1. The application of the corn bract-related protein or the substance for regulating the content or the activity of the corn bract-related protein in regulating the growth of corn bracts, wherein the corn bract-related protein is A1), A2) or A3) as follows:

A1) the amino acid sequence is the protein of sequence 3;

A2) the protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence shown in the sequence 3 in the sequence table and has the same function;

A3) a fusion protein obtained by connecting a label to the N-terminal or/and the C-terminal of A1) or A2).

2. Use according to claim 1, characterized in that: the substance is any one of the following B1) to B9):

B1) a nucleic acid molecule encoding a maize bract-associated protein of claim 1;

B2) an expression cassette comprising the nucleic acid molecule of B1);

B3) a recombinant vector containing the nucleic acid molecule of B1) or a recombinant vector containing the expression cassette of B2);

B4) a recombinant microorganism containing B1) the nucleic acid molecule, or a recombinant microorganism containing B2) the expression cassette, or a recombinant microorganism containing B3) the recombinant vector;

B5) a transgenic plant cell line comprising B1) the nucleic acid molecule or a transgenic plant cell line comprising B2) the expression cassette;

B6) transgenic plant tissue comprising the nucleic acid molecule of B1) or transgenic plant tissue comprising the expression cassette of B2);

B7) a transgenic plant organ containing the nucleic acid molecule of B1), or a transgenic plant organ containing the expression cassette of B2);

B8) a nucleic acid molecule that reduces the amount or activity of a maize bract-associated protein of claim 1;

B9) an expression cassette, a recombinant vector, a recombinant microorganism, a transgenic plant cell line, a transgenic plant tissue or a transgenic plant organ comprising the nucleic acid molecule according to B8).

3. Use according to claim 2, characterized in that: B1) the nucleic acid molecule is any one of the following b11) -b 15):

b11) the coding sequence is cDNA molecule or DNA molecule of sequence 2 in the sequence table;

b12) a cDNA molecule or a DNA molecule shown in a sequence 2 in a sequence table;

b13) DNA molecule shown in sequence 3 in the sequence table;

b14) a cDNA molecule or DNA molecule having 75% or more identity with the nucleotide sequence defined in b11) or b12) or b13) and encoding the maize bract-related protein of claim 1;

b15) a cDNA molecule or a DNA molecule which hybridizes with the nucleotide sequence defined by b11) or b12) or b13) or b14) under stringent conditions and encodes the corn bract-related protein described in claim 1.

4. Use of the maize bract-related protein or the substance for regulating the content or activity of the maize bract-related protein according to any one of claims 1 to 3 for regulating the width of maize bract.

5. Use of the maize bract-related protein or the substance for regulating the content or activity of the maize bract-related protein according to any one of claims 1 to 3 for cultivating maize with reduced bract width.

6. The following method of X1 or X2:

x1, a method of reducing corn bract width comprising: reducing the amount of the maize-husk-related protein according to claim 1 in a recipient maize, or reducing the activity of the maize-husk-related protein according to claim 1 in a recipient maize, or inhibiting the expression of the gene encoding the maize-husk-related protein according to claim 1 in a recipient maize, or knocking out the gene encoding the maize-husk-related protein according to claim 1 in a recipient maize, to obtain a maize of interest with a reduced husk width compared to the recipient maize, to achieve a reduction in the maize husk width;

x2, a method of growing corn with reduced bract width comprising: reducing the amount of the maize bract-related protein of claim 1 in the recipient maize, or reducing the activity of the maize bract-related protein of claim 1 in the recipient maize, or inhibiting the expression of the gene encoding the maize bract-related protein of claim 1 in the recipient maize, or knocking out the gene encoding the maize bract-related protein of claim 1 in the recipient maize, to obtain the maize of interest having a reduced bract width compared to the recipient maize.

7. The method of claim 6, wherein: knocking out the maize bract-associated protein coding gene as described in claim 1 in receptor maize by the CRISPR/Cas9 method.

8. The method of claim 7, wherein: the target sequence of sgRNA in CRISPR/Cas9 method is 62-80 th and/or 303-321 st of sequence 1.

9. The maize bract-related protein of claim 1.

10. The substance for regulating the content or activity of said maize bract-related protein according to any one of claims 1 to 3.

Background

The corn machine grain collection is a great change of a planting mode, and is a key measure and development trend for realizing large-area high-yield and high-efficiency production of corn. However, the corn varieties popularized in China at present generally have the problems of too low seed dehydration speed and too high water content in the harvest period, and the industrialization process of corn combine harvesting is severely restricted. Factors influencing the water content of the mature period of the corn comprise the mature period of the variety, the bract character of the fruit cluster and the self dehydration rate of the grain in the later grain filling period; the bract character directly influences the dehydration of the fruit cluster and indirectly influences the water loss of the kernel, and is a key character which needs to be solved preferentially for high yield of the corn and suitable for machine harvesting and breeding.

The corn bract is a modified leaf which grows on the ear stalk node and is converted from a leaf sheath, is a nutrient storage organ of the fruit cluster, is also a protective organ of the fruit cluster on a corn plant, and provides a good development environment for the fruit cluster. First, the bracts maintain the appropriate temperature for grain development by wrapping around the ears [1 ]. Especially in the later growth period of corn, under the condition that harvest may be suffered from freeze injury, the bracts can prevent heat loss, and effectively reduce the freeze injury rate caused by temperature reduction [2 ]. Second, bracts can reduce maize reproduction inhibition due to water deficit from adverse environments [3 ]. Third, reasonable bract coverage and closeness can effectively reduce or eliminate aflatoxin contamination [4 ]. Fourthly, when the corn is harvested, the longer and compact bracts can prevent the disease and pest from entering the interior of the fruit cluster, thereby being beneficial to reducing or preventing the occurrence of the disease and pest [5, 6 ].

The corn ear belongs to a modified side stem, the ear stem is a shortened stem, and the bract is modified leaves which grow on the ear stem node and are converted from leaf sheaths. Ear stalks have nodes and shortened internodes which are differentiated, each node has a bud primordium, and finally, the bud primordium develops into the bud of the female ear. Thus, the number of bracts is consistent with the number of nodes of the ear stalk. When the bud leaf tip extends out of the leaf sheath of the ear part, the bud leaf area is rapidly increased, the process lasts until the silking period, and the leaves turn green, are tough and tightly packed with inflorescences. The ears are similar to the main stem, but all internodes are short, the uppermost node is shortest, the other nodes grow gradually, the first leaf grows out is the leaf on the most basal node, and the other leaves form the ear bract to surround and protect the top ear [7 ]. Thus, the internode length of the ear is closely related to the degree of the bract compactness. In the process of extending bracts, the expansion of leaf area is related to the elongation time and extension efficiency of bracts, and is also related to the composition of cell sap and cell walls [8 ].

The genetic rule of each phenotypic character of the corn bract determines the breeding improvement direction. In recent years, under the influence of high temperature and drought, the corn in Liaoning, Heilongjiang, Shanxi, Shandong and other places has the phenomenon of 'corn top exposure', the corn female ear bud is narrower than the cob, so that the grains are exposed outside, the grouting is influenced, and the yield is reduced; in addition, the narrow bract is easy to attract insect pests, such as the diabrotica sinensis biting the filaments and the chafer biting the seeds, which also causes the reduction of yield. Therefore, proper corn bract width also has an important role in the yield improvement of corn.

The basic requirements for variety collection of the corn combine are as follows: the growth period is short, and the later lodging resistance is strong; more importantly, the moisture content of the seeds in the mature period is low, and the dehydration rate is high. Early studies show that the morphological and structural characteristics of corn bracts are the most direct factors influencing the late dehydration rate of corn ears. Zuber et al (1950) suggested that the width of bracts is an important factor in the rate of dehydration of corn kernels (Zuber MS. Effefect of the Y-Y factor pair yield and other agricultural chemicals in corn. Ph. D. dis. Iowa state scales, 1950,50 (01-0245)). The total length and the total width of the bracts are decisive factors influencing the area of the bracts, wherein the correlation between the total width and the total area of the bracts is obviously larger than the correlation between the total length and the area of the bracts (Hedan, Wangxouquan, Liuchangming and the like, the correlation between several agronomic traits of the bracts of the corn and the genetic research thereof, the corn science, 2001, 9(1): 43-45). The dehydration rate is inversely related to the degree of coverage of the bracts (Cross HZ, Kabir KM. evaluation of field dry-down rates in early mail. crop Science,1989,29(1):54-58.), and determination of 9 inbred lines of corn and the hybridization combinations prepared by Yan Shuqin et al (2007) revealed that: the dehydration rate of bract, the dehydration rate of cob and the dehydration rate of kernel are positively correlated; the number of bracts is large, the area is large, the water content is high, and the dehydration rate of the corn kernel is slow (Yan Shuqin, Sujun, Lichunxian and the like, the correlation of corn kernel grouting and dehydration rate and the diameter analysis, Heilongjiang agricultural science, 2007 (4): 1-4.). Thus, the width of the corn bract is an important character for influencing the dehydration in the corn harvest period.

Disclosure of Invention

The technical problem to be solved by the invention is how to regulate the growth of the corn bract, especially how to regulate the width of the corn bract.

In order to solve the technical problems, the invention firstly provides application of corn bract-related protein or substances for regulating the content or activity of the corn bract-related protein in regulating the growth of corn bract, wherein the corn bract-related protein (named PCD2C) is A1), A2) or A3) as follows:

A1) the amino acid sequence is the protein of sequence 3;

A2) the protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence shown in the sequence 3 in the sequence table and has the same function;

A3) a fusion protein obtained by connecting a label to the N-terminal or/and the C-terminal of A1) or A2).

In order to facilitate the purification of the protein in A1), the amino terminal or the carboxyl terminal of the protein consisting of the amino acid sequence shown in the sequence 3 in the sequence table is attached with the tags shown in the following table.

Table: sequence of tags

The protein in A2) above is a protein having 75% or more identity to the amino acid sequence of the protein shown in SEQ ID NO. 3 and having the same function. The identity of 75% or more than 75% is 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity.

The protein of A2) above may be artificially synthesized, or may be obtained by synthesizing the coding gene and then performing biological expression.

The gene encoding the protein of A2) above can be obtained by deleting one or several amino acid residues from the DNA sequence shown in SEQ ID No. 2, and/or by carrying out missense mutation of one or several base pairs, and/or by attaching the coding sequence of the tag shown in the above table to the 5 'end and/or 3' end thereof. Wherein, the DNA molecule shown in the sequence 2 encodes PCD2C shown in the sequence 3.

In the above application, the substance may be any one of the following B1) to B9):

B1) a nucleic acid molecule encoding PCD 2C;

B2) an expression cassette comprising the nucleic acid molecule of B1);

B3) a recombinant vector containing the nucleic acid molecule of B1) or a recombinant vector containing the expression cassette of B2);

B4) a recombinant microorganism containing B1) the nucleic acid molecule, or a recombinant microorganism containing B2) the expression cassette, or a recombinant microorganism containing B3) the recombinant vector;

B5) a transgenic plant cell line comprising B1) the nucleic acid molecule or a transgenic plant cell line comprising B2) the expression cassette;

B6) transgenic plant tissue comprising the nucleic acid molecule of B1) or transgenic plant tissue comprising the expression cassette of B2);

B7) a transgenic plant organ containing the nucleic acid molecule of B1), or a transgenic plant organ containing the expression cassette of B2);

B8) a nucleic acid molecule that reduces PCD2C content or activity;

B9) an expression cassette, a recombinant vector, a recombinant microorganism, a transgenic plant cell line, a transgenic plant tissue or a transgenic plant organ comprising the nucleic acid molecule according to B8).

In the above application, the nucleic acid molecule of B1) may be any one of the following B11) -B15):

b11) the coding sequence is cDNA molecule or DNA molecule of sequence 2 in the sequence table;

b12) a cDNA molecule or a DNA molecule shown in a sequence 2 in a sequence table;

b13) DNA molecule shown in sequence 3 in the sequence table;

b14) a cDNA molecule or DNA molecule having 75% or more identity to the nucleotide sequence defined in b11) or b12) or b13) and encoding PCD 2C;

b15) hybridizes under stringent conditions to a nucleotide sequence defined by b11) or b12) or b13) or b14) and encodes a cDNA molecule or a DNA molecule of PCD 2C.

Wherein the nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.

The nucleotide sequence encoding the PCD2C protein of the present invention may be readily mutated by one of ordinary skill in the art using known methods, such as directed evolution and point mutation. Those nucleotides which have been artificially modified to have 75% or more identity to the nucleotide sequence of the PCD2C protein isolated according to the present invention are derived from the nucleotide sequence of the present invention and are identical to the sequence of the present invention as long as they encode the PCD2C protein and have the function of the PCD2C protein.

The term "identity" as used herein refers to sequence similarity to a native nucleic acid sequence. "identity" includes nucleotide sequences that are 75% or more, or 85% or more, or 90% or more, or 95% or more identical to the nucleotide sequence of a protein consisting of the amino acid sequence shown in coding sequence 3 of the present invention. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to assess the identity between related sequences.

In the above application, the stringent conditions may be as follows: at 50 ℃ in 7% of dodecyl sulfurSodium sulfate (SDS), 0.5M NaPO₄Hybridization with 1mM EDTA, rinsing in2 XSSC, 0.1% SDS at 50 ℃; also can be: 50 ℃ in 7% SDS, 0.5M NaPO₄Hybridization with 1mM EDTA, rinsing at 50 ℃ in 1 XSSC, 0.1% SDS; also can be: 50 ℃ in 7% SDS, 0.5M NaPO₄Hybridization with 1mM EDTA, rinsing in 0.5 XSSC, 0.1% SDS at 50 ℃; also can be: 50 ℃ in 7% SDS, 0.5M NaPO₄Hybridization with 1mM EDTA, rinsing in 0.1 XSSC, 0.1% SDS at 50 ℃; also can be: 50 ℃ in 7% SDS, 0.5M NaPO₄Hybridization with 1mM EDTA, rinsing in 0.1 XSSC, 0.1% SDS at 65 ℃; can also be: hybridization in a solution of 6 XSSC, 0.5% SDS at 65 ℃ followed by washing the membrane once with each of 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS; can also be: hybridization and washing of membranes 2 times, 5min each, at 68 ℃ in a solution of 2 XSSC, 0.1% SDS, and hybridization and washing of membranes 2 times, 15min each, at 68 ℃ in a solution of 0.5 XSSC, 0.1% SDS; can also be: 0.1 XSSPE (or 0.1 XSSC), 0.1% SDS at 65 ℃ and washing the membrane.

The above-mentioned identity of 75% or more may be 80%, 85%, 90% or 95% or more.

In the above applications, the expression cassette containing a nucleic acid molecule encoding PCD2C protein (PCD2C gene expression cassette) described in B2) refers to DNA capable of expressing PCD2C protein in a host cell, and the DNA may include not only a promoter that initiates transcription of PCD2C gene, but also a terminator that terminates transcription of PCD2C gene. Further, the expression cassette may also include an enhancer sequence. Promoters useful in the present invention include, but are not limited to: constitutive promoters, tissue, organ and development specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: the constitutive promoter of cauliflower mosaic virus 35S; the wound-inducible promoter from tomato, leucine aminopeptidase ("LAP", Chao et al (1999) Plant Physiol 120: 979-992); chemically inducible promoter from tobacco, pathogenesis-related 1(PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-carbothioic acid S-methyl ester)); tomato proteinEnzyme inhibitor II promoter (PIN2) or LAP promoter (both inducible with methyl jasmonate); heat shock promoters (U.S. patent 5,187,267); tetracycline-inducible promoters (U.S. Pat. No. 5,057,422); seed-specific promoters, such as the millet seed-specific promoter pF128(CN101063139B (Chinese patent 200710099169.7)), seed storage protein-specific promoters (e.g., the promoters of phaseolin, napin, oleosin, and soybean beta conglycin (Beachy et al (1985) EMBO J.4: 3047-3053)). They can be used alone or in combination with other plant promoters. All references cited herein are incorporated by reference in their entirety. Suitable transcription terminators include, but are not limited to: agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator and nopaline and octopine synthase terminators (see, e.g., Odell et al (I)⁹⁸⁵) Nature313: 810; rosenberg et al (1987) Gene,56: 125; guerineau et al (1991) mol.gen.genet,262: 141; proudfoot (1991) Cell,64: 671; sanfacon et al Genes Dev.,5: 141; mogen et al (1990) Plant Cell,2: 1261; munroe et al (1990) Gene,91: 151; ballad et al (1989) Nucleic Acids Res.17: 7891; joshi et al (1987) Nucleic Acid Res, 15: 9627).

The recombinant vector containing the PCD2C gene expression cassette can be constructed using existing expression vectors. The plant expression vector comprises a binary agrobacterium vector, a vector for plant microprojectile bombardment and the like. Such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, PSN1301, or pCAMBIA1391-Xb (CAMBIA Corp.), etc. The plant expression vector may also comprise the 3' untranslated region of the foreign gene, i.e., a region comprising a polyadenylation signal and any other DNA segments involved in mRNA processing or gene expression. The poly A signal can lead poly A to be added to the 3 'end of mRNA precursor, and the untranslated regions transcribed at the 3' end of Agrobacterium crown gall inducible (Ti) plasmid genes (such as nopaline synthase gene Nos) and plant genes (such as soybean storage protein gene) have similar functions. When the gene of the present invention is used to construct a plant expression vector, enhancers, including translational or transcriptional enhancers, may be used, and these enhancer regions may be ATG initiation codon or initiation codon of adjacent regions, etc., but must be in the same reading frame as the coding sequence to ensure correct translation of the entire sequence. The translational control signals and initiation codons are widely derived, either naturally or synthetically. The translation initiation region may be derived from a transcription initiation region or a structural gene. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector to be used may be processed, for example, by adding a gene encoding an enzyme or a luminescent compound capable of producing a color change (GUS gene, luciferase gene, etc.), a marker gene for antibiotics (e.g., nptII gene conferring resistance to kanamycin and related antibiotics, bar gene conferring resistance to phosphinothricin as an herbicide, hph gene conferring resistance to hygromycin as an antibiotic, dhfr gene conferring resistance to methotrexate, EPSPS gene conferring resistance to glyphosate) or a marker gene for chemical resistance (e.g., herbicide resistance), a mannose-6-phosphate isomerase gene providing the ability to metabolize mannose, which can be expressed in plants. From the safety of transgenic plants, the transgenic plants can be directly screened and transformed in a stress environment without adding any selective marker gene.

In the above application, the vector may be a plasmid, a cosmid, a phage, or a viral vector.

B8) The nucleic acid molecule can be sgRNA or a coding gene thereof of a crisper/cas9 system, which can reduce the content of PCD 2C. The target sequence of the sgRNA can be 62 th to 80 th of the sequence 1 and/or 303 th and 321 th.

B8) The nucleic acid molecule can be specifically a DNA fragment shown in the 439 th and 533 th positions and/or 1350 th and 1444 th positions of a sequence 5 in a sequence table or an sgRNA coded by the DNA fragment.

B9) The recombinant vector can be a recombinant vector which can reduce the content of PCD2C and is prepared by utilizing a crispr/cas9 system. The recombinant vector can be a vector containing one or two of the two DNA fragments shown in the 439-533 th position and 1350-1444 th position of the sequence 5 in the sequence table. In one embodiment of the invention, B9) the recombinant vector is pBUE411-PCD 2C.

In the above application, the microorganism may be yeast, bacteria, algae or fungi. Wherein the bacteria can be Agrobacterium, such as Agrobacterium EHA 105.

In the above application, the transgenic plant cell line, the transgenic plant tissue and the transgenic plant organ do not comprise propagation material.

The application of the PCD2C or the substance for regulating the content or activity of the PCD2C in regulating the width of corn bracts also belongs to the protection scope of the invention.

As used herein, the modulation of the corn bract may be the inhibition of corn bract growth. The regulating the width of the corn bract can be reducing the width of the corn bract.

The application of the PCD2C or the substance for regulating the content or the activity of the PCD2C in the cultivation of the corn with the reduced bract width also belongs to the protection scope of the invention.

The invention also provides the following methods of X1 or X2:

x1, a method of reducing corn bract width comprising: reducing the content of PCD2C in the receptor corn, or reducing the activity of PCD2C in the receptor corn, or inhibiting the expression of a PCD2C coding gene in the receptor corn, or knocking out the PCD2C coding gene in the receptor corn to obtain the target corn with the reduced bract width compared with the receptor corn, thereby realizing the reduction of the bract width of the corn;

x2, a method of growing corn with reduced bract width comprising: reducing the content of PCD2C in the receptor corn, or reducing the activity of PCD2C in the receptor corn, or inhibiting the expression of a PCD2C coding gene in the receptor corn, or knocking out the PCD2C coding gene in the receptor corn, so as to obtain the target corn with the bract width reduced compared with the receptor corn.

In the method, the PCD2C encoding gene in receptor corn is knocked out by a CRISPR/Cas9 method.

Wherein, the target sequence of sgRNA in CRISPR/Cas9 method can be 62-80 th position and/or 303-321 st position of sequence 1.

Specifically, knocking out the gene encoding PCD2C in recipient maize can be accomplished by introducing the nucleic acid molecule described in B8) above or the recombinant vector described in B9) above into recipient maize and by screening.

The recombinant vector can be introduced into Plant cells by using conventional biotechnological methods such as Ti plasmid, Plant virus vector, direct DNA transformation, microinjection, electroporation, etc. (Weissbach,1998, Method for Plant Molecular Biology VIII, academic Press, New York, pp.411-463; Geiserson and Corey,1998, Plant Molecular Biology (2nd Edition)) or transforming recipient maize.

The maize of interest is understood to include not only the first generation maize in which the PCD2C protein or the gene encoding it has been altered, but also progeny thereof. For maize of interest, the gene can be propagated in that species, and can also be transferred into other varieties of the same species, including particularly commercial varieties, using conventional breeding techniques. The corn of interest includes seeds, callus, whole plants and cells.

In one embodiment of the invention, the recipient maize is maize B104.

PCD2C also falls within the scope of the present invention.

The material for regulating the content or activity of the PCD2C also belongs to the protection scope of the invention.

The inventor creates a deletion mutant (CRISPR-PCD2c) of a corn PCD2C gene by a CRISPR-Cas9 gene knockout technology and a corn gene genetic transformation method, wherein a mutation site is positioned at a position 65bp-308bp downstream of an ATG (start codon) of a first exon protein coding start codon and is a protein coding missense mutation caused by deletion of 244 nucleotides (65 th-308 th positions of a sequence 1). Phenotypic statistics of the width of the corn bract are carried out on the criprpr-pcd 2c mutant and the wild type of the gene, and the result shows that compared with the wild type, the criprpr-pcd 2c mutant reduces the width of the corn bract by 16.58 percent, and the phenotype of the plant is not changed any more obviously. It is demonstrated that PCD2C and the gene encoding it can be used to regulate the growth of corn bracts.

Drawings

FIG. 1 shows the results of electrophoresis. Lane Marker is Direct-load Starmarker D2000 Plus from GenStar, a DNA Marker product; lane CK is wild type control maize B104 without transfer vector; lanes 1-15 are 15T strains₀Transgenic maize plants were generated, lanes 5 and 11, maize, identical to the wild type, were individuals with unsuccessful transgenes, lanes 1-4, 6-10,12-15 are all positive transgenic individuals.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents, instruments and the like used in the following examples are commercially available unless otherwise specified. In the following examples, unless otherwise specified, the 1 st position of each nucleotide sequence in the sequence listing is the 5 'terminal nucleotide of the corresponding DNA/RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA/RNA.

Examples 1,

The invention discloses a corn bract regulating gene derived from corn B73, which is named as PCD2C gene, wherein the genome sequence of the gene in B73 is sequence 1 in a sequence table, the CDS sequence is sequence 2, and PCD2C protein shown in a coding sequence 3. In sequence 1, the exon sequences are located at positions 1-93, 294-377, 626-717, 818-1113, 1191-1419, 1544-1748 and 2283-2378.

The PCD2C gene is located on chromosome 10, has a full length of 3049bp, has 7 exons and codes 364 amino acids. In the public database of the maize B73 genome (www.maizeGDB.org), sequence search was performed using the BLASTP program, and the PCD2C gene contained only one copy, with no other similar genes, on the B73 genome, for its full length.

The inventor creates a deletion mutant (CRISPR-PCD2c) of a corn PCD2C gene by a CRISPR-Cas9 gene knockout technology and a corn gene genetic transformation method, wherein a mutation site is positioned 65bp downstream of an ATG (initiation codon) of a first exon protein coding start and is a protein coding missense mutation caused by deletion of 244 nucleotides. Phenotypic statistics of the width of the corn bract are carried out on the criprpr-pcd 2c mutant and the wild type of the gene, and the result shows that compared with the wild type, the criprpr-pcd 2c mutant reduces the width of the corn bract by 16.58 percent, and the phenotype of the plant is not changed any more obviously. The specific experimental steps are as follows:

1) selection of sgRNA sequences

Two target site sequences are designed on the corn PCD2C gene, and the lengths of the target site sequences are respectively 19 bp.

Target site 1 is located at 62-80 th position of PCD2C gene sequence (Exon1), and the sequence of target site 1 is as follows: ACCACTACACCACTAAGAT are provided.

The target site 2 is located at 303-321 of PCD2C gene sequence (Exon2), and the sequence of the target site 2 is as follows: ACTGGTGATATGGGCTTCA are provided.

The sgRNA backbone sequence is as follows: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC, respectively;

the coding DNA sequence of the sgRNA backbone is as follows: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC are provided.

2) Construction of CRISPR/Cas9 vector

The DNA fragment MT1T2 containing the target sequence was prepared, and the sequence of MT1T2 is shown in SEQ ID No. 4.

The linear vector obtained by cutting MT1T2 with restriction enzyme BsaI-HF (neb) is linked to pBUE411 vector (pBUE411 vector is described in "Xing, h.l., Dong, l., Wang, z.p., Zhang, h.y., Han, c.y., Liu, b., Wang, x.c., and Chen, Q.J. (2014) a CRISPR/Cas9 toolkit for multiplex genome editing in plants bmc plant biology 14,327", which is publicly available from the university of agriculture and is used only for repeating experiments related to the present invention and is not used as PCD for other purposes), and the linear vector obtained by cutting with BsaI-HF is linked to obtain the correct recombinant vector Cas sequence 9 vector, which is referred to as pBUE 411-2C.

The partial sequence (the part connected with the double target sites and the MT1T2 sequence) of pBUE411-PCD2C is shown as a sequence 5, the 439-457 th position of the sequence 5 is the sequence of the target 1, the 1350-1368 th position is the sequence of the target 2, and the 458-533 th position and the 1369-1444 th position are the coding DNA sequences of the sgRNA framework.

3) Obtaining transgenic maize plants

Transferring the pBUE411-PCD2C obtained in the step 2) to agrobacterium competent cells EHA105 (Beijing Olsongding Biotech limited) by a liquid nitrogen freezing method to obtain recombinant bacteria EHA105/pBUE411-PCD 2C. Propagating the recombinant strain EHA105/pBUE411-PCD2C at 28 ℃, infecting maize B104 immature embryos with a bacterial solution obtained by propagation by adopting an agrobacterium infection method, and screening, differentiating and rooting to obtain T0 generation transgenic maize plants. Specific methods are referenced in the following documents: weixiayu, Shaoshidi, Sunsu and the like, establishment of an agrobacterium-mediated maize immature embryo genetic transformation system, proceedings of Jilin agriculture university, 2017(06) 640-; xylonite, defensin, agrobacterium mediated genetic transformation of maize [ J ], experimental biology report, 1999 (04).

Among them, corn B104 is described in "Char, s.n., Neelakandan, a.k., Nahampun, h., Frame, b., Main, m., Spalding, m.h., Becraft, p.w., Meyers, b.c., Walbot, v., Wang, k.ang, Yang, b. (2016), An Agrobacterium-delayed CRISPR/Cas9 system for high-frequency targeted mutagenesis in Main, plant biotechnology journel, 15(2), 257-268".

4) Identification of transgenic maize plants

Collecting T0 transgenic maize plant leaves, extracting genome DNA as a template, and carrying out PCR amplification by using a left primer of criprpr-pcd 2c-F and a right primer of criprpr-pcd 2c-R to obtain PCR amplification products of different strains. The primer sequences are as follows:

left primer criprpr-pcd 2 c-F: TGGCTGAGCCTTCCCTTTGC, respectively;

right primer criprpr-pcd 2 c-R: TGCCATCACGGATCTGTTCG are provided.

The PCR products were subjected to agarose gel electrophoresis, and the results are shown in FIG. 1.

And performing Sanger sequencing on PCR amplification products of different strains, comparing a sequencing result with the PCD2C gene of wild corn B104, and identifying whether the PCD2C gene of different strains of T0 generation transgenic corn is mutated.

Since maize is a diploid plant, when Cas9 functions to begin to cut a particular gene, both alleles on both homologous chromosomes in the same cell are likely to be edited, producing the same type or different types of mutations, so both alleles in one plant are considered to be two gene editing events. Homozygous mutant refers to the plant having the same mutation in the PCD2C genes of two homologous chromosomes. The biallelic mutant refers to the plant with PCD2C gene of two homologous chromosomes mutated but in different mutation forms. Heterozygous mutant refers to the plant with a mutation in the PCD2C gene of one of the two homologous chromosomes and no mutation in the PCD2C gene of the other homologous chromosome. Wild type means that the PCD2C gene was not mutated in both homologous chromosomes of the plant. Homozygous and biallelic mutations are designated as mutants.

The identification result shows that: 15 strains of T₀Co-detection of T in transgenic maize plants₀Generation positive transgenic corn plant 13, wherein the number of homozygous mutant strains is 4. The plant with the PCD2C gene mutation is the positive T₀Transgenic maize was generated, and the plant with deletion mutation of PCD2C gene was designated as deletion mutant of PCD2C gene (criprpr-PCD 2 c).

The mutation site of a deletion mutant (crispr-PCD2c) of PCD2C gene is located at 65bp downstream of the ATG (start codon) of the first exon protein code, the mutation site is a missense mutation of protein code caused by deletion of 244 nucleotides, a specific deletion fragment is a DNA fragment shown in the 65 th-308 th position of sequence 1, and the deletion mutant (crispr-PCD2c) is a homozygous mutant.

Compared with the wild-type maize B104, the deletion mutant (criprpr-PCD 2c) is obtained by deleting the 481-802 th position of the PCD2C gene sequence in the wild-type maize B104 genome and keeping other sequences unchanged. The deletion sequences are as follows:

ACTACACCACTAAGATCGGTGGAGTCCCTGTATGTGTTTCCTGTGTAGCTCTTCCTGGTTCTAGCTTATGTCATGCACGTTATTCAGTTAACCCACCCATGATTATACATTTTACTCGATGACTCTTCTCGGAGGTCAGAGATTTTTCTGAGGGATCATAAGCAATGGGGCATCAGTAGTTGAAGGCCGAGCTCTTTTTGAGTCGTTTGCTGTTTTTTTTATTATGTAGGATTGGCCAACTGGT。

5) phenotypic analysis of the Crispr-pcd2c mutant

The width of the bracts of the deletion mutant (criprpr-pcd 2c) and the wild type (maize B104) was measured, and the experiment was repeated three times to obtain an average value, and the steps of each repetition were as follows: after the corn kernels are completely mature and at the same time before harvesting, the length and the width of the bracts are investigated in the field, the third bracts of the corn ears are selected from the outside to the inside, and the length (the length of the bracts refers to the length from the base parts of the bracts to the tops of the bracts, and the flag leaves at the topmost parts) and the width (the width refers to the fully unfolded width of the bracts at the half positions of the length of the bracts) of the bracts are measured by a soft rope ruler. The number of the corn plants to be measured is 50 in each measurement, and the measurement results are averaged.

The results show that: the deletion mutant (crispr-pcd2c) has the width of the 3 rd bract from outside to inside of 8.45 +/-0.01 cm, the width of the 3 rd bract from outside to inside of 10.13 +/-0.01 cm of corn B104 is obviously different from the deletion mutant, and the width of the corn bract of the deletion mutant (crispr-pcd2c) is reduced by 16.58%; the deletion mutant (criprpr-pcd 2c) has the 3 rd bract length of 22.00 +/-0.01 cm from outside to inside and the 3 rd bract length of 22.81 +/-0.01 cm from outside to inside of the corn B104, and has no obvious difference compared with the mutant B104. In addition, the plant deletion mutant (criprpr-pcd 2c) and the corn B104 have no any significant changes in plant height, leaf width and leaf length on the ear, leaf sheath width and leaf sheath length and bract number.

Phenotype statistics of the transgenic knockout mutant show that PCD2C can regulate and control establishment of corn bract width.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Reference documents:

【1】 Song phoenix bin, Xuhong culture, research on the photosynthetic physiological characteristics of corn bracts, corn science, 2008,16(4): 31-34.

【2】Rossen EC.Freezing injury of maize seed.Plant Physiology,1949,629-654。

【3】Westgate ME,Debral L,Thomson G.Water deficit and reproduction in maize.Plant Physiology,1989,91:862-867。

【4】Betran FJ,Isakeit T.Aflatoxin accumulation in maize hybrids of different maturities.American Society of Agronomy,2004,96:565-570。

【5】Widstrom NW,Butron A,Guo B Z,et al.Control of preharvest afatoxin contamination in maize by pyramiding QTL involved in resistance to ear-feeding insects and invasion by Aspergillus spp.European Journal of Agronomy,2003,19:563-572。

【6】Cao A,Santiago R,Ramos AJ,et al.Critical environmental and genotypic factors for Fusarium verticillioides infection,fungal growth and fumonisin contamination in maize grown in northwestern.Spain.Int.J.Food Microbiol,2014,177:63-71。

【7】 Subpurva, progress in the development of maize ears and bracts Anhui agronomy report, 2007, (14): 78-79.

【8】 The research on the photosynthetic physiological characteristics of corn bracts, the science of corn, 2008,

(04):31-34。

【9】Cui Z,Luo J,Qi C,et al.Genome-wide association study(GWAS)reveals the genetic architecture of four husk traits in maize.BMC genomics,2016,17(1):946。

<110> university of agriculture in China

<120> protein for regulating and controlling corn bract, related biological material and application thereof

<160> 5

<170> PatentIn version 3.5

<210> 1

<211> 2633

<212> DNA

<213> corn (Zea mays L.)

<400> 1

atggcggagg tgcatctagg tctgccaggt ccctgggcgg cggattacag ggagatggcc 60

gaccactaca ccactaagat cggtggagtc cctgtatgtg tttcctgtgt agctcttcct 120

ggttctagct tatgtcatgc acgttattca gttaacccac ccatgattat acattttact 180

cgatgactct tctcggaggt cagagatttt tctgagggat cataagcaat ggggcatcag 240

tagttgaagg ccgagctctt tttgagtcgt ttgctgtttt ttttattatg taggattggc 300

caactggtga tatgggcttc aagcccgaga ctcttcagtg cagcttatgt gggaccaagc 360

tttgtcttgt tgctcaggta aatgtcttcg tgtcgttgat taagcaagaa tttactagtt 420

gaaaaacatc tttatggtca gtcatgtaag gaaacggagt gttgcagtgc ttgggcacag 480

gcttgtaaag ttacaagctt gcagttctct gacttagcat tacgaactat gtttacgaac 540

agatccgtga tggcacaaaa cgcttgtatg ttgatgaatc aatgtcgttc cttgtaaaaa 600

aaaactaatg tggttcggac ttaaggtaca tgcgcctgtg gcaaagctaa acattgagga 660

gaggataatc tatgtgcttg tttgcccgac accagaatgt ggacctaaac ctcaaaggca 720

agtatatgcc aattgattca atctttttat tagatatcca gacattttta catgatttta 780

agtcagtacc tttttgttcc tttttcttct tatatagttg gaaggttcta agagttcaaa 840

aatgccataa tgttatgcaa acagaaggtg gtggtgatga attaggtcaa ccgaatggac 900

cttcttctac aagtcttcca gaagaacaga atgataaaaa taaaattcct gagacaaatg 960

atgacgattt tgatctagat gccttagccg aagcacttga acaagctgca actttggcat 1020

caaactcaaa gaagaagaac aaatcgaagc atgctaatgc tcctgtaaaa cgtcctgtat 1080

tgaaggagca agcatgtgat ctgagcatac ctggtgagga caactttgaa acaactcgtt 1140

accatgtatg caaaacccga gtgttttgat ctgataaaat tttgttgcag tccttccttg 1200

tttttacata cattataata aggaactata tgggggcaaa ggcgctgtgg gttcaagtag 1260

cagtgagttg gttttggaca aagaaatcat ggatgccgca aatgacgaag aagaaaaatg 1320

ggaaggagaa aagtatgagt acgatagagc tattggtgct gacagaactt ttttaaaatt 1380

caagaaacgg ctggatgcat atccccagca atgctttagg tagctaaaca tttagtttac 1440

atagtatcat tgcaacctga cttggtattt gcaaaccatt tgtttcttgt cccttttggt 1500

ttgcacagcc tgaattaaat tttggcttgc aatatttctt taggtattct tatggtggca 1560

agccactgtt ggctacaaca aaattacaag atcctggcac ctgtaggctg tgtggttcac 1620

cacgccagta tgaactgcaa ttgatgtctc ctttatcata ctttctccat gaagctggag 1680

acggttcctc aaattatgca cccagcagct ggacttggct gactgttata atatacacct 1740

gccccaaggt atgtcttttc ttcaatttcc tgatacggta gtgtaagaaa ttccgagtgc 1800

ccgaaacatt attcctggat agtagttcat ttgaaaaacc atttgatcta caaagtacac 1860

catgaagaac agtataccat caaagcatca cttgagcttt gtttggtgaa gagatttctg 1920

cgtccttgat gttctcaatg tacttcagaa ttcctagcag acaaggatgc taggttgtct 1980

gaaacatcta ccaggattta atccagtcta caaagtagac ttccaatggc actattttct 2040

tagacaaaca aatttctggt ctgtgggttt cgccagattc catcttgtcc cttgggaact 2100

ttgttagtta tccttgtcac ggcaatcttg aaagctcagt gggctgctac atgcacgtag 2160

ttgtcattgt ttaatatttc ttcttcctgg taccggggtg aaaccagaca ttgttcattg 2220

tgttcttttg tttacagttc tcctctctgc actattcctt agcctgtatc aatttactgc 2280

agagctgctg cccgtcctca tgcggtggaa agccccagag ctgttgttgg ggagcagcgg 2340

aggaggagat cctgattcag gaggatgaag tcctttagga tctaaccagt gctggttgag 2400

aaactattcc cgatttgaac atgtaatatg cagttttttt ttgttctcca atggttagag 2460

ttgtaaagct atctgaaatt ttgaagtgtg ttttgttatt gtgccctggt atactgcaga 2520

actgtcatac ttcacacagt atcatatcag actagtaaga tttttttttc tttgtggctg 2580

ttgttttccg ctgcaaaatc atttttttct aggtgcctgg attgtcaact cca 2633

<210> 2

<211> 1095

<212> DNA

<213> corn (Zea mays L.)

<400> 2

atggcggagg tgcatctagg tctgccaggt ccctgggcgg cggattacag ggagatggcc 60

gaccactaca ccactaagat cggtggagtc cctgattggc caactggtga tatgggcttc 120

aagcccgaga ctcttcagtg cagcttatgt gggaccaagc tttgtcttgt tgctcaggta 180

catgcgcctg tggcaaagct aaacattgag gagaggataa tctatgtgct tgtttgcccg 240

acaccagaat gtggacctaa acctcaaagt tggaaggttc taagagttca aaaatgccat 300

aatgttatgc aaacagaagg tggtggtgat gaattaggtc aaccgaatgg accttcttct 360

acaagtcttc cagaagaaca gaatgataaa aataaaattc ctgagacaaa tgatgacgat 420

tttgatctag atgccttagc cgaagcactt gaacaagctg caactttggc atcaaactca 480

aagaagaaga acaaatcgaa gcatgctaat gctcctgtaa aacgtcctgt attgaaggag 540

caagcatgtg atctgagcat acctgtcctt ccttgttttt acatacatta taataaggaa 600

ctatatgggg gcaaaggcgc tgtgggttca agtagcagtg agttggtttt ggacaaagaa 660

atcatggatg ccgcaaatga cgaagaagaa aaatgggaag gagaaaagta tgagtacgat 720

agagctattg gtgctgacag aactttttta aaattcaaga aacggctgga tgcatatccc 780

cagcaatgct ttaggtattc ttatggtggc aagccactgt tggctacaac aaaattacaa 840

gatcctggca cctgtaggct gtgtggttca ccacgccagt atgaactgca attgatgtct 900

cctttatcat actttctcca tgaagctgga gacggttcct caaattatgc acccagcagc 960

tggacttggc tgactgttat aatatacacc tgccccaaga gctgctgccc gtcctcatgc 1020

ggtggaaagc cccagagctg ttgttgggga gcagcggagg aggagatcct gattcaggag 1080

gatgaagtcc tttag 1095

<210> 3

<211> 364

<212> PRT

<213> corn (Zea mays L.)

<400> 3

Met Ala Glu Val His Leu Gly Leu Pro Gly Pro Trp Ala Ala Asp Tyr

1 5 10 15

Arg Glu Met Ala Asp His Tyr Thr Thr Lys Ile Gly Gly Val Pro Asp

20 25 30

Trp Pro Thr Gly Asp Met Gly Phe Lys Pro Glu Thr Leu Gln Cys Ser

35 40 45

Leu Cys Gly Thr Lys Leu Cys Leu Val Ala Gln Val His Ala Pro Val

50 55 60

Ala Lys Leu Asn Ile Glu Glu Arg Ile Ile Tyr Val Leu Val Cys Pro

65 70 75 80

Thr Pro Glu Cys Gly Pro Lys Pro Gln Ser Trp Lys Val Leu Arg Val

85 90 95

Gln Lys Cys His Asn Val Met Gln Thr Glu Gly Gly Gly Asp Glu Leu

100 105 110

Gly Gln Pro Asn Gly Pro Ser Ser Thr Ser Leu Pro Glu Glu Gln Asn

115 120 125

Asp Lys Asn Lys Ile Pro Glu Thr Asn Asp Asp Asp Phe Asp Leu Asp

130 135 140

Ala Leu Ala Glu Ala Leu Glu Gln Ala Ala Thr Leu Ala Ser Asn Ser

145 150 155 160

Lys Lys Lys Asn Lys Ser Lys His Ala Asn Ala Pro Val Lys Arg Pro

165 170 175

Val Leu Lys Glu Gln Ala Cys Asp Leu Ser Ile Pro Val Leu Pro Cys

180 185 190

Phe Tyr Ile His Tyr Asn Lys Glu Leu Tyr Gly Gly Lys Gly Ala Val

195 200 205

Gly Ser Ser Ser Ser Glu Leu Val Leu Asp Lys Glu Ile Met Asp Ala

210 215 220

Ala Asn Asp Glu Glu Glu Lys Trp Glu Gly Glu Lys Tyr Glu Tyr Asp

225 230 235 240

Arg Ala Ile Gly Ala Asp Arg Thr Phe Leu Lys Phe Lys Lys Arg Leu

245 250 255

Asp Ala Tyr Pro Gln Gln Cys Phe Arg Tyr Ser Tyr Gly Gly Lys Pro

260 265 270

Leu Leu Ala Thr Thr Lys Leu Gln Asp Pro Gly Thr Cys Arg Leu Cys

275 280 285

Gly Ser Pro Arg Gln Tyr Glu Leu Gln Leu Met Ser Pro Leu Ser Tyr

290 295 300

Phe Leu His Glu Ala Gly Asp Gly Ser Ser Asn Tyr Ala Pro Ser Ser

305 310 315 320

Trp Thr Trp Leu Thr Val Ile Ile Tyr Thr Cys Pro Lys Ser Cys Cys

325 330 335

Pro Ser Ser Cys Gly Gly Lys Pro Gln Ser Cys Cys Trp Gly Ala Ala

340 345 350

Glu Glu Glu Ile Leu Ile Gln Glu Asp Glu Val Leu

355 360

<210> 4

<211> 964

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 4

atatatggtc tctggcgatc ttagtggtgt agtggtgttt tagagctaga aatagcaagt 60

taaaataagg ctagtccgtt atcaacttga aaaagtggca ccgagtcggt gctttttttt 120

ttcgttttgc attgagtttt ctccgtcgca tgtttgcagt tttattttcc gttttgcatt 180

gaaatttctc cgtctcatgt ttgcagcgtg ttcaaaaagt acgcagctgt atttcactta 240

tttacggcgc cacattttca tgccgtttgt gccaactatc ccgagctagt gaatacagct 300

tggcttcaca caacactggt gacccgctga cctgctcgta cctcgtaccg tcgtacggca 360

cagcatttgg aattaaaggg tgtgatcgat actgcttgct gctcatgaat ccaaaccaca 420

cggagttcaa attcccacag attaaggctc gtccgtcgca caaggtaatg tgtgaatatt 480

atatctgtcg tgcaaaattg cctggcctgc acaattgctg ttatagttgg cggcagggag 540

agttttaaca ttgactagcg tgctgataat ttgtgagaaa taataattga caagtagata 600

ctgacatttg agaagagctt ctgaactgtt attagtaaca aaaatggaaa gctgatgcac 660

ggaaaaagga aagaaaaagc catacttttt tttaggtagg aaaagaaaaa gccatacgag 720

actgatgtct ctcagatggg ccgggatctg tctatctagc aggcagcagc ccaccaacct 780

cacgggccag caattacgag tccttctaaa agctcccgcc gaggggcgct ggcgctgctg 840

tgcagcagca cgtctaacat tagtcccacc tcgccagttt acagggagca gaaccagctt 900

ataagcggag gcgcggcacc aagaagcgtg aagcccatat caccagtgtt tagagaccaa 960

taat 964

<210> 5

<211> 1735

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 5

agtaattcat ccaggtctcc aagttctagg attttcagaa ctgcaactta ttttatcaag 60

gaatctttaa acatacgaac agatcactta aagttcttct gaagcaactt aaagttatca 120

ggcatgcatg gatcttggag gaatcagatg tgcagtcagg gaccatagca caagacaggc 180

gtcttctact ggtgctacca gcaaatgctg gaagccggga acactgggta cgttggaaac 240

cacgtgatgt gaagaagtaa gataaactgt aggagaaaag catttcgtag tgggccatga 300

agcctttcag gacatgtatt gcagtatggg ccggcccatt acgcaattgg acgacaacaa 360

agactagtat tagtaccacc tcggctatcc acatagatca aagctgattt aaaagagttg 420

tgcagatgat ccgtggcgat cttagtggtg tagtggtgtt ttagagctag aaatagcaag 480

ttaaaataag gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttt 540

tttcgttttg cattgagttt tctccgtcgc atgtttgcag ttttattttc cgttttgcat 600

tgaaatttct ccgtctcatg tttgcagcgt gttcaaaaag tacgcagctg tatttcactt 660

atttacggcg ccacattttc atgccgtttg tgccaactat cccgagctag tgaatacagc 720

ttggcttcac acaacactgg tgacccgctg acctgctcgt acctcgtacc gtcgtacggc 780

acagcatttg gaattaaagg gtgtgatcga tactgcttgc tgctcatgaa tccaaaccac 840

acggagttca aattcccaca gattaaggct cgtccgtcgc acaaggtaat gtgtgaatat 900

tatatctgtc gtgcaaaatt gcctggcctg cacaattgct gttatagttg gcggcaggga 960

gagttttaac attgactagc gtgctgataa tttgtgagaa ataataattg acaagtagat 1020

actgacattt gagaagagct tctgaactgt tattagtaac aaaaatggaa agctgatgca 1080

cggaaaaagg aaagaaaaag ccatactttt ttttaggtag gaaaagaaaa agccatacga 1140

gactgatgtc tctcagatgg gccgggatct gtctatctag caggcagcag cccaccaacc 1200

tcacgggcca gcaattacga gtccttctaa aagctcccgc cgaggggcgc tggcgctgct 1260

gtgcagcagc acgtctaaca ttagtcccac ctcgccagtt tacagggagc agaaccagct 1320

tataagcgga ggcgcggcac caagaagcgt gaagcccata tcaccagtgt tttagagcta 1380

gaaatagcaa gttaaaataa ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg 1440

gtgctttttt ttttcgtttt gcattgagtt ttctccgtcg catgtttgca gttttatttt 1500

ccgttttgca ttgaaatttc tccgtctcat gtttgcagcg tgttcaaaaa gtacgcagct 1560

gtatttcact tatttacggc gccacatttt catgccgttt gtgccaacta tcccgagcta 1620

gtgaatacag cttggcttca cacaacactg gtgacccgct gacctgctcg tacctcgtac 1680

cgtcgtacgg cacagcattt ggaattaaag ggtgtgatcg atactgcttg ctgct 1735