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asp Tyr Tyr Asp Asp Val Arg Arg Cys Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 187
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P277N/N338D/K418P/G419F)
<400> 187
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgaa tctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020
gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgttcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 188
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P277N/N338D/K418P/G419F)
<400> 188
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Asn Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asp Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Pro Phe Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 189
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/P277N/N338D/G342D/K418P/G419F/N420S)
<400> 189
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgaa tctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgttcagc 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 190
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/P277N/N338D/G342D/K418P/G419F/N420S)
<400> 190
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Asn Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asp Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Pro Phe Ser Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 191
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/P277N/P336D/N338D/G342D/K418P/G419F/N420S)
<400> 191
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgaa tctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc cgactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgttcagc 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 192
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/P277N/P336D/N338D/G342D/K418P/G419F/N420S)
<400> 192
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Asn Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp
325 330 335
Pro Asp Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Pro Phe Ser Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 193
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ H141R/G336D/G342D/K418P/G419F/N420S)
<400> 193
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc caactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgttcagc 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 194
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ H141R/G336D/G342D/K418P/G419F/N420S)
<400> 194
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp
325 330 335
Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Pro Phe Ser Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 195
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P336D/N338D/G342D)
<400> 195
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc cgactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 196
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P336D/N338D/G342D)
<400> 196
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp
325 330 335
Pro Asp Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 197
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P336D/N338S/G342D)
<400> 197
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc cagctactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 198
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P336D/N338S/G342D)
<400> 198
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp
325 330 335
Pro Ser Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 199
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P336D/N338Y/G342D)
<400> 199
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc ctactactac 1020
gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 200
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P336D/N338Y/G342D)
<400> 200
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp
325 330 335
Pro Tyr Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 201
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ N338D/G342D/R346C)
<400> 201
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020
gacgacgtgc ggcggtgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 202
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ N338D/G342D/R346C)
<400> 202
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asp Tyr Tyr Asp Asp Val Arg Arg Cys Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 203
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ N338D/G342D/R346H)
<400> 203
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020
gacgacgtgc ggcggcacgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 204
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ N338D/G342D/R346H)
<400> 204
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asp Tyr Tyr Asp Asp Val Arg Arg His Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 205
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ N338D/G342D/R346S)
<400> 205
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020
gacgacgtgc ggcggagcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 206
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ N338D/G342D/R346S)
<400> 206
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Asp Tyr Tyr Asp Asp Val Arg Arg Ser Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 207
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ N338S/G342D/R346C)
<400> 207
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cagctactac 1020
gacgacgtgc ggcggtgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 208
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ N338S/G342D/R346C)
<400> 208
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Ser Tyr Tyr Asp Asp Val Arg Arg Cys Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 209
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ N338S/G342D/R346H)
<400> 209
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cagctactac 1020
gacgacgtgc ggcggcacgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 210
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ N338S/G342D/R346H)
<400> 210
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Ser Tyr Tyr Asp Asp Val Arg Arg His Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 211
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ N338S/G342D/R346S)
<400> 211
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cagctactac 1020
gacgacgtgc ggcggagcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 212
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ N338S/G342D/R346S)
<400> 212
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Ser Tyr Tyr Asp Asp Val Arg Arg Ser Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 213
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ N338Y/G342D/R346C)
<400> 213
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc ctactactac 1020
gacgacgtgc ggcggtgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 214
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ N338Y/G342D/R346C)
<400> 214
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Tyr Tyr Tyr Asp Asp Val Arg Arg Cys Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 215
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ N338Y/G342D/R346H)
<400> 215
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc ctactactac 1020
gacgacgtgc ggcggcacgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 216
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ N338Y/G342D/R346H)
<400> 216
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Tyr Tyr Tyr Asp Asp Val Arg Arg His Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 217
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ N338Y/G342D/R346S)
<400> 217
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc ctactactac 1020
gacgacgtgc ggcggagcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 218
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ N338Y/G342D/R346S)
<400> 218
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro
325 330 335
Pro Tyr Tyr Tyr Asp Asp Val Arg Arg Ser Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 219
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P336D/G342D/R346H)
<400> 219
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc caactactac 1020
gacgacgtgc ggcggcacgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 220
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P336D/G342D/R346H)
<400> 220
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp
325 330 335
Pro Asn Tyr Tyr Asp Asp Val Arg Arg His Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 221
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P336D/G342D/R346C)
<400> 221
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc caactactac 1020
gacgacgtgc ggcggtgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 222
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P336D/G342D/R346C)
<400> 222
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp
325 330 335
Pro Asn Tyr Tyr Asp Asp Val Arg Arg Cys Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 223
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P336D/G342D/R346S)
<400> 223
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc caactactac 1020
gacgacgtgc ggcggagcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 224
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P336D/G342D/R346S)
<400> 224
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp
325 330 335
Pro Asn Tyr Tyr Asp Asp Val Arg Arg Ser Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 225
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P336D/N338D/R346C)
<400> 225
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc cgactactac 1020
gacggcgtgc ggcggtgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 226
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P336D/N338D/R346C)
<400> 226
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp
325 330 335
Pro Asp Tyr Tyr Asp Gly Val Arg Arg Cys Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 227
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P336D/N338D/R346H)
<400> 227
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc cgactactac 1020
gacggcgtgc ggcggcacgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 228
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P336D/N338D/R346H)
<400> 228
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp
325 330 335
Pro Asp Tyr Tyr Asp Gly Val Arg Arg His Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 229
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P336D/N338D/R346S)
<400> 229
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc cgactactac 1020
gacggcgtgc ggcggagcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 230
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P336D/N338D/R346S)
<400> 230
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp
325 330 335
Pro Asp Tyr Tyr Asp Gly Val Arg Arg Ser Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 231
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P336D/N338S/R346C)
<400> 231
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc cagctactac 1020
gacggcgtgc ggcggtgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 232
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P336D/N338S/R346C)
<400> 232
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp
325 330 335
Pro Ser Tyr Tyr Asp Gly Val Arg Arg Cys Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 233
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P336D/N338S/R346H)
<400> 233
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc cagctactac 1020
gacggcgtgc ggcggcacgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 234
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P336D/N338S/R346H)
<400> 234
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp
325 330 335
Pro Ser Tyr Tyr Asp Gly Val Arg Arg His Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 235
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P336D/N338S/R346S)
<400> 235
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc cagctactac 1020
gacggcgtgc ggcggagcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 236
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P336D/N338S/R346S)
<400> 236
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp
325 330 335
Pro Ser Tyr Tyr Asp Gly Val Arg Arg Ser Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 237
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P336D/N338Y/R346C)
<400> 237
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc ctactactac 1020
gacggcgtgc ggcggtgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 238
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P336D/N338Y/R346C)
<400> 238
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp
325 330 335
Pro Tyr Tyr Tyr Asp Gly Val Arg Arg Cys Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 239
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P336D/N338Y/R346H)
<400> 239
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc ctactactac 1020
gacggcgtgc ggcggcacgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 240
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P336D/N338Y/R346H)
<400> 240
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp
325 330 335
Pro Tyr Tyr Tyr Asp Gly Val Arg Arg His Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 241
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P336D/N338Y/R346S)
<400> 241
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc ctactactac 1020
gacggcgtgc ggcggagcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 242
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P336D/N338Y/R346S)
<400> 242
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp
325 330 335
Pro Tyr Tyr Tyr Asp Gly Val Arg Arg Ser Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 243
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P336D/N338D/G342D/R346C)
<400> 243
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc cgactactac 1020
gacgacgtgc ggcggtgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 244
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P336D/N338D/G342D/R346C)
<400> 244
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp
325 330 335
Pro Asp Tyr Tyr Asp Asp Val Arg Arg Cys Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 245
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P336D/N338D/G342D/R346H)
<400> 245
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc cgactactac 1020
gacgacgtgc ggcggcacgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 246
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P336D/N338D/G342D/R346H)
<400> 246
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp
325 330 335
Pro Asp Tyr Tyr Asp Asp Val Arg Arg His Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 247
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P336D/N338D/G342D/R346S)
<400> 247
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc cgactactac 1020
gacgacgtgc ggcggagcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 248
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P336D/N338D/G342D/R346S)
<400> 248
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp
325 330 335
Pro Asp Tyr Tyr Asp Asp Val Arg Arg Ser Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 249
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P336D/N338S/G342D/R346C)
<400> 249
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc cagctactac 1020
gacgacgtgc ggcggtgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 250
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P336D/N338S/G342D/R346C)
<400> 250
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp
325 330 335
Pro Ser Tyr Tyr Asp Asp Val Arg Arg Cys Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 251
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P336D/N338S/G342D/R346H)
<400> 251
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc cagctactac 1020
gacgacgtgc ggcggcacgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 252
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P336D/N338S/G342D/R346H)
<400> 252
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp
325 330 335
Pro Ser Tyr Tyr Asp Asp Val Arg Arg His Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 253
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P336D/N338S/G342D/R346S)
<400> 253
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc cagctactac 1020
gacgacgtgc ggcggagcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 254
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P336D/N338S/G342D/R346S)
<400> 254
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp
325 330 335
Pro Ser Tyr Tyr Asp Asp Val Arg Arg Ser Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 255
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P336D/N338Y/G342D/R346C)
<400> 255
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc ctactactac 1020
gacgacgtgc ggcggtgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 256
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P336D/N338Y/G342D/R346C)
<400> 256
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp
325 330 335
Pro Tyr Tyr Tyr Asp Asp Val Arg Arg Cys Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 257
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P336D/N338Y/G342D/R346H)
<400> 257
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc ctactactac 1020
gacgacgtgc ggcggcacgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 258
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P336D/N338Y/G342D/R346H)
<400> 258
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp
325 330 335
Pro Tyr Tyr Tyr Asp Asp Val Arg Arg His Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445
<210> 259
<211> 1341
<212> DNA
<213> open reading frame sequence of rice hppd mutant (Oshppd _ P336D/N338Y/G342D/R346S)
<400> 259
atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60
ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120
agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180
tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240
tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300
ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360
atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420
cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480
ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540
gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600
ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660
ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720
ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780
ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840
ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900
ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960
cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc ctactactac 1020
gacgacgtgc ggcggagcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080
gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140
ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200
aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260
ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320
cctacagttc aaggatccta g 1341
<210> 260
<211> 446
<212> PRT
<213> Rice HPPD mutant amino acid sequence (OsHPPD _ P336D/N338Y/G342D/R346S)
<400> 260
Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala
1 5 10 15
Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg
20 25 30
Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala
35 40 45
Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly
50 55 60
Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu
65 70 75 80
Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser
85 90 95
Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly
100 105 110
Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala
115 120 125
Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala
130 135 140
Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala
145 150 155 160
Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly
165 170 175
Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser
180 185 190
His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val
195 200 205
Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val
210 215 220
Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly
225 230 235 240
Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly
245 250 255
Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu
260 265 270
Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg
275 280 285
Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln
290 295 300
His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met
305 310 315 320
Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp
325 330 335
Pro Tyr Tyr Tyr Asp Asp Val Arg Arg Ser Ala Gly Asp Val Leu Ser
340 345 350
Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg
355 360 365
Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp
370 375 380
Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu
385 390 395 400
Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe
405 410 415
Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu
420 425 430
Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser
435 440 445