L-threonine transport protein and coding gene and application thereof
1. A protein, wherein the protein is (a) or (b) below:
(a) comprises the amino acid sequence shown in SEQ ID NO: 1;
(b) converting SEQ ID NO: 1 by substitution and/or deletion and/or addition of one or several amino acid residues and is associated with L-threonine transport and consists of SEQ ID NO: 1, or a derivative thereof.
2. A gene encoding the protein of claim 1.
3. The gene of claim 2, wherein the gene is a DNA molecule according to any one of the following 1) to 3):
1) the coding region is shown as SEQ ID NO: 2;
2) a DNA molecule which hybridizes with the DNA sequence defined in 1) under strict conditions and codes L-threonine transport related protein;
3) a DNA molecule which has more than 90 percent of homology with the DNA sequence limited by 1) and codes the protein related to the L-threonine transport.
4. A recombinant expression vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the gene of claim 2 or 3, wherein the recombinant expression vector comprises a pXMJ19 vector, a pDXW-series vector, a pET-series vector and a pPICZ-series vector; the host of the transgenic cell comprises escherichia coli, corynebacterium, bacillus, yeast or filamentous fungi, and preferably, the host of the transgenic cell is corynebacterium glutamicum C.
5. Use of the protein of claim 1 in the pharmaceutical, food or cosmetic field, characterized by being at least one of the following (c1) to (c 7):
(c1) as an L-threonine transporter;
(c2) promoting the transport of L-threonine;
(c3) promoting the transport of L-threonine to the outside of the microorganism;
(c4) promoting the transport of L-threonine to the outside of the bacterium;
(c5) promoting transport of L-threonine to Corynebacterium glutamicum in vitro, including Corynebacterium glutamicum C.glutamicum SYPS-062-33 a;
(c7) producing L-threonine.
6. A recombinant microorganism obtained by introducing the gene of claim 2 or 3 into a target microorganism and overexpressing the gene.
7. Use of the recombinant microorganism of claim 6 for the production of L-threonine.
8. A method for producing L-threonine, comprising the steps of: fermenting the recombinant microorganism of claim 6, wherein L-threonine is obtained from the fermentation supernatant.
9. A kit for producing L-threonine, comprising the recombinant microorganism according to claim 6.
10. A recombinant bacterium obtained by silencing a gene encoding the protein of claim 1 in a genome of a target bacterium.
Background
Corynebacterium glutamicum is a food-and drug-safe strain and is widely used in the production of amino acids, such as L-glutamic acid, L-lysine, L-valine, and the like. L-threonine is one of 8 essential amino acids, and is widely applied to the industries of food, feed, medicine and cosmetics. In the field of food, L-threonine can be used as one of ingredients of nutritional health food and has an antioxidant effect; can also be used as nutrient substance to be added into feed for promoting growth of livestock; in the field of medicine, L-threonine can promote the growth and development of human bodies and can also be used as a medicine intermediate; in cosmetics, L-threonine can be used as a moisturizing agent.
The production method of L-threonine mainly comprises a protein hydrolysis method, a chemical synthesis method and a direct fermentation method, wherein the protein hydrolysis method and the chemical synthesis method have the defects of low efficiency and more required raw materials, and the two methods are rarely used for industrialization. At present, the direct fermentation method is mainly used for production, and has the advantages of low cost, resource saving, small environmental pollution and the like. The studies of L-threonine production by fermentation of Corynebacterium glutamicum at home and abroad have focused on Molecular engineering via synthetic and degradative pathways, Diesveld et al have increased L-threonine production from 0.9g/L to 3.7g/L by heterologous expression of rhtC gene from Escherichia coli in C.glutamicum DM368-3(AECr, AHVr) using plasmid vectors, and have decreased the by-product glycine production from 1.1g/L to 0.15g/L (cited in the literature: Diesveld R, Tietz N, Furst O, et al. Activity of exporters of Escherichia coli in Corynebacterium glutamicum, and the family of microorganisms to serine production [ J ]. 198, and the family of microorganisms to microbial technology, 2009, homoserine 16 (3-4): 198) and aspartate kinase activities via the Zygosaponin pathway, the L-threonine yield is improved to 4.14g/L (cited in the literature: Zhang Jun Sheng, Wang Yang, Yang Xiao Zhi, etc.. the relationship between the key enzyme activity of Corynebacterium glutamicum and threonine high yield [ J ]. Hunan agricultural science, 2011 (09): 31-33+ 68.).
The inventor selects a wild Corynebacterium glutamicum SYPS-062 which can utilize sugar raw materials to ferment and accumulate L-threonine from the nature in advance, and obtains a mutant strain C.glutamicum SYPS-062-33a (abbreviated as 33a) by taking the wild Corynebacterium glutamicum SYPS-062 as an initial strain and performing multiple rounds of chemical mutagenesis, wherein the accumulation amount of L-threonine reaches 1.9 g/L. Since the production of L-threonine by Corynebacterium glutamicum has not been improved in a breakthrough manner in the last 20 years, the production of L-threonine in Corynebacterium glutamicum and the sugar-acid conversion rate during fermentation are much lower than those of Escherichia coli, and the ability of Corynebacterium glutamicum to produce L-threonine is still involved in the excavation process. Although the modification of the metabolic pathway of the strain is important for the fermentative production of amino acids by the strain, the transport of amino acids out of the cell after intracellular metabolism is also important. In recent decades, in Corynebacterium glutamicum and Escherichia coli, many amino acids have been identified to transport extracellular proteins and used for improving the production of amino acids using metabolic engineering, such as lysine transporter LysE, threonine transporter ThrE, cysteine transporter Eama, methionine transporter BrnFE, etc., but only threonine transporter ThrE has been reported to transport threonine, and thus the study of L-threonine transporter in Corynebacterium glutamicum has important significance for improving the production of L-threonine.
Disclosure of Invention
The technical problem is as follows: in order to overcome the defects in the prior art, the invention provides an L-threonine transporter, a coding gene and application thereof, and provides a function of transferring L-threonine by an NCgl0580 sequence in corynebacterium glutamicum on the basis of researching the amino acid transporter.
The technical scheme is as follows: in order to achieve the purpose, the invention adopts the technical scheme that:
the first object of the present invention is to provide a protein which is (a) or (b) below:
(a) comprises the amino acid sequence shown in SEQ ID NO: 1;
(b) converting SEQ ID NO: 1 by substitution and/or deletion and/or addition of one or several amino acid residues and is associated with L-threonine transport and consists of SEQ ID NO: 1, or a derivative thereof. .
It is a second object of the present invention to provide a gene encoding the above protein.
In one embodiment of the present invention, the gene is a DNA molecule as described in any one of the following 1) to 3):
1) the coding region is shown as SEQ ID NO: 2;
2) a DNA molecule which hybridizes with the DNA sequence defined in 1) under strict conditions and codes L-threonine transport related protein; the stringent conditions can be hybridization with a solution of 0.1 XSSPE (or 0.1 XSSC), 0.1% SDS at 65 ℃ in DNA or RNA hybridization experiments and washing of the membrane;
3) a DNA molecule which has more than 90 percent of homology with the DNA sequence limited by 1) and codes the protein related to the L-threonine transport.
The third purpose of the invention is to provide a recombinant expression vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the gene.
In one embodiment of the present invention, the recombinant expression vector includes, but is not limited to, pXMJ19 vector, pDXW series vector, pET series vector, and pPICZ series vector.
In one embodiment of the present invention, the host of the transgenic cell includes, but is not limited to, Escherichia coli, Corynebacterium, Bacillus, yeast, or filamentous fungi.
In one embodiment of the present invention, the host of the transgenic cell is preferably C.glutamicum SYPS-062-33 a. The Corynebacterium glutamicum SYPS-062-33a (hereinafter, referred to as 33a) is disclosed in the literature: comparative genomics analysis of L-serine-producing Corynebacterium glutamicum, Guo Wen, university of south Jiangnan, 2016.
The fourth purpose of the present invention is to provide the use of the protein in the fields of pharmacy, food or cosmetics, specifically at least one of the following (c1) to (c 6):
(c1) as an L-threonine transporter;
(c2) promoting the transport of L-threonine;
(c3) promoting the transport of L-threonine to the outside of the microorganism;
(c4) promoting the transport of L-threonine to the outside of the bacterium;
(c5) promoting transport of L-threonine to Corynebacterium glutamicum in vitro, including Corynebacterium glutamicum C.glutamicum SYPS-062-33 a;
(c6) producing L-threonine.
It is a fifth object of the present invention to provide a recombinant microorganism obtained by introducing the above gene into a microorganism of interest and overexpressing the same.
It is a sixth object of the present invention to provide use of the above recombinant microorganism for the production of L-threonine.
It is a seventh object of the present invention to provide a method for producing L-threonine, the method comprising the steps of: fermenting the recombinant microorganism to obtain L-threonine from the fermentation supernatant.
In one embodiment of the present invention, the method for producing L-threonine comprises overexpressing the L-threonine transporter NCgl0580 in Corynebacterium glutamicum 33a to obtain a genetically engineered bacterium overexpressing the threonine transporter NCgl0580, and fermenting with the genetically engineered bacterium.
In one embodiment of the invention, the fermentation medium comprises 90-110g/L of sucrose, 20-40g/L of ammonium sulfate, 50-70g/L of calcium carbonate and MgSO4·7H2O 0.5-1g/L，FeSO4·7H2O 0.01-0.05g/L，MnSO4·H20.01-0.05g/L of O, 20-40mg/L of protocatechuic acid, 40-60 mu g/L of biotin and 500 mu g/L of thiamine 400-ketone.
In one embodiment of the present invention, the fermentation is performed at 28-32 deg.C and 100-140rpm for 60-150 h.
An eighth object of the present invention is to provide a kit for producing L-threonine, which comprises the above recombinant microorganism.
The ninth object of the present invention is to provide a recombinant bacterium obtained by silencing a gene encoding the above protein in the genome of a target bacterium.
Has the advantages that: compared with the prior art, the L-threonine transport protein and the coding gene and the application thereof provided by the invention have the following advantages:
the transport plays an important role in the process of high yield of amino acid by the metabolic engineering strain. To date, a variety of amino acid transporters have been found in Corynebacterium glutamicum, but only the threonine transporter ThrE has been reported to transport L-threonine. The present invention provides a novel L-threonine transporter NCgl0580, which has the amino acid sequence of SEQ ID NO: 1, the total length is 903 nucleotides, and the code is 301 amino acids. By means of genetic engineering, the NCgl0580 is over-expressed in the Corynebacterium glutamicum 33a producing L-threonine, and the yield of L-threonine can be improved to 2.3 g/L. The method provides a new idea for improving the L-threonine yield by metabolically engineering the strain.
Drawings
FIG. 1 is the evaluation of the fermentation characteristics of thrE knockout and enhanced expression recombinant bacteria, wherein A: knocking out recombinant bacteria 33a delta thrE; b: the recombinant bacterium 33a-thrE is over-expressed.
FIG. 2 is the evaluation of fermentation characteristics of NCgl0580 knockout and overexpression recombinant bacteria, wherein A: knocking out recombinant bacteria 33a delta NCgl 0580; b: the recombinant bacterium 33a-NCgl0580 is overexpressed.
FIG. 3 is a functional test of L-threonine transport by NCgl 0580.
FIG. 4 shows the L-threonine accumulation of the recombinant bacterium 33a-NCgl0254, wherein A: knocking out the L-threonine accumulation of the recombinant bacteria 33 a-delta NCgl 0254; b: over-expressing the L-threonine accumulation of the recombinant bacterium 33a-NCgl 0254.
Detailed Description
The invention is further described with reference to the following figures and examples.
The present invention will be better understood from the following examples. However, those skilled in the art will readily appreciate that the specific material ratios, process conditions and results thereof described in the examples are illustrative only and should not be taken as limiting the invention as detailed in the claims.
(I) culture Medium
Seed culture medium: 37g/L of brain-heart infusion; 20g/L of glucose; (NH)4)2SO4 10g/L；MgSO4·7H2O 0.5g/L；K2HPO4 0.2g/L；NaH2PO4 0.3g/L。
CGX II minimal medium: glucose 40g/L, Urea 5g/L, (NH)4)2SO4 20g/L，KH2PO4 1g/L，MgSO40.25g/L，MOPS 42g/L，CaCl2 10mg/L，FeSO4·7H2O 10mg/L，MnSO4·H2O 10mg/L，ZnSO4 1mg/L，CuSO4 0.2mg/L，NiCl2·6H2O0.02 mg/L, biotin 0.2mg/L, protocatechuic acid 0.03 g/L.
Fermentation medium: 100g/L of sucrose, 30g/L of ammonium sulfate, 60g/L of calcium carbonate and MgSO4·7H2O 0.5g/L，FeSO4·7H2O 0.02g/L，MnSO4·H2O0.02 g/L, protocatechuic acid 30mg/L, biotin 50. mu.g/L, thiamine 450. mu.g/L, and the initial pH was adjusted to 7.0.
Method for knocking out gene in corynebacterium glutamicum 33a
The method comprises the following steps: extracting the genome of corynebacterium glutamicum 33a by using a bacterial genome extraction kit of Shanghai Czeri;
step two: using 33a genome as a template, using high-fidelity enzyme of Takara company, designing gene knockout specific primers to respectively amplify an upstream sequence and a downstream segment of a target gene, and obtaining a homologous arm segment of target gene deletion by a cross PCR method;
step three: connecting the homologous arm fragment to a corynebacterium glutamicum knock-out plasmid pk18mobsacB to construct a recombinant knock-out plasmid, electrically transferring the recombinant knock-out plasmid into a 33a competence, screening by using kanamycin and a 10% sucrose flat plate, and then verifying by PCR to obtain a recombinant bacterium with a knocked-out gene, namely the knocked-out recombinant bacterium.
Method for overexpression of gene in Corynebacterium glutamicum 33a
The method comprises the following steps: extracting the genome of corynebacterium glutamicum 33a by using a bacterial genome extraction kit of Shanghai Czeri;
step two: using the genome of 33a as a template, and amplifying by using high-fidelity enzyme of Takara company and gene specific primers to obtain a gene fragment;
step three: connecting the target gene fragment with an expression plasmid PDXW-10, constructing an over-expression recombinant plasmid, electrically transferring the over-expression recombinant plasmid into 33a competence, screening over-expression recombinant bacteria by using kanamycin, extracting the plasmid, and verifying to obtain correct over-expression recombinant bacteria.
Fermentation culture method of (IV) recombinant corynebacterium glutamicum
Activating the strain: inoculating recombinant corynebacterium glutamicum on a seed plate, carrying out three-region streaking, culturing for 3d, selecting a single colony, carrying out dense streaking on the seed plate, culturing for 3d, inoculating bacteria on the plate into 20mL of seed solution, carrying out overnight culture at 30 ℃ and 120rpm for about 12-16h until OD562 is 25, adding the culture solution into 25mL of fermentation medium to enable OD to be 25562Culturing at 120rpm for 5d at 1, 30 deg.C, and measuring OD every 12h562And amino acid concentration.
(V) verification of L-threonine transporter function
The addition of amino acid dipeptide is a common experimental method for functional verification of amino acid transporters. To verify the transport protein of L-threonine, L-threonine dipeptide (L-thr-thr) was synthesized in Nanjing peptide industry for L-threonine transport experiments. Activating corynebacterium glutamicum on a solid seed plate, inoculating the corynebacterium glutamicum into a liquid seed culture medium for overnight culture, and growing to a logarithmic growth phase. The cells in the logarithmic growth phase were collected, washed 2 times with CGX II minimal medium, inoculated into CGX II minimal medium, added with 3mM L-thr-thr dipeptide, and pre-cultured at 30 ℃ for 2 hours. The pre-cultured cells were collected and washed 2 times with pre-cooled CGX II minimal medium. According to initial OD562Bacterial cells were inoculated into 50mL of CGX II (8-10)In minimal medium, the transport experiment was started by adding L-thr-thr dipeptide to a final concentration of 3 mM. Sampling 1mL every 15min, immediately centrifuging the sample, taking out the supernatant, storing the supernatant in a refrigerator at-80 ℃, terminating the reaction after 120h, and then measuring the extracellular L-threonine concentration by high performance liquid chromatography.
(VI) high performance liquid chromatography for measuring L-threonine concentration
1. Solution preparation
Triethylamine acetonitrile: 0.7mL of triethylamine was added to 4.3mL of acetonitrile.
Phenyl isothiocyanate acetonitrile (PITC) solution: 25 μ L of phenylisothiocyanate was added to 2mL of acetonitrile.
Mobile phase A: 15.2g of anhydrous sodium acetate and 1850mL of water were weighed, dissolved, adjusted to pH 6.5 with glacial acetic acid, added with 140mL of acetonitrile, mixed well and filtered through a 0.45 μm organic filter.
Mobile phase B: 80% acetonitrile.
2. Amino acid sample derivatization
Taking 200 mu L of amino acid standard sample and diluted fermentation liquor sample, and adding 20 mu L of norleucine internal standard solution into each tube. Then, 100 mu L of triethylamine acetonitrile and phenyl isothiocyanate acetonitrile solution are respectively added, the mixture is evenly mixed and then stands for 1h at room temperature, 400 mu L of normal hexane is added, the mixture is violently shaken and evenly mixed and then stands for 10min, 200 mu L of lower layer solution is taken out, 800 mu L of ultrapure water is added for dilution, and then sample loading is carried out after filtration by a 0.45 mu m organic filter membrane.
HPLC reaction conditions
A chromatographic column: venusil AA, 4.6X 250nm, 5 μm; violet absorption wavelength: 254 nm; column temperature: 40 ℃; flow rate: 1 mL/min; sample introduction volume: 10 μ L. The mobile phase is eluted in a gradient way, and the elution procedure is as follows: 0-4min, 100% mobile phase a: 4-16min, 97% mobile phase A: 16-17min, 89% mobile phase A: 17-32min, 79% mobile phase A; 32-34min, 66% mobile phase A; 34-38min, 0% mobile phase A; 38.01min, 100% mobile phase A.
Example 1 Effect of L-threonine Transporter ThrE on L-threonine production by 33a
The embodiment is to verify the influence of two recombinant bacteria of the L-threonine transporter ThrE, namely a knockout recombinant bacterium and an overexpression recombinant bacterium on the L-threonine production of 33 a.
1. The thrE knockout was achieved according to the gene knockout method in Corynebacterium glutamicum 33 a.
(1) Extracting the genome of corynebacterium glutamicum 33a by using a bacterial genome extraction kit of Shanghai Czeri;
through gene sequencing, the genome of the L-threonine transporter NCgl0580 in the Corynebacterium glutamicum 33a has the nucleotide sequence shown in SEQ ID NO: 1, the total length is 903 nucleotides; the gene code is shown as SEQ ID NO: 2, and 2 is 300 amino acids.
(2) Using specific primers thrE-1: 5' -GCTCTAGACATCAATCTGGTCAACGAA and thrE-2: 5' -GACATGGAGATGAGCTAAGAATGCGGCCACGAAGGGTC amplifying the left homologous arm of the target gene; using the specific primer thrE-3: 5' -CTTAGCTCATCTCCATGTCTCAACCCATACCGTGCATT and thrE-4: 5' -CCCAAGCTTATCATCCATATAAGATCCG amplifying the right homologous arm of the target gene, and obtaining the homologous arm fragment of the target gene deletion by a cross PCR method;
(3) connecting the homologous arm fragment to a corynebacterium glutamicum knock-out plasmid pk18mobsacB to construct a recombinant knock-out plasmid, electrically transferring the recombinant knock-out plasmid into 33a competence, screening by using kanamycin and a 10% sucrose plate, and then verifying by PCR to obtain a knock-out recombinant bacterium 33a delta thrE with a knocked-out gene.
2. Overexpression of thrE was achieved as described for overexpression in C.glutamicum 33 a.
(1) Extracting the genome of corynebacterium glutamicum 33a by using a bacterial genome extraction kit of Shanghai Czeri;
(2) using the genome of Corynebacterium glutamicum 33a as a template, a high-fidelity enzyme from Takara, and a gene-specific primer thrE-F: 5' GAAGATCTAGAAGGAGATATACCATGTTGAGTTTTGCGACCCT and thrE-R: amplifying 5' -CCCAAGCTTTTACCTTTTATTACCGAATC to obtain gene segment;
(3) connecting the target gene fragment with an expression plasmid, constructing an over-expression recombinant plasmid, electrically transferring the over-expression recombinant plasmid into 33a competence, screening over-expression recombinant bacteria by using kanamycin, extracting the plasmid, and verifying to obtain correct over-expression recombinant bacteria.
The fermentation characteristics of the recombinant bacterium 33a delta thrE knocked out and the recombinant bacterium 33a-thrE overexpressed are evaluated in a fermentation medium taking 100g/L of sucrose as a substrate, and are used for explaining the influence of the fermentation medium on the L-threonine production of 33 a.
As can be seen from FIG. 1A, the starting strain 33a had an accumulated L-threonine amount of 1.9 g/L; the transporter ThrE of the L-threonine is knocked out, fermentation is carried out for 120h, the L-threonine accumulation amount of the knocked-out recombinant bacterium 33a delta thrE is 1.42g/L, and is reduced by 25.3% compared with the original strain 33a, which indicates that the transporter ThrE has obvious influence on the growth of the strain and the yield of the L-threonine;
as can be found from FIG. 1B, after ThrE is overexpressed, the accumulation amount of L-threonine of the overexpressed recombinant strain 33a-thrE is 2.3g/L, which is 21% higher than that of the original strain 33a, and the yield of L-threonine is increased, which indicates that ThrE, an L-threonine transporter, has a positive effect on the increase of the yield of L-threonine.
In view of the influence of the knockout recombinant bacterium and the overexpression recombinant bacterium on the L-threonine production of 33a obtained in example 1, the present invention was verified by example 2 in order to further examine the amino acid fragment having an influence in ThrE.
Example 2 Effect of L-threonine Transporter NCgl0580 on L-threonine production by 33a
This example is to verify the influence of two recombinant bacteria of the L-threonine transporter NCgl0580, namely a knockout recombinant bacterium and an overexpression recombinant bacterium, on the production of L-threonine by 33 a.
1. The procedure for knocking out the gene encoding NCgl0580 was as follows:
(1) extracting the genome of corynebacterium glutamicum 33a by using a bacterial genome extraction kit of Shanghai Czeri;
(2) using the specific primer NCgl 0580-1: TCCCCCGGGTTCGAGCGCTGCGGTGACT and NCgl 0580-2: GTAGACATGACGGCGACTTTGCAGGGATAGGGCGGAAC amplifying the left homology arm of the target gene; using the specific primer NCgl 0580-3:
AAGTCGCCGTCATGTCTACGTGGGCCGCGATCATCCTT and NCgl 0580-4:
GCTCTAGAATGTTCCTGTCATCGCTGG amplifying the right homologous arm of the target gene, and obtaining the homologous arm segment of the target gene deletion by a cross PCR method;
(3) connecting the homologous arm fragment to a corynebacterium glutamicum knock-out plasmid pk18mobsacB to construct a recombinant knock-out plasmid, electrically transferring the recombinant knock-out plasmid into 33a competence, screening by using kanamycin and a 10% sucrose plate, and verifying by PCR to obtain a gene-knocked-out recombinant bacterium 33a delta NCgl 0580.
2. Overexpression of NCgl0580 was achieved according to the method for overexpression in C.glutamicum 33 a.
(1) Extracting the genome of corynebacterium glutamicum 33a by using a bacterial genome extraction kit of Shanghai Czeri;
(2) using the genome of Corynebacterium glutamicum 33a as a template, a high-fidelity enzyme from Takara, and a gene-specific primer NCgl 0580-F: 5' GAAGATCTAGAAGGAGATATACCATGAATAAACAGTCCGCTGC and NCgl 0580-R: amplifying 5' -CCCAAGCTTTTACCTTTTATTACCGAATC to obtain gene segment;
(3) connecting the target gene fragment with an expression plasmid, constructing an over-expression recombinant plasmid, electrically transferring the over-expression recombinant plasmid into 33a competence, screening over-expression recombinant bacteria by using kanamycin, extracting the plasmid, and verifying to obtain correct over-expression recombinant bacteria.
The fermentation characteristics of the two recombinant bacteria were evaluated in a fermentation medium with 100g/L sucrose as a substrate, and the results are shown in FIG. 2. The starting strain 33a had an L-threonine accumulation of 1.9 g/L.
As can be seen from FIG. 2A, after NCgl0580 knockout, the L-threonine production is significantly reduced, and the L-threonine accumulation of the knockout recombinant strain 33a delta NCgl0580 is 1.51g/L and is reduced by 20.5% compared with the starting strain 33a after fermentation for 120 h.
As can be seen from FIG. 2B, after the NCgl0580 is over-expressed, the L-threonine accumulation of the over-expressed recombinant bacterium 33aNCgl0580 is 2.3g/L and is increased by 21% after fermentation for 120h, which indicates that the NCgl0580 is an extremely important transporter of L-threonine.
By comparing the technical effects of examples 1 and 2, it can be seen that the technical effects obtained in examples 1 and 2 are the same, and it is fully demonstrated that the amino acid fragment having an influence in ThrE of L-threonine transporter is NCgl 0580.
Example 3 functional verification of the L-threonine transporter NCgl0580
This example was conducted to verify the L-threonine transport function of the L-threonine transporter NCgl 0580.
The addition of amino acid dipeptide is a common experimental method for functional verification of amino acid transporters. To verify the transport protein of L-threonine, L-threonine dipeptide (L-thr-thr) was synthesized in Nanjing peptide industry for L-threonine transport experiments. Activating corynebacterium glutamicum on a solid seed plate, inoculating the corynebacterium glutamicum into a liquid seed culture medium for overnight culture, and growing to a logarithmic growth phase. The cells in the logarithmic growth phase were collected, washed 2 times with CGX II minimal medium, inoculated into CGX II minimal medium, added with 3mM L-thr-thr dipeptide, and pre-cultured at 30 ℃ for 2 hours. The pre-cultured cells were collected and washed 2 times with pre-cooled CGX II minimal medium. According to initial OD562The cells were inoculated into 50mL of CGX II minimal medium (8-10), and the transport experiment was started by adding L-thr-thr dipeptide to a final concentration of 3 mM. Sampling 1mL every 15min, immediately centrifuging the sample, taking out the supernatant, storing the supernatant in a refrigerator at-80 ℃, terminating the reaction after 120h, and then measuring the extracellular L-threonine concentration by high performance liquid chromatography.
As can be seen from FIG. 3, when threonine dipeptide was not added to CGX II medium, the L-threonine concentration in the culture medium of the recombinant knockout bacterium 33a Δ NCgl0580 was reduced by 55.7% compared to 33a, i.e., the L-threonine transport function of the NCgl 0580-knocked-out protein was rapidly decreased, indicating that NCgl0580 has the function of transporting L-threonine.
Comparative example 1
Knocking out other proteins NCgl0254 according to the gene knockout method provided by the application to obtain the knockout recombinant bacterium 33a delta NCgl 0254.
The fermentation characteristics of the knockout recombinant bacterium 33a delta NCgl0254 are evaluated in a fermentation medium taking 100g/L sucrose as a substrate, and the results show that after NCgl0254 is knocked out, the knockout strain is fermented for 120h, and the L-threonine accumulation amount of the knockout recombinant bacterium 33a delta NCgl0254 is 1.87g/L as can be seen from figure 4A, and the strain growth and the L-threonine yield are not significantly influenced compared with the starting strain 33 a.
Comparative example 2
Other proteins NCgl0254 are overexpressed according to the gene overexpression method provided by the application, and an overexpression recombinant bacterium 33a-NCgl0254 is obtained.
The fermentation characteristics of the over-expressed recombinant strain 33a-NCgl0254 were evaluated in a fermentation medium using 100g/L sucrose as a substrate, and the results showed that after the over-expression of NCgl0254, the over-expressed recombinant strain was fermented for 120h, and it can be seen from FIG. 4B that the L-threonine accumulation of the over-expressed recombinant strain 33a-NCgl0254 was 1.91g/L, which did not significantly affect the strain growth and L-threonine production compared with the starting strain 33 a.
In summary, the present invention provides a novel L-threonine transporter NCgl0580, which has the amino acid sequence of SEQ ID NO: 1, the total length is 903 nucleotides, and the code is 301 amino acids. By means of genetic engineering, the NCgl0580 is over-expressed in the Corynebacterium glutamicum 33a producing L-threonine, and the yield of L-threonine can be improved to 2.3 g/L. The method provides a new idea for improving the L-threonine yield by metabolically engineering the strain.
The invention provides a protein, which in one example is a polypeptide comprising SEQ ID NO: 1 in the sequence table 1. In other examples of the invention, the protein may be a protein represented by SEQ ID NO: 1 by substitution and/or deletion and/or addition of one or several amino acid residues and is associated with L-threonine transport and consists of SEQ ID NO: 1, or a derivative thereof. The protein of the present invention can be used in the fields of pharmaceutical, food or cosmetic products, such as L-threonine transporter, L-threonine transport promotion to the outside of microorganisms, L-threonine transport promotion to the outside of bacteria, L-threonine transport promotion to the outside of Corynebacterium glutamicum, L-threonine production, and the like, and examples of the Corynebacterium glutamicum include C.glutamicum SYPS-062-33 a.
Similarly, the invention also provides a gene for coding the protein, a recombinant expression vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the gene, a recombinant microorganism obtained by introducing the gene into a target microorganism and performing overexpression, and a kit comprising the recombinant microorganism, which are used for producing the L-threonine.
The present invention also provides a recombinant bacterium obtained by silencing a gene encoding the above protein in the genome of a target bacterium, which can be used for the production of L-threonine.
The above description is only of the preferred embodiments of the present invention, and it should be noted that: it will be apparent to those skilled in the art that various modifications and adaptations can be made without departing from the principles of the invention and these are intended to be within the scope of the invention.
Sequence listing
<110> university of south of the Yangtze river
<120> L-threonine transport protein, and coding gene and application thereof
<141> 2021-06-09
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 303
<212> PRT
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 1
Val Leu Asn Leu Asn Arg Leu His Ile Leu Gln Glu Phe His Arg Leu
1 5 10 15
Gly Thr Ile Thr Ala Val Ala Glu Ser Met Asn Tyr Ser Arg Ser Ala
20 25 30
Ile Ser Gln Gln Met Ala Leu Leu Glu Lys Glu Ile Gly Val Lys Leu
35 40 45
Phe Glu Lys Ser Gly Arg Asn Leu Tyr Phe Thr Glu Gln Gly Glu Val
50 55 60
Leu Ala Ser Glu Thr His Ala Ile Met Ala Ala Val Asp His Ala Arg
65 70 75 80
Ala Ala Val Leu Asp Ser Met Ser Glu Val Ser Gly Thr Leu Lys Val
85 90 95
Thr Ser Phe Gln Ser Leu Leu Phe Thr Leu Ala Pro Lys Ala Ile Ala
100 105 110
Arg Leu Thr Glu Lys Tyr Pro His Leu Gln Val Glu Ile Ser Gln Leu
115 120 125
Glu Val Thr Ala Ala Leu Glu Glu Leu Arg Ala Arg Arg Val Asp Val
130 135 140
Ala Leu Gly Glu Glu Tyr Pro Val Glu Val Pro Leu Val Glu Ala Ser
145 150 155 160
Ile His Arg Glu Val Leu Phe Glu Asp Ser Met Leu Leu Val Thr Pro
165 170 175
Ala Ser Gly Pro Tyr Ser Gly Leu Thr Leu Pro Glu Leu Arg Asp Ile
180 185 190
Pro Ile Ala Ile Asp Pro Pro Asp Leu Pro Ala Gly Asp Trp Val His
195 200 205
Arg Leu Cys Arg Arg Ala Gly Phe Glu Pro Arg Val Thr Phe Glu Thr
210 215 220
Ser Asp Pro Met Leu Gln Ala His Leu Val Arg Ser Gly Leu Ala Val
225 230 235 240
Thr Phe Ser Pro Thr Leu Leu Thr Pro Met Leu Glu Gly Val His Ile
245 250 255
Gln Pro Leu Pro Asp Asn Pro Thr Arg Thr Leu Tyr Thr Ala Val Arg
260 265 270
Glu Gly Arg Gln Arg His Pro Ala Ile Lys Ala Phe Arg Arg Thr Leu
275 280 285
Ala His Val Ala Lys Glu Ser Tyr Leu Glu Ala Arg Leu Val Glu
290 295 300
